Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > DF21/S192 > FGC3213 > ZZ1 > S3058 > S424 > S426 > S190 > FGC3215 > FGC3216 > FGC3197 > FGC3198

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFB38
92306-A
BigY3
92306
20222940-C-T 18061054-C-T P5_Dst ***A*
20296881-G-C 18134995-G-C P5_Dst A*
13823241-T-A 11702535-T-A A*
4026208-C-A 4158167-C-A A*
3563184-G-A 3695143-G-A A*
5604530-C-A 5736489-C-A FT39711 **+
21485475-G-A 19323589-G-A FT43644 YY++
8858141-G-A 8990100-G-A FT40989 YY++
18964816-G-C 16852936-G-C FT43213 YY++
4793390-T-C 4925349-T-C FT39258 **+
15989655-G-A 13877775-G-A FT42130 YY++
28611981-C-A 26465834-C-A FT44579 **+
18707262-G-T 16595382-G-T FT43114 YY++
22291829-CGTTA-TGTTG 20129943-CGTTA-TGTTG DYZ19 *
22236219-CAA-AAA,AAT 20074333-CAA-AAA,AAT DYZ19 *
9340831-AACAC-A 9503222-AACAC-A 22×AC*
10693579-TTT-GTC,TTC *
22367981-GCAGT-ACAGC 20206095-GCAGT-ACAGC DYZ19 *
10849636-AACACTACAC-AACAC,TTCACTACAG *
13470545-AGCC-GGCT 11314869-AGCC-GGCT *
13489766-ACCCGGCC-CGACCGCA 11334090-ACCCGGCC-CGACCGCA *
22477572-TTGTT-GTGTG,GTGTT 20315686-TTGTT-GTGTG,GTGTT DYZ19 *
9211352-AACACACACACACACAC-A,AACACACACACACAC 9373743-AACACACACACACACAC-A,AACACACACACACAC 22×AC*
28587715-CC-TCG 26441568-CC-TCG *
17507641-GT-A 15395761-GT-A *
7474374-AAGAGAG-A,AAG 7606333-AAGAGAG-A,AAG IR1_L 21×AG*
22359069-CAGAA-AAGAG 20197183-CAGAA-AAGAG DYZ19 *
22454821-TTATG-GTCTT 20292935-TTATG-GTCTT DYZ19 *
59025134-A-G 56878987-A-G *
9191076-AACAC-A 9353467-AACAC-A 20×AC*
17507641-GT-G 15395761-GT-G *
27055693-CTT-C,CT 24909546-CTT-C,CT P1_r4 18×T*
9347709-T-G 9510100-T-G Y*
24934025-C-T 22787878-C-T g1 *
24047695-GA-CG 21901548-GA-CG *
28363317-AT-A 26217170-AT-A P1_gr2 14×T**
21746379-C-T 19584493-C-T ****
27877440-G-A 25731293-G-A P1_Y2 **
19768203-A-T 17656323-A-T P5_Prx **
13727244-ACG-CCT 11571568-ACG-CCT **
19832911-TA-T 17721031-TA-T P5_Prx 9×A**
13726316-G-T 11570640-G-T **
20022443-C-A 17910563-C-A P5_Prx 24×T**
13721649-G-T 11565973-G-T **
20620714-A-T 18458828-A-T P4_Prx **
13716447-CG-GC 11560771-CG-GC **
13708384-A-T 11552708-A-T **
27438827-CT-C 25292680-CT-C P1_Y2 20×T**
25940446-T-A 23794299-T-A P1_Y1 **
21949709-T-C 19787823-T-C ****
26407014-T-G 24260867-T-G P1_Y1 **
13734238-AAT-CAG 11578562-AAT-CAG **
6128312-C-A 6260271-C-A **
4880709-G-TT 5012668-G-TT 22×T**
4292223-G-A 4424182-G-A **
28449637-C-CT 26303490-C-CT P1_gr2 17×T**
27492911-T-G 25346764-T-G P1_Y2 **
25409789-G-T 23263642-G-T P2_r2 **
13727953-A-T 11572277-A-T **
20141149-C-CT 18029269-C-CT P5_Dst 12×T**
13735846-G-T 11580170-G-T **
27517816-C-A 25371669-C-A P1_Y2 **
24646349-TC-T 22500202-TC-T P3_b2 **
25658011-GTT-G 23511864-GTT-G P1_b3 24×T**
25921854-T-C 23775707-T-C P1_Y1 **
26906694-G-GAA 24760547-G-GAA P1_r3 19×A**
27398510-CAA-C 25252363-CAA-C P1_g3 23×A**
27411141-A-G 25264994-A-G P1_g3 **
27442383-A-T 25296236-A-T P1_Y2 **
27542744-A-C 25396597-A-C P1_Y2 **
22355726-C-A 20193840-C-A DYZ19 **
27579890-C-T 25433743-C-T P1_Y2 **
27659157-G-GA 25513010-G-GA P1_Y2 13×A**
27799914-C-T 25653767-C-T P1_Y2 **
27804388-T-C 25658241-T-C P1_Y2 **
27924459-C-A 25778312-C-A P1_Y2 **
28385031-C-T 26238884-C-T P1_gr2 **
28385085-A-T 26238938-A-T P1_gr2 **
28385109-A-G 26238962-A-G P1_gr2 **
21778783-G-A **
21631150-T-G 19469264-T-G **
13735850-G-T 11580174-G-T **
18530394-C-T 16418514-C-T P6_Dst **
15806192-C-A 13694312-C-A **
15835396-G-C 13723516-G-C **
17301260-AAGAAAAGAAAAAAAAGAAGCGGT-GAAAAGAAAAAAAAGAAGCGGG 15189380-AAGAAAAGAAAAAAAAGAAGCGGT-GAAAAGAAAAAAAAGAAGCGGG **
21757553-AAA-GAT **
19700241-CAAAA-C 17588361-CAAAA-C P5_Prx 19×A**
16709236-A-C 14597356-A-C **
17726560-G-A 15614680-G-A **
17726580-C-T 15614700-C-T **
18530399-TA-CG 16418519-TA-CG P6_Dst **
20570925-G-A 18409039-G-A P5_Dst **
18530413-G-A 16418533-G-A P6_Dst **
18530434-AC-CA 16418554-AC-CA P6_Dst **
18535386-G-T 16423506-G-T P6_Dst **
20083464-TTTTA-T 17971584-TTTTA-T P5_Dst 5×TTTA**
20264750-T-C 18102864-T-C P5_Dst **
20336969-C-A 18175083-C-A P5_Dst **
20493759-A-G 18331873-A-G P5_Dst **
20509521-T-C 18347635-T-C P5_Dst **
6359095-CAAAAAAA-C 6491054-CAAAAAAA-C 30×A**
28407539-C-T 26261392-C-T P1_gr2 **
19600369-A-T 17488489-A-T P5_Prx **
21631108-A-G 19469222-A-G **
21631117-A-T 19469231-A-T **
28214049-C-CT 26067902-C-CT P1_b4 14×T**
13724165-C-A 11568489-C-A **
20127900-G-GC 18016020-G-GC FGCLR88 P5_Dst **
18316529-CAA-C 16204649-CAA-C P6_Prx 27×A**
22236528-TA-AT 20074642-TA-AT DYZ19 **
21002535-T-C 18840649-T-C P4_Dst 16×TC**
9959860-TAATTAATAAT-C 10122251-TAATTAATAAT-C **
8296260-C-A 8428219-C-A **
18329043-C-CTT 16217163-C-CTT P6_Prx 17×T**
13745182-A-C 11589506-A-C **
22348898-T-C 20187012-T-C DYZ19 **
27466757-T-G 25320610-T-G P1_Y2 **
26428127-C-A 24281980-C-A P1_Y1 **
27056889-ATT-A 24910742-ATT-A P1_r4 19×T**
26124426-C-A 23978279-C-A P1_Y1 **
13467197-CCGTG-AAGTT 11311521-CCGTG-AAGTT **
5531271-C-T 5663230-C-T **
15290954-ATTT-A 13179053-ATTT-A 17×T****
22355626-A-G 20193740-A-G DYZ19 **
26558021-T-C 24411874-T-C P1_g2 **
13476662-AAACC-GAATG 11320986-AAACC-GAATG **
15102593-T-C 12990681-T-C *****
19326897-C-T 17215017-C-T *****
14134925-C-CT 12014219-C-CT 10×T*****
8814327-A-T 8946286-A-T ****
22229646-AAGA-TAGT 20067760-AAGA-TAGT DYZ19 ***
25529718-C-T 23383571-C-T P1_gr1 ***
9623645-T-TA 9786036-T-TA IR3_Prx 11×A***
17596201-GTA-G 15484321-GTA-G ***
25165648-CTT-C 23019501-CTT-C g1 22×T***
25362145-C-T 23215998-C-T P2_r2 ***
25674539-C-T 23528392-C-T P1_b3 ***
25375046-A-G 23228899-A-G P2_r2 ***
21024737-G-T 18862851-G-T P4_Dst ***
25440714-C-T 23294567-C-T P2_r2 ***
25529756-T-A 23383609-T-A P1_gr1 ***
25529749-A-G 23383602-A-G P1_gr1 ***
25453956-T-A 23307809-T-A P2_r2 ***
25650303-C-T 23504156-C-T P1_b3 ***
25649929-C-T 23503782-C-T P1_b3 ***
24904674-GTT-G,GTTT 22758527-GTT-G,GTTT g1 21×T***
25454490-T-C 23308343-T-C P2_r2 ***
27711690-C-CT 25565543-C-CT P1_Y2 17×T***
25500519-C-A 23354372-C-A P2_r2 ***
25529676-A-G 23383529-A-G P1_gr1 ***
25529744-T-A 23383597-T-A P1_gr1 ***
9591034-GA-G 9753425-GA-G IR3_Prx 12×A***
22355736-T-G 20193850-T-G DYZ19 ***
24862250-CA-C 22716103-CA-C IR1_R 28×A***
22341427-T-A 20179541-T-A DYZ19 ***
22367963-A-T 20206077-A-T DYZ19 ***
22451356-AAT-CAA 20289470-AAT-CAA DYZ19 ***
22357810-T-C 20195924-T-C DYZ19 ***
22457013-ATC-GTT 20295127-ATC-GTT DYZ19 ***
22475178-ATGA-TTGC 20313292-ATGA-TTGC DYZ19 ***
58996556-A-T 56850409-A-T ***
22479943-A-C 20318057-A-C BY25227 DYZ19 ***
22484568-A-T 20322682-A-T DYZ19 ***
22341495-T-A 20179609-T-A DYZ19 ***
22479905-G-T 20318019-G-T BY25225 DYZ19 ***
21786642-T-C ***
24068253-T-C 21922106-T-C P3_b1 ***
22259423-TGTCCT-ATGTTCG 20097537-TGTCCT-ATGTTCG DYZ19 ***
24490720-G-A 22344573-G-A ***
24490741-G-T 22344594-G-T ***
24526429-G-T 22380282-G-T P3_t2 ***
9964373-G-T 10126764-G-T ***
24552403-A-T 22406256-A-T P3_t2 ***
24581767-G-A 22435620-G-A P3_t2 ***
24596611-A-G 22450464-A-G P3_t2 ***
24606967-G-T 22460820-G-T P3_t2 ***
24612175-C-G 22466028-C-G P3_t2 ***
24619510-G-T 22473363-G-T P3_t2 ***
27275864-T-C 25129717-T-C P1_g3 ***
22479891-C-T 20318005-C-T BY18419BY25224 DYZ19 ***
24542371-G-A 22396224-G-A P3_t2 ***
27280269-A-G 25134122-A-G P1_g3 ***
26985038-T-C 24838891-T-C P1_r4 ***
28361206-T-C 26215059-T-C P1_gr2 ***
27836007-G-C 25689860-G-C P1_Y2 ***
27955990-G-A 25809843-G-A P1_Y2 ***
27986716-T-C 25840569-T-C P1_Y2 ***
28023171-A-G 25877024-A-G P1_Y2 ***
28036866-G-A 25890719-G-A P1_Y2 ***
28345554-A-C 26199407-A-C P1_gr2 ***
28347134-T-C 26200987-T-C P1_gr2 ***
28347220-C-T 26201073-C-T P1_gr2 ***
28347278-C-T 26201131-C-T P1_gr2 ***
28349003-G-C 26202856-G-C P1_gr2 ***
28351222-T-C 26205075-T-C P1_gr2 ***
28357978-A-G 26211831-A-G P1_gr2 ***
28372521-C-T 26226374-C-T P1_gr2 ***
27819259-C-T 25673112-C-T P1_Y2 ***
28376552-A-T 26230405-A-T P1_gr2 ***
28380450-A-G 26234303-A-G P1_gr2 ***
28384225-TAA-T 26238078-TAA-T P1_gr2 13×A***
20914498-CA-C 18752612-CA-C P4_Dst 12×A***
25431792-C-CT 23285645-C-CT P2_r2 10×T***
20134533-TA-T 18022653-TA-T P5_Dst 11×A***
28391273-A-C 26245126-A-C P1_gr2 ***
28392689-G-A 26246542-G-A P1_gr2 ***
28412031-G-T 26265884-G-T P1_gr2 ***
28415228-TG-CC 26269081-TG-CC P1_gr2 ***
28418719-G-C 26272572-G-C P1_gr2 ***
28425627-T-C 26279480-T-C P1_gr2 ***
25334270-G-T 23188123-G-T P2_r1 18×A***
27820230-A-G 25674083-A-G P1_Y2 ***
20348650-AT-A 18186764-AT-A P5_Dst 9×T***
27072411-T-C 24926264-T-C P1_r4 ***
24675448-CT-C 22529301-CT-C P3_b2 12×T***
27146549-A-G 25000402-A-G P1_g3 10×T***
27152856-CT-C 25006709-CT-C P1_g3 8×T***
27204574-C-T 25058427-C-T P1_g3 ***
27247447-G-A 25101300-G-A P1_g3 ***
27247972-T-A 25101825-T-A P1_g3 ***
20936910-C-A 18775024-C-A P4_Dst ***
27394633-G-A 25248486-G-A P1_g3 ***
22487532-A-T 20325646-A-T DYZ19 ***
17859336-C-T 15747456-C-T CTS8171 ***
22364435-G-C 20202549-G-C DYZ19 ***
27471965-C-A 25325818-C-A P1_Y2 ***
27480337-TCA-T 25334190-TCA-T P1_Y2 ***
27483084-GCCTT-ACCTC 25336937-GCCTT-ACCTC P1_Y2 ***
27544126-AT-A 25397979-AT-A P1_Y2 11×T***
22484904-T-C 20323018-T-C DYZ19 ***
27551819-A-G 25405672-A-G P1_Y2 ***
27552106-G-A 25405959-G-A P1_Y2 ***
27553635-T-C 25407488-T-C P1_Y2 ***
27558623-G-T 25412476-G-T P1_Y2 ***
27575352-CAA-C,CA 25429205-CAA-C,CA P1_Y2 13×A***
27582244-C-T 25436097-C-T P1_Y2 ***
27601903-G-T 25455756-G-T P1_Y2 ***
27635497-TGTGC-T 25489350-TGTGC-T P1_Y2 ***
27650687-G-T 25504540-G-T P1_Y2 ***
27653583-G-C 25507436-G-C P1_Y2 ***
20213749-ATT-A 18051863-ATT-A P5_Dst 14×T***
27675644-C-A 25529497-C-A P1_Y2 ***
27798852-A-G 25652705-A-G P1_Y2 ***
20988937-G-A 18827051-G-A P4_Dst ***
20489044-CTGCA-TTGCT 18327158-CTGCA-TTGCT P5_Dst ***
20910779-G-T 18748893-G-T P4_Dst ***
13475481-T-G 11319805-T-G ***
9056031-TATTT-CATTC ***
10683323-ATTTCTTTCG-CTATCTTTCC ***
10685921-A-TT ***
10691348-ATTCCATTCCATTCCATTCCATTCCAT-TTTCCATTCCATTCCATTCCATTCCAC ***
10776534-TTCC-ATCT ***
13435672-T-G 11279996-T-G ***
10987184-TTC-ATT ***
11018818-TTTCG-GTTCA ***
13447321-CCACTCCACTCCACTC-A 11291645-CCACTCCACTCCACTC-A ***
13452374-TTCCATTCCATTCCATTCCATTCAAATACACTCCTTGC-GTCAAATCCACTCCATGA,TTCCATTCCATTCCATTCCAGTCAAATCCACTCCATTC 11296698-TTCCATTCCATTCCATTCCATTCAAATACACTCCTTGC-GTCAAATCCACTCCATGA,TTCCATTCCATTCCATTCCAGTCAAATCCACTCCATTC ***
13489367-TCCCCGCCC-CCCACGCCA 11333691-TCCCCGCCC-CCCACGCCA ***
10760742-C-G ***
21224779-ATT-A,ATTT 19062893-ATT-A,ATTT 19×T***
7717633-CCCTCCC-TCCTTTCCT,TCCTTTCCTTCCCTCCC 7849592-CCCTCCC-TCCTTTCCT,TCCTTTCCTTCCCTCCC ***
16784369-C-A 14672489-C-A ******
13728937-TATAT-CATAA,TATAA 11573261-TATAT-CATAA,TATAA ***
13719358-T-A 11563682-T-A ***
9424598-GA-G,GAA 9586989-GA-G,GAA 16×A***
23045471-CA-C,CAA 20883585-CA-C,CAA 16×A***
13965269-CA-C,CAA 11844563-CA-C,CAA 21×A***
17802195-AAG-A 15690315-AAG-A ***
24490762-G-C 22344615-G-C ***
18204985-CA-C,CAA 16093105-CA-C,CAA 23×A***
22739738-AAAG-AAAAT,G 20577852-AAAG-AAAAT,G ***
22851638-A-T 20689752-A-T ***
21754361-CAC-AAT,CAT ***
7832071-G-GTCTT,GTCTTTCTT 7964030-G-GTCTT,GTCTTTCTT 18×TCTT***
6686250-C-A 6818209-C-A ***
26558027-A-C 24411880-A-C P1_g2 ***
18390083-CA-C,CAA 16278203-CA-C,CAA P6_Gap 19×A***
17507641-G-A 15395761-G-A ***
17085721-CTT-C,CT 14973841-CTT-C,CT 20×T***
14505713-C-T 12393918-C-T ******
9949998-T-C 10112389-T-C ******
21125027-G-A 18963141-G-A ******
6621719-T-C 6753678-T-C ******
24388567-A-G 22242420-A-G ***
24961031-C-A 22814884-C-A g1 ***
3869081-A-G 4001040-A-G ***
20573712-G-A 18411826-G-A P5_Dst ***
19064934-CA-C 16953054-CA-C 8×A***
56871634-A-C ***
13558181-C-T 11402505-C-T ***
14765676-ATTT-A,ATTTT 12653745-ATTT-A,ATTTT 21×T***
24389894-CTT-C,CT 22243747-CTT-C,CT 26×T***
20570108-T-A 18408222-T-A P5_Dst ***
22298196-CCATC-TCATT 20136310-CCATC-TCATT DYZ19 ***
19611206-CTT-C 17499326-CTT-C P5_Prx 26×T***
22320604-A-T 20158718-A-T DYZ19 ***
22259400-T-G 20097514-T-G DYZ19 ***
7164467-CAA-C,CAAA 7296426-CAA-C,CAAA 24×A***
22490551-C-A 20328665-C-A DYZ19 ***
2861534-CAA-C,CA 2993493-CAA-C,CA 25×A***
4067402-G-T 4199361-G-T ***
23471038-CAAA-C,CAA 21309152-CAAA-C,CAA 19×A***
4878246-CAAA-C,CAAAA 5010205-CAAA-C,CAAAA 18×A***
10776333-C-A ***
21757500-TT-CC ***
22259414-A-T 20097528-A-T DYZ19 ***
20894079-G-T 18732193-G-T P4_Dst ***
20310697-G-A 18148811-G-A P5_Dst ***
20067536-G-A 17955656-G-A P5_Dst ***
20073982-A-G 17962102-A-G P5_Dst ***
20079333-C-T 17967453-C-T P5_Dst ***
20130928-C-A 18019048-C-A P5_Dst ***
20132736-C-T 18020856-C-T P5_Dst ***
20228938-T-C 18067052-T-C P5_Dst ***
20251016-A-G 18089130-A-G P5_Dst ***
20251191-C-G 18089305-C-G P5_Dst ***
20254214-C-T 18092328-C-T P5_Dst ***
5088751-CTT-C 5220710-CTT-C 23×T***
20289135-G-T 18127249-G-T P5_Dst ***
20296881-GCT-CC 18134995-GCT-CC P5_Dst ***
22341554-C-A 20179668-C-A DYZ19 ***
8030030-TAA-T,TA 8161989-TAA-T,TA 26×A***
20412324-G-A 18250438-G-A P5_Dst ***
20419924-A-G 18258038-A-G P5_Dst ***
20421691-C-T 18259805-C-T P5_Dst ***
20430919-T-C 18269033-T-C P5_Dst ***
20443098-G-A 18281212-G-A P5_Dst ***
20450709-C-G 18288823-C-G P5_Dst ***
20483283-T-A 18321397-T-A P5_Dst ***
20498837-G-A 18336951-G-A P5_Dst ***
27367006-T-C 25220859-T-C P1_g3 ***
20522415-C-T 18360529-C-T P5_Dst ***
20588403-G-A 18426517-G-A P5_Dst ***
20601484-A-G 18439598-A-G P5_Dst ***
20885270-A-G 18723384-A-G P4_Dst ***
19839616-GAA-G,GA 17727736-GAA-G,GA P5_Prx 26×A***
22456994-C-A 20295108-C-A DYZ19 ***
28350213-A-G 26204066-A-G P1_gr2 ***
9594425-C-G 9756816-C-G IR3_Prx ***
28351262-T-C 26205115-T-C P1_gr2 ***
28357150-C-CT 26211003-C-CT P1_gr2 15×T***
28351575-C-T 26205428-C-T P1_gr2 ***
28367516-C-T 26221369-C-T P1_gr2 ***
28347027-GAGGTG-AAGGCA 26200880-GAGGTG-AAGGCA P1_gr2 ***
22240640-A-G 20078754-A-G DYZ19 ***
26202302-C-CT 24056155-C-CT P1_Y1 16×T***
22466814-A-G 20304928-A-G E625 DYZ19 ***
9527310-C-T 9689701-C-T ***
9529754-T-C 9692145-T-C IR3_Prx ***
9535507-G-A 9697898-G-A IR3_Prx ***
9555204-T-C 9717595-T-C IR3_Prx ***
9603887-C-A 9766278-C-A IR3_Prx ***
27940342-A-G 25794195-A-G P1_Y2 ***
16146799-G-T 14034919-G-T P8_Dst ***
22484576-G-T 20322690-G-T BY22163BY22186 DYZ19 ***
26433572-CTT-C 24287425-CTT-C P1_Y1 19×T***
18467786-C-T 16355906-C-T P6_Dst ***
18473240-C-T 16361360-C-T P6_Dst ***
18486123-C-T 16374243-C-T P6_Dst ***
18488449-T-C 16376569-T-C P6_Dst ***
18499090-T-TC 16387210-T-TC P6_Dst ***
18516089-G-A 16404209-G-A P6_Dst ***
18530352-AT-CAA 16418472-AT-CAA P6_Dst ***
18530360-T-C 16418480-T-C P6_Dst ***
18530372-TGT-GGA 16418492-TGT-GGA P6_Dst ***
22467206-TGTTT-GGTTA 20305320-TGTTT-GGTTA DYZ19 ***
25491429-CAA-C,CA 23345282-CAA-C,CA P2_r2 19×A***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 923061511715794727268352714
Kit: 92306-A*16000000100000008300000
Used in age calculations1511715794727268352714
Counts of SNPs65
Variant counts last updated 2020-10-09 03:18:59.

* BED data not available. Using default values.


Big Tree Main Page