Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > DF21/S192 > FGC3213 > ZZ1 > S3058 > S424 > S426 > S190 > FGC3215 > FGC3216 > FGC3197 > Y82590 > BY73349

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFB38
B242783-A
BigY3
B242783
13452847-T-A 11297171-T-A A*
20223076-A-T 18061190-A-T P5_Dst ***A*
18506521-T-TA 16394641-T-TA P6_Dst 9×AA*
18511674-C-T 16399794-C-T P6_Dst ***A*
18535327-T-C 16423447-T-C P6_Dst A*
20058891-A-G 17947011-A-G P5_Prx A*
20058902-G-A 17947022-G-A P5_Prx A*
20067590-A-T 17955710-A-T P5_Dst A*
20091281-G-A 17979401-G-A P5_Dst ***A*
20259968-A-G 18098082-A-G P5_Dst A*
18010698-G-A 15898818-G-A P7_Dst YA*
20273139-A-G 18111253-A-G P5_Dst A*
20278235-T-C 18116349-T-C P5_Dst A*
20283669-G-A 18121783-G-A P5_Dst ***A*
20305344-T-A 18143458-T-A P5_Dst A*
20310054-G-A 18148168-G-A P5_Dst ***A*
20328398-T-A 18166512-T-A P5_Dst A*
20331411-A-T 18169525-A-T P5_Dst A*
18433158-A-G 16321278-A-G P6_Dst A*
16169680-G-T 14057800-G-T YA*
20341156-A-G 18179270-A-G P5_Dst A*
20941951-A-G 18780065-A-G P4_Dst ***A*
21007722-C-T 18845836-C-T P4_Dst Y***A*
20990889-T-C 18829003-T-C P4_Dst ***A*
20983048-G-A 18821162-G-A P4_Dst ***A*
20977357-A-G 18815471-A-G P4_Dst ***A*
20965886-A-T 18804000-A-T P4_Dst A*
20963789-G-T 18801903-G-T P4_Dst A*
20963682-C-A 18801796-C-A P4_Dst A*
20937851-T-C 18775965-T-C P4_Dst A*
16161625-C-T 14049745-C-T P8_Dst ***A*
20926863-C-T 18764977-C-T P4_Dst A*
20918930-G-A 18757044-G-A P4_Dst A*
20915249-G-A 18753363-G-A P4_Dst A*
20904826-T-TA 18742940-T-TA P4_Dst 9×AA*
20901439-C-T 18739553-C-T P4_Dst ***A*
20898228-G-A 18736342-G-A P4_Dst A*
16149174-G-T 14037294-G-T P8_Dst ***A*
20338525-A-G 18176639-A-G P5_Dst ***A*
20366200-A-G 18204314-A-G P5_Dst ***A*
20898192-G-A 18736306-G-A P4_Dst ***A*
20851916-G-A 18690030-G-A P4_Dst A*
20553646-G-A 18391760-G-A P5_Dst ***A*
20553659-G-A 18391773-G-A P5_Dst ***A*
20554869-G-A 18392983-G-A P5_Dst ***A*
20588323-T-C 18426437-T-C P5_Dst ***A*
20843120-C-T 18681234-C-T P4_Dst A*
20843611-A-T 18681725-A-T P4_Dst A*
20851912-G-A 18690026-G-A P4_Dst A*
20851953-G-A 18690067-G-A P4_Dst A*
20537072-C-T 18375186-C-T P5_Dst ***A*
20851955-G-A 18690069-G-A P4_Dst A*
20851959-G-A 18690073-G-A P4_Dst A*
20851963-G-A 18690077-G-A P4_Dst A*
20854647-G-A 18692761-G-A P4_Dst ***A*
20862415-T-C 18700529-T-C P4_Dst ***A*
20890069-A-G 18728183-A-G P4_Dst ***A*
20891626-G-A 18729740-G-A P4_Dst ***A*
20550583-A-G 18388697-A-G P5_Dst A*
20524549-T-C 18362663-T-C P5_Dst A*
20388084-T-C 18226198-T-C P5_Dst ***A*
20480294-G-A 18318408-G-A P5_Dst A*
20410600-T-C 18248714-T-C P5_Dst ***A*
20412546-G-A 18250660-G-A P5_Dst A*
20418212-C-T 18256326-C-T P5_Dst A*
20419217-C-T 18257331-C-T P5_Dst A*
20445977-C-A 18284091-C-A P5_Dst A*
20446253-A-C 18284367-A-C P5_Dst A*
20466171-T-C 18304285-T-C P5_Dst ***A*
20482692-A-G 18320806-A-G P5_Dst ***A*
20522382-A-G 18360496-A-G P5_Dst A*
20483188-C-T 18321302-C-T P5_Dst A*
20483194-C-T 18321308-C-T P5_Dst A*
20484207-G-A 18322321-G-A P5_Dst A*
20484208-G-A 18322322-G-A P5_Dst A*
20509137-C-T 18347251-C-T P5_Dst A*
20509139-C-T 18347253-C-T P5_Dst A*
20509144-C-T 18347258-C-T P5_Dst A*
21027716-A-G 18865830-A-G P4_Dst YA*
20898183-G-A 18736297-G-A P4_Dst ***A*
16114653-A-T 14002773-A-T P8_Prx A*
3433078-A-G 3565037-A-G A*
11665428-T-C ++
13448162-TTCCAG-CTCCAC 11292486-TTCCAG-CTCCAC +
59019088-CGCG-TGCC 56872941-CGCG-TGCC *
56831992-GCACTCCACTG-CCACTCAACTA,CCACTCCACTG *
56855234-ATAAAAAAAAAG-TTAAAAAAAA *
56861817-AAAAAAAAAAAAAAAAAAAAAACCTG-AAAAAAAAAAAAACCTA,CAAACAAACAAACAAACAAACAAACAAAAAAAACCTA *
56879318-A-AGA,AGG *
22811008-CA-TG 20649122-CA-TG *
10789411-ATTGCATT-CTTCCACA *
9340761-ACC-A,ACACACC 9503152-ACC-A,ACACACC *
13535693-GTGTGTGTACATAC-ATAT,GTGTGTGTATAT 11380017-GTGTGTGTACATAC-ATAT,GTGTGTGTATAT *
10789398-TGCA-CTCT *
22502688-GCACG-CCACT,GCCCT 20340802-GCACG-CCACT,GCCCT DYZ19 *
22506732-GTCCG-ATCCA,GTCCA 20344846-GTCCG-ATCCA,GTCCA DYZ19 *
9327706-CTG-C 9490097-CTG-C 8×TG*
59015498-C-T 56869351-C-T *
13706867-T-A 11551191-T-A BY49946 *
19790172-GAA-G 17678292-GAA-G P5_Prx 15×A*
13451679-TACTTCAT-AACTCCAT,GACTCCAA 11296003-TACTTCAT-AACTCCAT,GACTCCAA *
13448358-CCT-CC,TCT 11292682-CCT-CC,TCT *
13450521-CTTCACTCCAC-ATCCATCCCAT,CTCCAC 11294845-CTTCACTCCAC-ATCCATCCCAT,CTCCAC *
19987682-G-GT 17875802-G-GT P5_Prx 15×T*
9984886-AAT-TAG 10147277-AAT-TAG *
10693705-GTTCCGTTG-ATTGCGTTT *
13447040-GTA-ATC 11291364-GTA-ATC *
10691942-C-G *
13447645-GCTCCACTCCACTCC-ATTCCACTCCACTCT 11291969-GCTCCACTCCACTCC-ATTCCACTCCACTCT 4×CTCCA*
13448322-TTCCAG-CTCCAC,TTCCAC 11292646-TTCCAG-CTCCAC,TTCCAC *
56825755-ATATATATATGG-GA *
13448943-GCACGA-CCACGC,CGACGC 11293267-GCACGA-CCACGC,CGACGC *
13449753-CAACCCCATTCTATTC-AAACCCCATTCCATTG,AAGCCCCATTCCATTC 11294077-CAACCCCATTCTATTC-AAACCCCATTCCATTG,AAGCCCCATTCCATTC *
25781006-G-T 23634859-G-T P1_b3 **
26228681-CTTTCTTTC-ATTTATTTA 24082534-CTTTCTTTC-ATTTATTTA P1_Y1 **
26540623-CT-C 24394476-CT-C P1_g2 16×T**
27243496-A-G 25097349-A-G P1_g3 **
27283010-G-A 25136863-G-A P1_g3 **
27283020-G-A 25136873-G-A P1_g3 **
27283043-G-A 25136896-G-A P1_g3 **
27501961-G-T 25355814-G-T P1_Y2 **
27528876-T-A 25382729-T-A P1_Y2 **
27589805-TTGGTAGCTTGA-T 25443658-TTGGTAGCTTGA-T P1_Y2 **
27844566-TGGTC-GGTA 25698419-TGGTC-GGTA P1_Y2 **
28349495-C-G 26203348-C-G P1_gr2 **
27997468-CAA-C 25851321-CAA-C P1_Y2 23×A**
28349513-C-T 26203366-C-T P1_gr2 **
28366218-T-A 26220071-T-A P1_gr2 **
28369397-AGC-GGT 26223250-AGC-GGT P1_gr2 **
28403603-C-T 26257456-C-T P1_gr2 **
28422559-G-T 26276412-G-T P1_gr2 **
28422624-C-T 26276477-C-T P1_gr2 **
28440195-C-T 26294048-C-T P1_gr2 **
28445693-C-A 26299546-C-A P1_gr2 **
28449163-AT-A 26303016-AT-A P1_gr2 12×T**
28449408-C-T 26303261-C-T P1_gr2 **
28452427-A-C 26306280-A-C P1_gr2 **
25240847-G-A 23094700-G-A P2_r1 **
24919995-G-A 22773848-G-A g1 **
24920011-G-A 22773864-G-A g1 **
20399536-GAG-AAA 18237650-GAG-AAA P5_Dst **
27129870-CA-C 24983723-CA-C P1_g3 16×A**
28791103-TCA-GTG 26644956-TCA-GTG **
8176336-A-G 8308295-A-G **
17268868-C-T 15156988-C-T **
12372008-T-C **
9729369-G-A 9891760-G-A IR3_Prx **
16498193-A-C 14386313-A-C **
18477490-T-C 16365610-T-C P6_Dst **
14119783-CC-TT 11999077-CC-TT **
19084172-C-A 16972292-C-A **
13710266-GTAG-ATAT 11554590-GTAG-ATAT **
20549962-C-T 18388076-C-T P5_Dst **
24895923-C-T 22749776-C-T g1 **
20637578-G-GATAT 18475692-G-GATAT P4_Prx 25×AT**
20928597-A-G 18766711-A-G P4_Dst **
21198846-C-A 19036960-C-A **
21198856-G-C 19036970-G-C **
13726739-C-T 11571063-C-T **
13708396-G-T 11552720-G-T **
27412865-A-ATG 25266718-A-ATG P1_g3 17×TG**
13704762-G-T 11549086-G-T **
6948088-GTTTG-TTTT 7080047-GTTTG-TTTT **
28345690-T-TAC 26199543-T-TAC P1_gr2 19×AC**
24621589-T-C 22475442-T-C P3_t2 **
24562264-C-G 22416117-C-G P3_t2 **
56858328-GAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGGAAAGAAAAGAAAGAAAAGAAAGAAAGA-AGAAAGAAAAGAAAGAAAAAGAAAGAAAGAAAAGAAAGAAAAGAAAGAAAGAAAAGAAAGAAAAGAAAGAAAG **
26199619-G-A 24053472-G-A P1_Y1 **
13726423-CAAAAT-TTAAAA 11570747-CAAAAT-TTAAAA **
22330091-A-T 20168205-A-T DYZ19 **
13726354-C-T 11570678-C-T **
5235405-CTT-C 5367364-CTT-C 31×T**
26421473-GCT-G 24275326-GCT-G P1_Y1 **
13453348-C-CTG 11297672-C-CTG **
13453344-CAT-C 11297668-CAT-C **
13453333-C-T 11297657-C-T **
24597813-C-CT 22451666-C-CT P3_t2 22×T**
4431200-G-T 4563159-G-T **
20654981-AATATATATAT-A 18493095-AATATATATAT-A P4_Prx 21×AT**
4431199-T-G 4563158-T-G **
4431198-T-A 4563157-T-A **
22311524-C-G 20149638-C-G DYZ19 **
13726727-T-C 11571051-T-C **
20587808-AAT-A 18425922-AAT-A P5_Dst 10×AT**
19210017-C-G 17098137-C-G **
27616494-C-CT 25470347-C-CT P1_Y2 9×T**
20385533-A-G 18223647-A-G FGC61340 P5_Dst **
18511195-C-A 16399315-C-A P6_Dst 30×A**
13257268-GATATAT-G 11101592-GATATAT-G 11×AT****
18734469-C-T 16622589-C-T ****
3062269-G-A 3194228-G-A **
22361071-CTA-AG 20199185-CTA-AG DYZ19 **
22295627-G-T 20133741-G-T DYZ19 **
6193146-CA-C 6325105-CA-C IR3_Dst **
22337705-A-C 20175819-A-C DYZ19 **
28414287-G-C 26268140-G-C P1_gr2 ***
27300819-C-T 25154672-C-T P1_g3 ***
28453258-G-A 26307111-G-A P1_gr2 ***
22359302-A-T 20197416-A-T DYZ19 ***
27173659-G-GA 25027512-G-GA P1_g3 13×A***
17278250-AGAAAGGAAGAAAGGAAGAAGAACGAAAGAAA-AGAAAGGAAGAAAGGAAGAAGAACGAAA,GAAAGGAAGAAAGGAAGAAGAAC 15166370-AGAAAGGAAGAAAGGAAGAAGAACGAAAGAAA-AGAAAGGAAGAAAGGAAGAAGAACGAAA,GAAAGGAAGAAAGGAAGAAGAAC ***
27280288-GG-AA 25134141-GG-AA P1_g3 ***
27397919-C-T 25251772-C-T P1_g3 ***
27242795-G-A 25096648-G-A P1_g3 ***
27242342-C-T 25096195-C-T P1_g3 ***
27228987-C-T 25082840-C-T P1_g3 ***
27305660-A-G 25159513-A-G P1_g3 ***
27410376-T-C 25264229-T-C P1_g3 ***
27397928-C-T 25251781-C-T P1_g3 ***
13591443-G-A 11435767-G-A ***
27781145-AT-A 25634998-AT-A P1_Y2 10×T***
27572555-CTG-C 25426408-CTG-C P1_Y2 10×TG***
27566627-A-C 25420480-A-C P1_Y2 ***
27542426-G-A 25396279-G-A P1_Y2 ***
27541368-A-G 25395221-A-G P1_Y2 ***
27538907-G-A 25392760-G-A P1_Y2 ***
13591495-C-T 11435819-C-T ***
27214359-C-T 25068212-C-T P1_g3 ***
27494426-C-T 25348279-C-T P1_Y2 ***
27472187-G-A 25326040-G-A P1_Y2 ***
27472028-G-T 25325881-G-T P1_Y2 ***
27471981-G-A 25325834-G-A P1_Y2 ***
27461606-T-G 25315459-T-G P1_Y2 ***
27461249-A-C 25315102-A-C P1_Y2 ***
27459997-C-T 25313850-C-T P1_Y2 ***
27222361-C-A 25076214-C-A P1_g3 ***
27189243-C-T 25043096-C-T P1_g3 ***
27197778-A-G 25051631-A-G P1_g3 ***
22242849-A-G 20080963-A-G BY28138 DYZ19 ***
25291897-T-C 23145750-T-C P2_r1 ***
13467238-T-A 11311562-T-A ***
25085892-A-G 22939745-A-G g1 ***
27414820-C-T 25268673-C-T P1_g3 ***
13329879-AATAT-A 11174203-AATAT-A 25×AT***
24907781-T-TA 22761634-T-TA g1 22×A***
24851241-A-G 22705094-A-G IR1_R ***
25412653-CTT-C 23266506-CTT-C P2_r2 16×T***
24701562-G-T 22555415-G-T P3_b2 ***
24680465-T-C 22534318-T-C P3_b2 ***
24642024-T-C 22495877-T-C P3_t2 ***
24628063-GAGG-AAAA 22481916-GAGG-AAAA P3_t2 ***
24628014-A-T 22481867-A-T P3_t2 ***
22484716-T-A 20322830-T-A K624 DYZ19 ***
25378556-G-A 23232409-G-A P2_r2 ***
25445007-A-G 23298860-A-G P2_r2 ***
20991160-AT-A 18829274-AT-A P4_Dst 18×T***
22454336-C-A 20292450-C-A DYZ19 ***
27149071-C-T 25002924-C-T P1_g3 ***
27136198-A-G 24990051-A-G P1_g3 ***
27130320-GAA-G 24984173-GAA-G P1_g3 14×A***
27122319-A-T 24976172-A-T P1_g3 ***
27121711-C-T 24975564-C-T P1_g3 ***
27567147-G-GA,GAA 25421000-G-GA,GAA P1_Y2 11×A***
26501807-C-CA 24355660-C-CA P1_Y1 15×A***
25486075-C-T 23339928-C-T P2_r2 ***
26387069-G-GT 24240922-G-GT P1_Y1 13×T***
26376499-CA-AA,C 24230352-CA-AA,C P1_Y1 18×A***
9232958-C-G 9395349-C-G ***
9355440-A-G 9517831-A-G ***
25682559-A-G 23536412-A-G P1_b3 ***
25491097-TTTTG-T 23344950-TTTTG-T P2_r2 4×TTTG***
27574365-T-C 25428218-T-C P1_Y2 ***
27632633-T-C 25486486-T-C P1_Y2 ***
13591428-G-A 11435752-G-A ***
28362773-G-A 26216626-G-A P1_gr2 ***
28431476-CTC-TTT 26285329-CTC-TTT P1_gr2 ***
28172366-C-T 26026219-C-T P1_b4 ***
28431471-C-T 26285324-C-T P1_gr2 ***
28255069-TC-T 26108922-TC-T P1_b4 ***
28343345-G-T 26197198-G-T P1_gr2 ***
28346944-C-G 26200797-C-G P1_gr2 ***
28431461-C-T 26285314-C-T P1_gr2 ***
22364782-C-A 20202896-C-A DYZ19 ***
22451050-T-C 20289164-T-C DYZ19 ***
28349544-T-G 26203397-T-G P1_gr2 ***
28350699-G-C 26204552-G-C P1_gr2 ***
28351176-A-G 26205029-A-G P1_gr2 ***
28359563-G-C 26213416-G-C P1_gr2 ***
28362754-C-A 26216607-C-A P1_gr2 ***
28362784-A-T 26216637-A-T P1_gr2 ***
28114947-TA-T 25968800-TA-T P1_b4 ***
28394930-T-G 26248783-T-G P1_gr2 ***
28404132-G-A 26257985-G-A P1_gr2 ***
28404098-C-T 26257951-C-T P1_gr2 ***
13479082-C-A 11323406-C-A ***
28399777-C-T 26253630-C-T P1_gr2 ***
28397707-G-A 26251560-G-A P1_gr2 ***
28397661-CATATT-C 26251514-CATATT-C P1_gr2 ***
28392035-T-G 26245888-T-G P1_gr2 ***
28362792-C-G 26216645-C-G P1_gr2 ***
28420879-C-T 26274732-C-T P1_gr2 ***
27421234-A-G 25275087-A-G P1_g3 ***
28387262-A-G 26241115-A-G P1_gr2 ***
28381004-T-A 26234857-T-A P1_gr2 ***
28368913-A-G 26222766-A-G P1_gr2 ***
20337720-AT-A 18175834-AT-A P5_Dst 9×T***
28120118-T-C 25973971-T-C P1_b4 ***
28091500-C-T 25945353-C-T P1_Y2 ***
27600557-C-T 25454410-C-T P1_Y2 ***
13726383-C-G,T 11570707-C-G,T ***
27666066-G-A 25519919-G-A P1_Y2 ***
27666044-G-A 25519897-G-A P1_Y2 ***
22490515-G-A 20328629-G-A DYZ19 ***
27666039-G-A 25519892-G-A P1_Y2 ***
27665772-C-A 25519625-C-A P1_Y2 ***
27661126-C-T 25514979-C-T P1_Y2 ***
27660634-A-C 25514487-A-C P1_Y2 ***
27754201-T-C 25608054-T-C P1_Y2 ***
28449142-A-G 26302995-A-G P1_gr2 ***
27657415-T-A 25511268-T-A P1_Y2 ***
27651529-C-T 25505382-C-T P1_Y2 ***
22489844-G-T 20327958-G-T DYZ19 ***
27649970-C-T 25503823-C-T P1_Y2 ***
28407463-C-T 26261316-C-T P1_gr2 ***
27737351-A-G 25591204-A-G P1_Y2 ***
27767287-C-T 25621140-C-T P1_Y2 ***
28086316-A-C 25940169-A-C P1_Y2 ***
27866184-A-G 25720037-A-G P1_Y2 ***
28051624-A-G 25905477-A-G P1_Y2 ***
13500483-CTG-C 11344807-CTG-C ***
27972276-A-G 25826129-A-G P1_Y2 ***
27922950-A-T 25776803-A-T P1_Y2 ***
28445585-G-A 26299438-G-A P1_gr2 ***
27880284-T-C 25734137-T-C P1_Y2 ***
27846923-G-T 25700776-G-T P1_Y2 ***
27790547-C-A 25644400-C-A P1_Y2 ***
13591415-T-A 11435739-T-A ***
27837481-G-A 25691334-G-A P1_Y2 ***
27809840-G-A 25663693-G-A P1_Y2 ***
27804305-G-A 25658158-G-A P1_Y2 ***
27804257-GGAGTGG-AAAGTAA 25658110-GGAGTGG-AAAGTAA P1_Y2 ***
27801774-C-A 25655627-C-A P1_Y2 ***
24570625-T-C 22424478-T-C P3_t2 ***
22488341-T-C 20326455-T-C DYZ19 ***
24558155-G-A 22412008-G-A P3_t2 ***
5257534-A-AT 5389493-A-AT 10×T***
13488944-GCAGGGGTT-CCTGGGGTC 11333268-GCAGGGGTT-CCTGGGGTC ***
13488370-GCC-ACT 11332694-GCC-ACT ***
13488299-GGACCGCG-AGACTGCT 11332623-GGACCGCG-AGACTGCT ***
13471196-TGCTC-AGCTA 11315520-TGCTC-AGCTA ***
13470444-TCTGCG-CCTGTT 11314768-TCTGCG-CCTGTT ***
16298639-CT-C 14186759-CT-C 9×T***
27809848-G-A 25663701-G-A P1_Y2 ***
13504673-CAC-TGT 11348997-CAC-TGT ***
9403521-GT-G,GTT 9565912-GT-G,GTT 21×T***
15151502-CAA-C,CA 13039589-CAA-C,CA 23×A***
13348249-G-A 11192573-G-A ***
11034826-GTCCATTG-CTCCATTC ***
9932055-T-G 10094446-T-G ***
10693693-CTTC-TTTA ***
13489804-CCC-ACT 11334128-CCC-ACT ***
14071348-ACCCGACTT-TCCTGAC,TCCTGACTT 11950642-ACCCGACTT-TCCTGAC,TCCTGACTT ***
10678578-CAA-AAT ***
28586795-T-C 26440648-T-C ***
59012707-TG-GT 56866560-TG-GT ***
56829155-TTTCGAGTCCA-ATTCGAGTCCG ***
56828330-ATTCC-ATTCTTTGCA,TTGCA ***
56828308-CAAATCA-CCATTCC,TGATTCT ***
28797106-GAATG-TAATT 26650959-GAATG-TAATT ***
27397108-A-AT 25250961-A-AT P1_g3 10×T***
21753665-TG-CA ***
15127828-CTT-C 13015915-CTT-C 11×T***
21838971-G-GA,GAA 19677085-G-GA,GAA 20×A***
20815408-CATAT-C,CAT 18653522-CATAT-C,CAT P4_Gap 22×AT***
18688500-C-AAA 16576620-C-AAA 20×A***
22442916-C-A 20281030-C-A DYZ19 ***
9056761-G-GAAACCACTTCCAAA ***
13467266-C-A 11311590-C-A ***
10683323-ATTTCTTTCGAC-CTATCTTTTGAA ***
10624485-G-AT ***
56867493-TTTTTTTT-ATA ***
13222482-A-G 11066806-A-G ***
13455776-G-A 11300100-G-A ***
22490195-T-G 20328309-T-G DYZ19 ***
17046715-GT-G,GTT 14934835-GT-G,GTT 25×T***
13481480-T-C 11325804-T-C ***
5147441-CAAA-C,CAA 5279400-CAAA-C,CAA 30×A***
8692608-A-C 8824567-A-C ***
13222487-A-G 11066811-A-G ***
27242386-G-T 25096239-G-T P1_g3 ***
13304158-T-C 11148482-T-C ***
12308680-T-TTA,TTATATA 14×TA***
14795058-G-T 12683129-G-T ***
16305744-T-A 14193864-T-A ***
20815408-CATATATATAT-C,CATATATATATATAT 18653522-CATATATATAT-C,CATATATATATATAT P4_Gap 22×AT***
22853770-C-T 20691884-C-T ***
13728215-G-A 11572539-G-A ***
4307641-A-AT 4439600-A-AT 10×T***
22256043-C-A 20094157-C-A DYZ19 ***
13204215-ATGGTGATGGTGATGA-GTGG 11048539-ATGGTGATGGTGATGA-GTGG ***
8100637-CAAA-C,CAA 8232596-CAAA-C,CAA 37×A***
20774922-GAAA-G 18613036-GAAA-G P4_Prx 22×A***
4973668-CAA-C,CA 5105627-CAA-C,CA 19×A***
3720173-ACCCG-CTCTT 3852132-ACCCG-CTCTT ***
13487357-TAA-CAC 11331681-TAA-CAC ***
10669466-TTCCA-CTCCT ***
9057380-TTGT-A ***
4982523-AT-A,ATT 5114482-AT-A,ATT 23×T***
13461829-GGCA-TTCG 11306153-GGCA-TTCG ***
10624514-TCG-CCA ***
4505414-ATT-A,AT 4637373-ATT-A,AT 22×T***
13850557-A-C 11729851-A-C FT286238 ***
27494909-T-G 25348762-T-G P1_Y2 ***
18365541-A-ATG 16253661-A-ATG P6_Prx 20×TG***
20567560-AAT-A 18405674-AAT-A P5_Dst 9×AT***
13977154-GTC-ATG 11856448-GTC-ATG ***
24681832-T-C 22535685-T-C P3_b2 ***
24023162-T-C 21877015-T-C ***
20851953-GAGGAAGACTG-AAAAAAAACTA 18690067-GAGGAAGACTG-AAAAAAAACTA P4_Dst ***
22268233-GTTT-CTTC 20106347-GTTT-CTTC DYZ19 ***
20086349-T-TA 17974469-T-TA P5_Dst 10×A***
24577878-CA-C 22431731-CA-C P3_t2 25×A***
20977661-T-A 18815775-T-A P4_Dst ***
3676509-AT-A 3808468-AT-A 11×T***
20893559-T-C 18731673-T-C P4_Dst ***
20851933-G-A 18690047-G-A P4_Dst ***
22281980-C-T 20120094-C-T DYZ19 ***
26461472-T-TA 24315325-T-TA P1_Y1 17×A***
20510438-T-C 18348552-T-C P5_Dst ***
20399526-G-A 18237640-G-A P5_Dst ***
20399518-G-A 18237632-G-A P5_Dst ***
20399512-G-A 18237626-G-A P5_Dst ***
20389872-G-A 18227986-G-A P5_Dst ***
22275639-CCTA-TCTT 20113753-CCTA-TCTT DYZ19 ***
22298716-ACT-GCA 20136830-ACT-GCA DYZ19 ***
20295869-T-C 18133983-T-C P5_Dst ***
26046002-CT-C 23899855-CT-C P1_Y1 13×T***
21768124-T-C ***
22810971-TAC-T 20649085-TAC-T ***
27357557-T-TA 25211410-T-TA P1_g3 14×A***
22505043-GGCCT-AACCA,GACCT 20343157-GGCCT-AACCA,GACCT DYZ19 ***
22504526-C-G 20342640-C-G DYZ19 ***
22502828-TTGTG-ATGTC,TTGTC 20340942-TTGTG-ATGTC,TTGTC DYZ19 ***
22495654-G-C 20333768-G-C DYZ19 ***
22337771-C-T 20175885-C-T DYZ19 ***
22490175-AGTGT-TGTGG 20328289-AGTGT-TGTGG DYZ19 ***
22962008-GTTTT-G,GTTTTT 20800122-GTTTT-G,GTTTTT 27×T***
22483467-ATG-TTT 20321581-ATG-TTT DYZ19 ***
22430833-G-T 20268947-G-T DYZ19 ***
22364479-T-C 20202593-T-C DYZ19 ***
22355746-A-G 20193860-A-G DYZ19 ***
20312385-C-T 18150499-C-T P5_Dst ***
20283658-G-A 18121772-G-A P5_Dst ***
28343290-A-G 26197143-A-G P1_gr2 ***
9530936-AT-A 9693327-AT-A IR3_Prx ***
9670439-T-C 9832830-T-C IR3_Prx ***
9620962-C-T 9783353-C-T IR3_Prx ***
9599136-T-G 9761527-T-G IR3_Prx ***
9564029-A-T 9726420-A-T IR3_Prx ***
9534724-A-G 9697115-A-G IR3_Prx ***
9531142-C-A 9693533-C-A IR3_Prx ***
9527769-C-T 9690160-C-T ***
9729119-G-C 9891510-G-C IR3_Prx ***
9218496-CTG-C 9380887-CTG-C 8×TG***
8006935-GG-AA 8138894-GG-AA ***
7059312-G-A 7191271-G-A ***
6401942-ATCGCTGTTA-GTCGCTGTCG 6533901-ATCGCTGTTA-GTCGCTGTCG ***
28381085-T-C 26234938-T-C P1_gr2 ***
28351165-G-A 26205018-G-A P1_gr2 ***
9698956-C-T 9861347-C-T IR3_Prx ***
28366313-G-A 26220166-G-A P1_gr2 ***
20246601-TA-T 18084715-TA-T P5_Dst ***
20084810-C-A 17972930-C-A P5_Dst ***
20232617-A-G 18070731-A-G P5_Dst ***
20230152-T-TA,TAA 18068266-T-TA,TAA P5_Dst 16×A***
20196584-G-A 18034698-G-A P5_Dst ***
20139776-T-C 18027896-T-C P5_Dst ***
20112089-G-A 18000209-G-A P5_Dst ***
20092207-A-C 17980327-A-C P5_Dst ***
20010762-C-T 17898882-C-T P5_Prx ***
22429245-AGTA-GGTC 20267359-AGTA-GGTC DYZ19 ***
19695012-AT-A 17583132-AT-A P5_Prx 23×T***
19652904-A-G 17541024-A-G P5_Prx ***
22503236-C-A 20341350-C-A DYZ19 ***
18509525-A-C 16397645-A-C P6_Dst ***
18501106-C-A 16389226-C-A P6_Dst ***
22237712-ACT-GTA 20075826-ACT-GTA DYZ19 ***
18378959-C-A 16267079-C-A P6_Prx 28×T***
17301238-CAAA-C,CA 15189358-CAAA-C,CA 23×A***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: B2427831518030995191338375059
Kit: B242783-A*16000000100000008300000
Used in age calculations1518030995191338375059
Counts of SNPs40
Variant counts last updated 2020-06-05 03:15:29.

* BED data not available. Using default values.


Big Tree Main Page