Tree Position

R-M269 > L23 > Z2103 > Z2106 > Z2108 > Z2110 > Exact position not yet finalized.

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY3
B200842
22242158-G-A 20080272-G-A DYZ19 A+
20774922-G-GA 18613036-G-GA P4_Prx 22×AA*
56833517-A-T A*
20247747-C-CA 18085861-C-CA P5_Dst 10×AA*
56832598-C-T A*
56834147-C-T A*
19772026-C-T 17660146-C-T P5_Prx A*
19655203-A-G 17543323-A-G P5_Prx A*
22314207-G-T 20152321-G-T DYZ19 A*
56831622-T-C A*
25965031-A-T 23818884-A-T BY209173 P1_Y1 A*
10794243-C-T A*
13487822-A-G 11332146-A-G A*
10767801-A-C A*
10676673-G-C A*
10767803-T-C A*
10767800-A-C A*
10767797-C-T A*
20917254-C-CA 18755368-C-CA P4_Dst 14×AA*
28817453-C-T 26671306-C-T A*
26045486-A-C 23899339-A-C P1_Y1 A*
28817227-A-T 26671080-A-T A*
58980455-T-C 56834308-T-C A*
26418245-A-G 24272098-A-G P1_Y1 A*
26089227-T-TAAGAA 23943080-T-TAAGAA P1_Y1 A*
6228574-T-A 6360533-T-A IR3_Dst A*
26519786-G-A 24373639-G-A P1_Y1 A*
6961878-C-T 7093837-C-T FT61067 YY+
26334826-C-T 24188679-C-T FGC52814 P1_Y1 +
6141131-G-A 6273090-G-A BY59231 IR3_Dst +
21219817-C-A 19057931-C-A BY208161 YY+
14096487-C-T 11975781-C-T YY+
14124949-G-A 12004243-G-A YY+
14996318-G-A 12884403-G-A FT61489 YY+
14917570-G-A 12805637-G-A BY98474 YY+
7083290-G-A 7215249-G-A YY+
7193627-G-A 7325586-G-A YY+
15655701-C-G 13543821-C-G FT61550 YY+
15822306-A-G 13710426-A-G FT61586 YY+
7990064-G-A 8122023-G-A FT61168 YY+
8107990-C-T 8239949-C-T YY+
16250153-A-C 14138273-A-C FT61625 YY+
7417006-G-A 7548965-G-A YY+
8106092-G-A 8238051-G-A YY+
10892091-C-T FT435696 +
10760500-G-A FT430005 +
8273199-C-T 8405158-C-T FT61196 YY+
2862761-G-T 2994720-G-T FT60497 YY+
4661190-A-G 4793149-A-G FT16723 +
4661189-G-T 4793148-G-T FT16722 +
4193513-C-T 4325472-C-T FT16187 +
4191567-C-G 4323526-C-G FT27921 +
4173678-C-T 4305637-C-T FT16159 +
8358452-G-C 8490411-G-C FT61203 YY+
8577771-G-A 8709730-G-A FGC47254 YY+
3636759-C-G 3768718-C-G FT15507 +
8984459-T-C 9146850-T-C FT61264 +
2732839-T-C 2864798-T-C FT60489 YY+
4780352-G-A 4912311-G-A FT60778 +
9092220-G-A 9254611-G-A FT61276 Y+
17016357-G-A 14904477-G-A YY+
5431037-T-C 5562996-T-C FT60863 +
5553618-GTTATC-G 5685577-GTTATC-G +
2695769-A-G 2827728-A-G YY+
9898952-G-A 10061343-G-A Y+
5733626-CTTTT-C 5865585-CTTTT-C +
10665180-A-G FT91503 +
10684555-GTCCATTCCATTCCAT-G +
16477707-C-T 14365827-C-T YY+
7880817-C-T 8012776-C-T FT61156 YY+
17411361-C-T 15299481-C-T FT61772 YY+
21130800-G-A 18968914-G-A YY+
28609941-A-G 26463794-A-G FT62308 Y+
14852779-T-A 12740845-T-A BY11189 YY+
28500554-A-G 26354407-A-G BY150614 Y+
28463299-C-A 26317152-C-A +
7850298-A-C 7982257-A-C BY19950S10738 YY+
23607612-T-G 21445726-T-G YY+
23536183-A-G 21374297-A-G FT62248 YY+
22990700-G-A 20828814-G-A FT26314 Y+
22651746-CTA-C 20489860-CTA-C +
18096080-G-A 15984200-G-A Z16472 YY+
22612192-T-G 20450306-T-G YY+
22172959-G-A 20011073-G-A FT25945 Y+
19317361-C-T 17205481-C-T FT61989 YY+
18673807-G-A 16561927-G-A FT24380 YY+
18824929-T-C 16713049-T-C FT61917 YY+
18018894-C-T 15907014-C-T Y+
28800095-T-TGA 26653948-T-TGA *
5862541-T-C 5994500-T-C *
4997519-C-CAG 5129478-C-CAG 16×AG*
22316966-T-C 20155080-T-C Y17629 DYZ19 *
5862555-CAT-C 5994514-CAT-C *
20931853-A-ATG 18769967-A-ATG P4_Dst 18×TG*
23966967-T-TTG 21820820-T-TTG 10×TG*
17274955-TAGATAGAC-T,TAGATAGAT 15163075-TAGATAGAC-T,TAGATAGAT *
28807115-C-T 26660968-C-T FT148754BY40553 *
28620205-A-C 26474058-A-C Z7975 **
13468672-A-G 11312996-A-G **
8169268-A-AT 8301227-A-AT 10×T**
4188898-A-C 4320857-A-C FT16178 **
14319448-GAT-G 12198742-GAT-G 8×AT**
4151420-T-C 4283379-T-C **
10079211-T-C 10241602-T-C **
14016667-G-A 11895961-G-A FT12941 **
5491261-C-CAA 5623220-C-CAA 18×A**
8822570-A-G 8954529-A-G **
18863991-A-G 16752111-A-G **
7201630-C-CT 7333589-C-CT 11×T**
22460843-T-G 20298957-T-G DYZ19 **
9716298-A-G 9878689-A-G IR3_Prx **
22473666-C-G 20311780-C-G BY222964 DYZ19 **
17632788-C-T 15520908-C-T **
19043595-C-A 16931715-C-A **
4890660-CAAAA-C 5022619-CAAAA-C 18×A**
23572484-C-T 21410598-C-T BY9466 13×GT**
19143253-T-C 17031373-T-C **
18890882-ATTT-A 16779002-ATTT-A 17×T**
28725510-T-G 26579363-T-G FT27308 **
3240658-ATT-A 3372617-ATT-A 13×T**
11022840-AT-A ***
13468648-C-CAGG 11312972-C-CAGG **
13468650-ACC-A 11312974-ACC-A **
7305124-C-A 7437083-C-A **
2697794-TA-T 2829753-TA-T 10×A**
19048386-T-G 16936506-T-G **
8172687-CTTTTT-C 8304646-CTTTTT-C 22×T**
13725144-A-G 11569468-A-G **
13713650-T-A 11557974-T-A **
13467348-T-C 11311672-T-C **
19048388-T-G 16936508-T-G BY125785 **
6936292-G-T 7068251-G-T **
19128007-G-A 17016127-G-A FT181690 **
27701739-G-A 25555592-G-A P1_Y2 **
19199320-A-AT 17087440-A-AT 9×T**
10896417-C-T **
28601002-G-GT 26454855-G-GT ***
16395075-T-TG 14283195-T-TG ***
17787106-CA-C,CAA 15675226-CA-C,CAA 19×A***
8281836-TA-T 8413795-TA-T ***
18565061-CAAAAA-C 16453181-CAAAAA-C 27×A***
9942043-ATT-A,ATTT 10104434-ATT-A,ATTT 28×T***
16321430-C-A 14209550-C-A ***
13454870-T-C 11299194-T-C ***
14704733-A-T 12592799-A-T ***
14704730-T-A 12592796-T-A ***
14704728-T-G 12592794-T-G ***
13969060-C-T 11848354-C-T ***
13467337-G-A 11311661-G-A ***
13467336-A-C 11311660-A-C ***
13467325-C-T 11311649-C-T ***
13420790-C-G 11265114-C-G ***
23011258-A-G 20849372-A-G ***
13374326-A-G 11218650-A-G ***
10956561-CTCCATTCCATTCCATTCCATTCCAT-C,CTCCATTCCATTCCATTCCAT ***
20804822-T-C 18642936-T-C P4_Gap ***
15406939-TAAA-T,TAAAAA 13295059-TAAA-T,TAAAAA 20×A***
21475931-G-A 19314045-G-A ***
15445475-T-C 13333595-T-C ***
16000916-T-C 13889036-T-C ***
15951464-T-C 13839584-T-C ***
13349042-T-C 11193366-T-C ***
7650599-G-A 7782558-G-A ***
15733879-CAAA-C 13621999-CAAA-C 25×A***
14888076-CTT-C 12776142-CTT-C 17×T***
15020595-AT-A 12908684-AT-A 8×T***
13513143-A-AC 11357467-A-AC 9×C***
5252833-ATT-A 5384792-ATT-A 16×T***
4207957-CAAA-C 4339916-CAAA-C 22×A***
13480284-G-A 11324608-G-A ***
18861371-CT-C 16749491-CT-C 11×T***
13478910-G-A 11323234-G-A ***
13921125-CA-C 11800419-CA-C 10×A***
13195525-C-A 11039849-C-A ***
13487828-A-T 11332152-A-T ***
13705592-C-T 11549916-C-T ***
10770494-C-CTTCCA ***
10810562-A-G ***
13462335-A-G 11306659-A-G ***
10772538-A-T ***
13470029-A-T 11314353-A-T ***
21468745-ATTT-A,ATT 19306859-ATTT-A,ATT 25×T***
13349054-G-A 11193378-G-A ***
13470627-C-G 11314951-C-G ***
11002112-T-A ***
3301243-TTA-T 3433202-TTA-T 8×TA***
13456303-C-G 11300627-C-G ***
13446577-T-C 11290901-T-C ***
13474059-G-A 11318383-G-A ***
19206934-T-TTA 17095054-T-TTA 10×TA***
13488831-C-T 11333155-C-T ***
18672379-TTTTA-T 16560499-TTTTA-T 8×TTTA***
18804474-AAGAGAGAGAG-A 16692594-AAGAGAGAGAG-A 26×AG***
21343193-T-TG 19181307-T-TG 10×G***
5862533-T-G 5994492-T-G ***
16494317-A-AAT 14382437-A-AAT 11×AT***
21068499-AAC-A 18906613-AAC-A ***
21477223-CTTA-C 19315337-CTTA-C ***
58974788-G-A 56828641-G-A ***
59017779-AT-A 56871632-AT-A ***
4466106-A-G 4598065-A-G ***
13349048-C-T 11193372-C-T FGC16807 ***
14392761-GTC-G 12272057-GTC-G ***
19138271-CAT-C 17026391-CAT-C ***
6493953-C-CA 6625912-C-CA 19×A***
28587735-ATAG-A 26441588-ATAG-A ***
22011557-CAAA-C 19849671-CAAA-C 21×A***
7269610-CTTT-C,CTT 7401569-CTTT-C,CTT 22×T***
13349064-A-T 11193388-A-T ***
16471361-C-T 14359481-C-T FT143923 ***
5177121-CAA-C 5309080-CAA-C 15×A***
13470610-C-A 11314934-C-A ***
13465727-C-T 11310051-C-T ***
13465731-G-C 11310055-G-C ***
14510449-GAA-G,GA 12398654-GAA-G,GA 21×A***
4897963-CAA-C,CA 5029922-CAA-C,CA 20×A***
56869320-T-C ***
13868350-A-G 11747644-A-G ***
13453485-A-T 11297809-A-T ***
13467296-T-A 11311620-T-A ***
2698238-T-A 2830197-T-A ***
3478355-CTTT-C,CTT 3610314-CTTT-C,CTT 14×T***
3491077-G-A 3623036-G-A ***
3910070-TAA-T 4042029-TAA-T 12×A***
4123368-T-C 4255327-T-C ***
5088909-A-G 5220868-A-G ***
6046214-T-C 6178173-T-C ***
21148503-C-A 18986617-C-A ***
10954280-G-GCATTC ***
14826548-GTTTT-G 12714615-GTTTT-G 19×T***
22587954-CA-C,CAA 20426068-CA-C,CAA 13×A***
28724174-ATTT-A 26578027-ATTT-A 20×T***
13808742-A-AAGCAG 11688036-A-AAGCAG ***
8468065-CAAAAAA-C 8600024-CAAAAAA-C 24×A***
21146240-C-CT 18984354-C-CT 10×T***
12869906-T-TTTCCTTCC 14×TTCC***
18106353-G-GTT 15994473-G-GTT 15×T***
14774253-CTTT-C 12662322-CTTT-C 28×T***
13462154-A-C 11306478-A-C ***
4151936-C-CA 4283895-C-CA 17×A***
4409081-A-ATT 4541040-A-ATT 12×T***
15848964-A-T 13737084-A-T ***
10776541-C-G ***
4937662-GT-G 5069621-GT-G 12×T***
16309531-C-A 14197651-C-A ***
13349045-T-G 11193369-T-G ***
13349080-A-G 11193404-A-G ***
13463091-GCC-G 11307415-GCC-G ***
7758491-GTT-G 7890450-GTT-G 17×T***
23231613-A-G 21069727-A-G ***
56871190-T-G ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: B2008421472672092385908219649
Used in age calculations1472672092385908219649
Counts of SNPs3938
Variant counts last updated 2022-07-30 03:30:00.



Big Tree Main Page