Tree Position

R-P312/S116 > Z46577 > Z290 > L21/S145 > S552 > DF13 > Z39589 > DF49/S474 > Z2980 > Z2976 > DF23 > Z2961 > Z2956 > M222 > Z2959 > Z46375 > DF106 > DF104 > DF105 > FGC23742 > A1206 > FGC23739 > BY11687 > BY11688 > BY43720 > Z34649 > FT43311

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

Position Blocks Names Region McDonald BED combBED STRBigY3
MI40896
hg19:Y:24430070-C-T hg38:Y:22283923-C-T FT37969 YA*
hg19:Y:24387686-A-C hg38:Y:22241539-A-C FT332825 **
hg19:Y:24252239-G-GA hg38:Y:22106092-G-GA P3_b1 8×A**
hg38:Y:10949437-G-C **
hg38:Y:56742645-T-C **
hg19:Y:10043030-C-T hg38:Y:10205421-C-T **
hg19:Y:4123517-A-G hg38:Y:4255476-A-G **
hg19:Y:4123522-T-C hg38:Y:4255481-T-C **
hg19:Y:4949963-A-G hg38:Y:5081922-A-G **
hg19:Y:6279366-A-G hg38:Y:6411325-A-G IR3_Dst **
hg19:Y:6329480-G-T hg38:Y:6461439-G-T IR3_Dst **
hg38:Y:10776276-T-C **
hg19:Y:16687696-C-T hg38:Y:14575816-C-T **
hg19:Y:18361645-G-T hg38:Y:16249765-G-T P6_Prx **
hg19:Y:19871552-A-G hg38:Y:17759672-A-G P5_Prx **
hg19:Y:20018769-A-C hg38:Y:17906889-A-C P5_Prx **
hg19:Y:20622997-C-A hg38:Y:18461111-C-A P4_Prx **
hg19:Y:20622999-G-T hg38:Y:18461113-G-T P4_Prx **
hg19:Y:20701214-CTT-C hg38:Y:18539328-CTT-C P4_Prx 13×T**
hg19:Y:27692913-T-C hg38:Y:25546766-T-C P1_Y2 **
hg19:Y:13482484-A-G hg38:Y:11326808-A-G ***
hg38:Y:11014321-G-A ***
hg38:Y:56828834-AATTCCATTCG-A,AATTCCATTCCATTCCATTTG ***
hg19:Y:2649802-CAAAA-C,CAAA hg38:Y:2781761-CAAAA-C,CAAA 24×A***
hg19:Y:13469353-C-A hg38:Y:11313677-C-A ***
hg19:Y:28797791-T-C hg38:Y:26651644-T-C ***
hg19:Y:6059092-CAAAAA-C hg38:Y:6191051-CAAAAA-C 25×A***
hg19:Y:13222637-A-C hg38:Y:11066961-A-C ***
hg19:Y:13470914-CACCG-C hg38:Y:11315238-CACCG-C ***
hg19:Y:13482402-A-C hg38:Y:11326726-A-C ***
hg38:Y:12374290-G-A ***
hg19:Y:17006435-T-C hg38:Y:14894555-T-C ***
hg19:Y:17155448-T-C hg38:Y:15043568-T-C ***
hg19:Y:21824286-C-A hg38:Y:19662400-C-A FT35231 ***
hg19:Y:22287748-C-G hg38:Y:20125862-C-G DYZ19 ***
hg19:Y:22528186-C-T hg38:Y:20366300-C-T ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: MI408961513982794786098351337
Used in age calculations1513982794786098351337
Counts of SNPs01
Variant counts last updated 2026-04-30 02:57:43.



Big Tree Main Page