Tree Position

R-P312/S116 > Z40481 > ZZ11 > DF27/S250 > ZZ12 > FGC78762 > ZZ19 > Exact position not yet finalized.

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY3
873766
24876892-A-T 22730745-A-T g1 A+
18310884-C-T 16199004-C-T P6_Prx A*
28817717-G-T 26671570-G-T A*
3015864-G-A 3147823-G-A A*
24254773-C-T 22108626-C-T P3_b1 A*
24349885-G-T 22203738-G-T P3_t1 A*
25917009-G-C 23770862-G-C P1_Y1 A*
26152312-A-ATT 24006165-A-ATT P1_Y1 A*
26368518-A-G 24222371-A-G P1_Y1 A*
6183795-A-G 6315754-A-G IR3_Dst A*
11015142-C-T A*
7471337-T-A 7603296-T-A IR1_L A*
21464783-C-G 19302897-C-G YYA*
22893336-T-C 20731450-T-C YYA*
18286381-G-T 16174501-G-T P6_Prx A*
56833641-T-G A*
9437710-G-T 9600101-G-T FT8915 YY+
22799906-CT-C 20638020-CT-C +
20813952-A-G 18652066-A-G P4_Gap +
9013355-C-T 9175746-C-T FT8863 Y+
9956446-G-A 10118837-G-A Y+
22437181-ATG-A 20275295-ATG-A DYZ19 +
22437184-T-A 20275298-T-A DYZ19 +
21292862-G-T 19130976-G-T FT10636 YY+
8594232-G-A 8726191-G-A BY173660 YY+
11666508-A-T +
14213268-G-T 12092562-G-T FT9192 YY+
14049300-G-A 11928594-G-A FT9123 YY+
14174016-C-T 12053310-C-T FT9167 YY+
14211990-C-T 12091284-C-T FT9188 YY+
8541566-A-G 8673525-A-G FT8749 YY+
15156358-T-C 13044445-T-C FT9446 YY+
15688822-C-T 13576942-C-T FT9564 YY+
15768329-G-A 13656449-G-A FT9587 YY+
16623859-C-T 14511979-C-T Y+
16788261-G-A 14676381-G-A FT9836 YY+
16882345-A-G 14770465-A-G FT9853 Y+
17272653-TC-T 15160773-TC-T +
17881356-T-C 15769476-T-C FT10125 YY+
18100924-C-A 15989044-C-A FT10199 YY+
18270043-A-G 16158163-A-G FT10240 +
8553652-T-G 8685611-T-G FT8750 YY+
13827143-A-T 11706437-A-T FT8997 +
8190119-T-G 8322078-T-G FT8664 YY+
8041993-G-A 8173952-G-A YY+
5482677-C-T 5614636-C-T FT7927 +
28730906-CTCTT-C 26584759-CTCTT-C +
21552475-G-C 19390589-G-C FT10731 Y+
28546218-G-A 26400071-G-A FT11367 +
16488586-C-T 14376706-C-T BY108170 YY+
28512553-G-C 26366406-G-C FT11356 +
28504865-A-G 26358718-A-G FT11354 Y+
10652679-A-T +
5130944-C-A 5262903-C-A FT7753 +
10813461-C-A +
24499181-A-G 22353034-A-G FT11334 +
17277287-G-A 15165407-G-A FT9936 YY+
23540897-C-T 21379011-C-T FT11204 YY+
3786612-A-T 3918571-A-T FT7177 +
3979736-C-CAA 4111695-C-CAA +
4157302-ACAAT-A 4289261-ACAAT-A +
23345294-C-T 21183408-C-T FT11147 YY+
23151111-C-T 20989225-C-T FT11085 YY+
23081807-A-T 20919921-A-T YY+
5251933-C-T 5383892-C-T FT7815 +
5481935-G-A 5613894-G-A FT7925 +
6435601-T-G 6567560-T-G FT8228 +
6503896-A-G 6635855-A-G FT8257 +
19476982-A-T 17365102-A-T FT10554 YY+
7531464-C-G 7663423-C-G FT8510 YY+
7572596-C-T 7704555-C-T FT8519 YY+
7734243-T-A 7866202-T-A FT8563 YY+
7095668-G-A 7227627-G-A FT8398 YY+
20931938-A-G 18770052-A-G P4_Dst *
20712240-T-C 18550354-T-C P4_Prx *
3480816-A-ATG 3612775-A-ATG 13×TG*
56868950-C-G *
13271877-G-A 11116201-G-A *
22225057-G-T 20063171-G-T DYZ19 *
23087338-C-A 20925452-C-A **
56855201-T-C **
4419900-C-T 4551859-C-T **
19696433-TAAA-T 17584553-TAAA-T P5_Prx 14×A**
25978216-T-A 23832069-T-A P1_Y1 **
16101996-CTTTT-C 13990116-CTTTT-C P8_Prx 19×T**
17627762-C-T 15515882-C-T **
4229216-T-C 4361175-T-C **
4229217-G-A 4361176-G-A **
23114036-TATATATATA-T 20952150-TATATATATA-T **
18612759-G-GTATATATATATA 16500879-G-GTATATATATATA 15×TA**
4229222-C-T 4361181-C-T **
9114274-G-C **
10654536-C-T **
22442241-G-C 20280355-G-C DYZ19 **
22441729-G-A 20279843-G-A DYZ19 **
10652274-T-C ***
3573338-G-A 3705297-G-A ***
13446823-TTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCAT-T,TTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCAC 11291147-TTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCAT-T,TTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCAC ***
28815024-G-A 26668877-G-A ***
28815016-C-T 26668869-C-T ***
28815009-T-C 26668862-T-C ***
17923734-G-A 15811854-G-A ***
17923743-G-A 15811863-G-A ***
10652269-T-C ***
18006687-AATTATT-A 15894807-AATTATT-A P7_Gap 11×ATT***
26204640-T-TC 24058493-T-TC P1_Y1 ***
22893344-T-C 20731458-T-C ***
17923746-A-AAG 15811866-A-AAG 11×AAAG***
28815006-T-G 26668859-T-G ***
8468065-CA-C,CAA 8600024-CA-C,CAA 24×A***
56867491-ATTTTTTTTT-A,ATATTTTTTT 11×T***
9924392-T-C 10086783-T-C ***
3451063-C-G 3583022-C-G ***
22893336-T-TCTTTCTTC 20731450-T-TCTTTCTTC ***
24047559-AG-A 21901412-AG-A ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 8737661519743595287038377881
Used in age calculations1519743595287038377881
Counts of SNPs3432
Variant counts last updated 2019-07-19 21:40:30.



Big Tree Main Page