Tree Position

R-M269 > L23 > L51 > Z2118 > ~18571755-G-A > S1161 > S1141 > Exact position not yet finalized.

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY2
287464
22315902-C-G 20154016-C-G DYZ19 A*
26220620-A-G 24074473-A-G P1_Y1 A*
24273721-C-T 22127574-C-T P3_b1 A*
13687182-C-A 11531506-C-A A*
22450705-A-C 20288819-A-C DYZ19 A*
28816716-T-A 26670569-T-A A*
18362201-C-T 16250321-C-T BY11186BY11792 P6_Prx A*
20703490-G-A 18541604-G-A P4_Prx A*
10973922-C-G A*
15906794-GA-G 13794914-GA-G +
21749566-C-T 19587680-C-T BY135162 YY+
8510571-G-T 8642530-G-T BY48364 YY+
17383444-A-G 15271564-A-G BY114303 YY+
23309664-T-C 21147778-T-C BY144509 YY+
16553147-C-T 14441267-C-T BY108569 YY+
8372155-T-A 8504114-T-A BY72076 YY+
23031251-G-A 20869365-G-A BY55412 YY+
13815383-G-A 11694677-G-A BY42296 +
22582910-T-A 20421024-T-A BY42298 YY+
22554358-C-T 20392472-C-T BY138946 YY+
17720504-C-T 15608624-C-T BY42297 YY+
21742351-A-AT 19580465-A-AT 9×T+
18549944-T-G 16438064-T-G BY122092 Y+
16299339-T-C 14187459-T-C BY106764 YY+
7429864-A-G 7561823-A-G BY42293 YY+
7105709-C-T 7237668-C-T BY63355 YY+
8707606-A-G 8839565-A-G BY75334 YY+
19447076-G-T 17335196-G-T BY129127 YY+
6976748-C-G 7108707-C-G FT272550 Y+
18673161-A-T 16561281-A-T BY123018 YY+
17974647-T-G 15862767-T-G BY118850 Y+
6659645-T-C 6791604-T-C BY60590 YY+
18563997-C-G 16452117-C-G BY122235 YY+
8647447-A-G 8779406-A-G BY42294 YY+
17974652-A-T 15862772-A-T BY118851 Y+
23764152-C-CA 21602266-C-CA 8×A+
9041067-TA-T 9203458-TA-T +
9776657-G-A 9939048-G-A BY42295 Y+
16942476-G-A 14830596-G-A BY111281 YY+
21757125-T-C 19595239-T-C FGC39122 YY+
28786001-GAGTGA-G 26639854-GAGTGA-G *
13476625-C-T 11320949-C-T *
16809086-CAGAT-C 14697206-CAGAT-C 11×AGAT*
18160863-TGATG-T 16048983-TGATG-T 11×GATG*
22280758-G-T 20118872-G-T Z18107FT315290 DYZ19 *
28786671-GTGGAA-G 26640524-GTGGAA-G 5×TGGAA*
6230335-G-C 6362294-G-C IR3_Dst **
6489475-G-T 6621434-G-T **
10653133-C-CAGGTTA **
10653132-C-CTGTT **
8768807-C-A 8900766-C-A **
10653093-C-G **
6674526-C-A 6806485-C-A **
10653154-A-C **
6910525-C-A 7042484-C-A **
6953508-C-A 7085467-C-A **
9881714-C-A 10044105-C-A **
6732711-G-A 6864670-G-A **
10654210-ACACTC-A **
6090473-G-A 6222432-G-A **
5800065-A-G 5932024-A-G **
5701953-T-G 5833912-T-G **
5256999-G-T 5388958-G-T **
10668169-C-T **
4873651-A-G 5005610-A-G **
10691942-C-A **
10693158-C-T **
3847284-G-T 3979243-G-T **
3834780-A-G 3966739-A-G **
3275845-T-G 3407804-T-G **
10750123-A-T **
2980818-A-C 3112777-A-C **
2860128-TG-C 2992087-TG-C **
2860127-T-C 2992086-T-C **
6988388-A-C 7120347-A-C **
7079239-C-G 7211198-C-G **
8721539-G-T 8853498-G-T **
7695789-C-A 7827748-C-A **
8907108-TTATATTTTCATATTTAAAATATGTATATATTTATATGA-T 9039067-TTATATTTTCATATTTAAAATATGTATATATTTATATGA-T **
8286705-C-A 8418664-C-A **
8207897-C-A 8339856-C-A **
9003273-TG-T 9165664-TG-T **
8090200-A-G 8222159-A-G **
8024997-C-A 8156956-C-A **
7999020-C-A 8130979-C-A **
7925959-C-A 8057918-C-A **
7868225-C-A 8000184-C-A 9×A**
7782861-T-G 7914820-T-G **
7702364-T-C 7834323-T-C **
9407603-C-A 9569994-C-A **
9418865-C-A 9581256-C-A **
2847329-C-A 2979288-C-A **
7651443-C-A 7783402-C-A **
7079216-G-A 7211175-G-A **
7262796-C-A 7394755-C-A **
8840463-G-T 8972422-G-T **
7089855-C-A 7221814-C-A **
8715192-C-A 8847151-C-A **
9560166-G-T 9722557-G-T IR3_Prx **
7188172-G-T 7320131-G-T **
7262780-C-A 7394739-C-A **
7382526-T-C 7514485-T-C **
7433392-C-A 7565351-C-A **
7382535-G-A 7514494-G-A FT364945 **
7399479-G-A 7531438-G-A **
7431719-T-C 7563678-T-C **
9519822-T-TC 9682213-T-TC **
9519819-TC-T 9682210-TC-T **
7431735-G-A 7563694-G-A **
7093834-C-A 7225793-C-A **
9666579-A-AAAT 9828970-A-AAAT IR3_Prx 11×AAT**
2763738-C-A 2895697-C-A **
7974761-C-A 8106720-C-A **
23052931-C-A 20891045-C-A **
15773652-A-G 13661772-A-G **
7111927-C-A 7243886-C-A **
15495001-C-A 13383121-C-A **
10827063-C-A **
14924378-C-A 12812443-C-A **
9839518-C-A 10001909-C-A **
10934227-C-A **
11018255-C-A **
10934232-C-A **
13319231-C-A 11163555-C-A **
15161334-T-A 13049420-T-A **
21168981-C-A 19007095-C-A **
14027094-C-A 11906388-C-A **
10663159-C-A **
16922206-T-C 14810326-T-C **
18602198-T-C 16490318-T-C **
13453316-T-G 11297640-T-G **
10771910-C-A **
14444880-C-A 12324153-C-A **
11000478-C-A **
10873178-C-A **
3164572-C-A 3296531-C-A **
13885958-C-A 11765252-C-A **
13453308-C-T 11297632-C-T **
10825663-A-T **
24872697-G-GTT 22726550-G-GTT IR1_R 11×T**
13453329-C-G 11297653-C-G **
13453269-C-T 11297593-C-T **
10925266-C-A **
13593616-T-G 11437940-T-G **
23597906-ATATT-A 21436020-ATATT-A 5×TATT**
13458005-C-T 11302329-C-T **
16758589-C-A 14646709-C-A **
10771858-A-T **
13453334-C-T 11297658-C-T **
28111576-C-T 25965429-C-T P1_Y2 **
17399657-C-A 15287777-C-A **
21469170-C-A 19307284-C-A **
10750136-C-G **
15714434-C-A 13602554-C-A **
10653149-A-T **
3164579-C-A 3296538-C-A FT135414 **
11018237-C-CAATT **
11018239-A-AT **
11018267-C-CTATTG **
18714039-C-A 16602159-C-A **
19295556-G-T 17183676-G-T **
16823846-C-T 14711966-C-T **
14091741-C-A 11971035-C-A **
19395435-C-A 17283555-C-A **
10911495-C-T **
18631955-C-A 16520075-C-A **
13473747-C-T 11318071-C-T **
15957775-C-A 13845895-C-A **
9669752-G-T 9832143-G-T IR3_Prx **
17052680-C-A 14940800-C-A **
14893085-C-A 12781151-C-A **
10750115-G-T **
21176929-C-A 19015043-C-A **
7431721-G-T 7563680-G-T **
13896748-C-A 11776042-C-A **
22430050-A-C 20268164-A-C DYZ19 **
10889750-A-T **
7098094-C-A 7230053-C-A **
13457987-G-C 11302311-G-C **
14981830-TTTCCTTCCTTCC-T 12869906-TTTCC-T 16×TTCC**
7401874-C-A 7533833-C-A **
21262339-C-A 19100453-C-A **
17029428-C-A 14917548-C-A **
3407318-C-A 3539277-C-A **
10825639-T-C **
14502288-C-A 12390493-C-A **
14852997-C-A 12741063-C-A **
10880278-A-G **
22213722-C-A 20051836-C-A **
21489227-C-A 19327341-C-A **
10750132-G-A **
10965611-T-G **
10764732-C-A **
21139957-C-A 18978071-C-A **
19461499-C-A 17349619-C-A **
19472880-C-A 17361000-C-A **
19849309-C-A 17737429-C-A P5_Prx **
21047689-C-A 18885803-C-A **
21066200-C-A 18904314-C-A **
21128898-C-A 18967012-C-A **
21196317-C-A 19034431-C-A **
19415146-C-A 17303266-C-A **
21222189-T-C 19060303-T-C **
21283545-G-A 19121659-G-A **
21360480-A-G 19198594-A-G **
21565904-C-A 19404018-C-A **
22003196-C-A 19841310-C-A **
22010430-C-A 19848544-C-A **
22062144-C-A 19900258-C-A **
19453041-T-C 17341161-T-C **
19411988-A-C 17300108-A-C **
22565007-T-C 20403121-T-C **
18203665-C-A 16091785-C-A **
17741476-T-G 15629596-T-G **
17751024-C-A 15639144-C-A **
17853702-C-A 15741822-C-A **
17868977-C-A 15757097-C-A **
17872011-C-A 15760131-C-A **
18083812-C-A 15971932-C-A **
18115994-C-A 16004114-C-A **
18462547-C-A 16350667-C-A P6_Dst **
19394210-C-A 17282330-C-A **
18558789-C-G 16446909-C-G **
18558871-C-A 16446991-C-A **
18672653-C-A 16560773-C-A FT202093 **
18997380-C-A 16885500-C-A **
19298729-G-T 17186849-G-T **
19314704-T-C 17202824-T-C **
19369437-C-A 17257557-C-A **
22066173-C-A 19904287-C-A **
22587981-G-T 20426095-G-T **
17534616-C-A 15422736-C-A **
26033678-A-G 23887531-A-G P1_Y1 **
25901882-G-T 23755735-G-T P1_Y1 **
25901886-G-T 23755739-G-T P1_Y1 **
25901893-C-A 23755746-C-A P1_Y1 **
25901910-C-A 23755763-C-A P1_Y1 **
25901913-C-A 23755766-C-A P1_Y1 **
25901928-G-T 23755781-G-T P1_Y1 **
26033676-C-G 23887529-C-G P1_Y1 **
27920453-G-T 25774306-G-T P1_Y2 **
24458559-A-T 22312412-A-T **
27937163-C-A 25791016-C-A P1_Y2 **
28650053-A-T 26503906-A-T **
28674605-A-G 26528458-A-G FT44601 **
28754911-C-A 26608764-C-A **
28755121-T-G 26608974-T-G **
56850224-C-A **
56851541-C-T **
24458563-A-G 22312416-A-G **
24458540-A-G 22312393-A-G **
22633737-T-C 20471851-T-C **
23074651-C-A 20912765-C-A **
22697053-C-A 20535167-C-A **
22728855-A-C 20566969-A-C FT44013 **
22791101-C-A 20629215-C-A **
22791136-C-A 20629250-C-A **
22812108-C-A 20650222-C-A **
22818975-C-A 20657089-C-A **
22968034-C-A 20806148-C-A **
23132091-C-A 20970205-C-A **
24458535-T-C 22312388-T-C **
23463850-C-A 21301964-C-A **
23471485-T-C 21309599-T-C **
23734406-C-A 21572520-C-A **
23773964-C-A 21612078-C-A **
23782141-T-C 21620255-T-C **
24290801-TGC-A 22144654-TGC-A P3_t1 **
24385130-C-A 22238983-C-A **
17605057-T-C 15493177-T-C **
17284581-G-T 15172701-G-T **
10790257-T-C **
13453319-CA-C 11297643-CA-C **
11028152-CACCAT-C **
11028159-C-G **
13222076-G-A 11066400-G-A **
13227699-C-A 11072023-C-A **
13239874-T-G 11084198-T-G **
13294330-G-A 11138654-G-A **
13316097-C-A 11160421-C-A **
13473773-G-T 11318097-G-T **
11010152-C-A **
13654473-G-T 11498797-G-T **
14232337-C-A 12111631-C-A **
14245044-A-C 12124338-A-C **
14284562-G-A 12163856-G-A FT41508 **
14346620-C-A 12225915-C-A **
14372877-C-A 12252173-C-A FT281560 **
14451982-C-T 12331255-C-T **
11028138-T-G **
10983643-C-A **
14485733-G-T 12365002-G-T **
10851753-C-A **
10797975-C-A **
10801682-C-CACTGA **
10808607-A-C **
10810893-T-G **
10827054-C-A **
10844065-A-TCACTC **
10849872-C-A **
10883095-C-CTTCAA **
10976752-A-G **
10889795-C-CGGATG **
10909710-C-G **
10911506-C-T FT262855 **
10927147-C-A **
10950592-C-A **
10959731-A-C **
10976756-T-C **
14471636-C-A 12350905-C-A **
14519009-T-C 12407210-T-C **
17037374-C-A 14925494-C-A **
16258162-C-A 14146282-C-A **
15764241-C-A 13652361-C-A **
15786181-CA-C 13674301-CA-C **
15832345-C-T 13720465-C-T **
15832364-G-A 13720484-G-A **
15862383-C-A 13750503-C-A **
16229884-C-A 14118004-C-A **
16247691-T-C 14135811-T-C **
16330573-C-A 14218693-C-A **
15724273-C-A 13612393-C-A **
16351421-C-A 14239541-C-A **
16429934-G-T 14318054-G-T FT336783 **
16679167-T-A 14567287-T-A **
16691378-A-G 14579498-A-G **
16744981-C-A 14633101-C-A **
16908776-C-A 14796896-C-A **
16922214-A-G 14810334-A-G **
15750521-C-TA 13638641-C-TA **
15689172-C-A 13577292-C-A **
14519010-G-A 12407211-G-A **
14930594-A-C 12818659-A-C **
14549038-C-A 12437239-C-A **
14550519-C-A 12438720-C-A **
14570731-T-C 12458931-T-C **
14570732-G-A 12458932-G-A **
14610715-T-C 12498917-T-C **
14859955-G-T 12748021-G-T **
14923883-C-A 12811948-C-A **
14941160-C-A 12829234-C-A **
15664102-C-A 13552222-C-A **
15051216-AC-A 12939307-AC-A **
15074313-C-A 12962403-C-A **
15176443-C-A 13064529-C-A **
15252174-C-A 13140260-C-A FTB63472 **
15311086-C-A 13199191-C-A **
15325047-C-A 13213165-C-A **
15394911-T-A 13283031-T-A **
10911477-T-A **
10934231-C-A **
17054890-T-C 14943010-T-C **
20603940-C-A 18442054-C-A P5_Dst **
13460897-C-T 11305221-C-T **
13460923-C-T 11305247-C-T **
13460929-G-A 11305253-G-A **
10924382-C-A **
10924394-T-G **
13458003-T-C 11302327-T-C **
17942774-C-A 15830894-C-A **
7142792-C-A 7274751-C-A **
13460880-T-C 11305204-T-C **
13902872-C-A 11782166-C-A **
7591204-A-AT 7723163-A-AT 11×T**
8109998-C-A 8241957-C-A **
7079223-A-T 7211182-A-T **
7079232-T-C 7211191-T-C **
7079235-A-G 7211194-A-G **
16181483-C-A 14069603-C-A **
13460896-T-C 11305220-T-C **
13460877-G-C 11305201-G-C **
10756377-G-C **
10892577-C-G **
10808976-C-G **
10808985-C-T **
10808986-T-TCCGCA **
10808993-C-A **
10809001-T-TAGATC **
18950765-C-A 16838885-C-A **
10663817-C-T **
10770588-C-T **
10995804-C-T **
10770604-A-T **
10770617-A-TTATTCCATTT **
14910798-A-T 12798865-A-T 21×T**
10841963-C-A FT433656 **
22974116-C-CA 20812230-C-CA 24×A**
18328809-G-T 16216929-G-T P6_Prx **
19682835-G-C 17570955-G-C P5_Prx **
10775958-TCGGTG-T **
10756363-C-T **
15882587-CT-C 13770707-CT-C 9×T**
10808960-T-C **
15364051-C-A 13252171-C-A **
10947642-C-T **
18443471-A-T 16331591-A-T P6_Dst **
7310458-T-C 7442417-T-C **
27887002-AC-A 25740855-AC-A P1_Y2 **
10964649-C-A **
11020136-C-A **
10825658-A-G **
23834644-TTTTA-T 21672758-TTTTA-T 5×TTTA**
10775971-A-C **
10657404-C-G **
10836564-C-A **
5220989-C-A 5352948-C-A **
10947621-C-T **
11018208-G-C **
11006175-C-A **
11006184-A-T **
11006188-T-A **
10775975-C-A **
10892508-C-T **
10895758-T-C **
10927205-T-C **
10801688-A-C **
10892587-C-T **
9462232-C-A 9624623-C-A **
10986375-A-T **
10994366-C-T **
10895763-T-TTGTAA **
8019413-GA-G 8151372-GA-G 10×A**
10927215-C-T **
14299845-C-A 12179139-C-A **
10927233-C-A **
18756798-GTTT-G 16644918-GTTT-G 19×T**
8720610-C-A 8852569-C-A **
10841959-C-T **
10841964-C-T **
10841969-CA-C **
10986374-C-G **
15743986-C-A 13632106-C-A **
10808975-C-T **
11036072-T-G **
10979829-T-A **
10802375-TCATTC-T **
2845821-CAA-C 2977780-CAA-C 28×A**
58982913-A-G 56836766-A-G **
13489011-CAT-C 11333335-CAT-C **
16244840-C-A 14132960-C-A **
18052568-ATTT-A 15940688-ATTT-A 16×T**
6403549-G-A 6535508-G-A **
10678606-C-T **
10964520-A-T **
13479691-A-G 11324015-A-G **
10964524-T-C **
10964529-T-A **
10969123-T-C **
10969131-A-C **
10969136-C-T **
10969167-C-T **
10969173-G-C **
10975805-C-G BY160838 **
22710641-T-TA 20548755-T-TA 10×A**
14784724-G-T 12672794-G-T **
7939680-C-A 8071639-C-A **
13460916-T-A 11305240-T-A **
20603841-GGA-G 18441955-GGA-G P5_Dst 18×GA**
17597175-G-T 15485295-G-T **
17420330-TA-T 15308450-TA-T 10×A**
15579657-GAA-G 13467777-GAA-G 14×A**
23471038-CAAAAAA-C 21309152-CAAAAAA-C 19×A**
58883603-A-C 56707268-T-G **
23052978-C-A 20891092-C-A **
7367295-TCTC-T 7499254-TCTC-T 6×CTC**
22201977-G-GA 20040091-G-GA 9×A**
16308153-ATG-A 14196273-ATG-A **
21189443-G-A 19027557-G-A Y14019 FGC19709 **
23091423-C-A 20929537-C-A Z24406 **
23435178-TG-T 21273292-TG-T **
13489077-T-G 11333401-T-G **
13460862-C-G 11305186-C-G **
15669964-C-CA 13558084-C-CA 18×A**
28602505-AT-A 26456358-AT-A 19×T**
10975808-T-C BY160840 **
27757832-C-A 25611685-C-A P1_Y2 **
10792729-A-ACAATG **
10775930-C-A **
10841928-T-G **
10955521-T-C **
10775889-C-A **
10775902-T-G **
10775910-T-C **
10775926-G-T **
10775927-C-T **
10755394-C-CCA **
10841931-T-C **
10924396-C-G **
10952449-C-T **
10952474-C-G **
10952502-T-C **
10657416-A-T **
11030248-G-A **
11030252-C-A **
10667044-C-T **
10761197-G-A **
10927063-T-C **
18480350-T-A 16368470-T-A P6_Dst **
10986865-T-G **
10825284-C-CT **
10678046-C-T **
10834077-G-A **
10834104-G-C **
10834106-G-T **
10927248-C-T **
10927255-C-T **
10892595-T-C **
10927061-C-T **
56841748-T-A **
56841751-T-C **
56841761-A-T **
10775925-T-C **
10756888-T-G **
24290813-C-A 22144666-C-A P3_t1 **
10927045-G-C **
10927050-C-CTCTTTTCAAG **
10927022-T-A **
13456901-C-A 11301225-C-A **
10979835-T-C **
25955585-C-A 23809438-C-A P1_Y1 **
10909696-G-T **
7431714-A-C 7563673-A-C **
7431720-G-A 7563679-G-A **
10930778-C-T **
10930788-T-C **
10930818-A-C **
19479732-C-A 17367852-C-A **
10757346-CCTCCA-C **
7418072-TC-T 7550031-TC-T **
10744252-C-T **
10979847-T-C **
10955485-C-G **
10955497-A-G **
16514367-C-A 14402487-C-A **
16745197-C-A 14633317-C-A **
10964662-C-A **
10979874-C-A **
23300554-CTTTT-C 21138668-CTTTT-C 16×T**
10979846-C-A **
10892553-C-A **
10892582-C-G **
15832322-G-A 13720442-G-A ZS8588 **
10631453-A-T **
10979820-C-G **
10979830-C-T **
10979861-T-G **
20974876-CA-C 18812990-CA-C P4_Dst **
10979873-T-C **
24602322-T-TG 22456175-T-TG P3_t2 **
10780654-C-A **
10653143-C-T **
10750120-A-C **
6891883-C-A 7023842-C-A **
10773300-C-A **
10949339-T-A **
10994369-T-C **
10892519-A-ATCCCG **
10821821-C-A **
10792774-A-T **
22521095-C-A 20359209-C-A **
13893688-C-A 11772982-C-A **
10976935-T-A **
10855938-G-T **
23397068-C-A 21235182-C-A **
4201550-C-A 4333509-C-A **
16823851-A-G 14711971-A-G **
15832302-A-G 13720422-A-G **
15832305-T-C 13720425-T-C **
15348235-C-A 13236354-C-A **
10976719-T-C **
6321385-C-CAA 6453344-C-CAA IR3_Dst **
28763518-C-A 26617371-C-A **
5336668-G-T 5468627-G-T **
15832306-T-C 13720426-T-C **
10771871-G-T **
10994374-C-G **
4201199-C-A 4333158-C-A **
15421326-C-A 13309446-C-A **
9181060-C-A 9343451-C-A **
22651544-G-GTA 20489658-G-GTA **
14451991-T-C 12331264-T-C **
14409092-C-A 12288389-C-A **
14261729-C-A 12141023-C-A **
56847562-C-A **
24886540-C-A 22740393-C-A g1 **
13457997-G-T 11302321-G-T **
13306121-C-A 11150445-C-A **
7310434-ATT-A 7442393-ATT-A **
10825661-C-A **
28777178-C-A 26631031-C-A **
9966211-C-A 10128602-C-A **
13696492-T-C 11540816-T-C **
10892549-A-C **
24971-C-A **
10772455-C-T **
10909686-AG-A **
10880310-T-A **
22970281-TC-T 20808395-TC-T **
11010023-C-A **
13460881-A-T 11305205-A-T **
18871681-AAG-A 16759801-AAG-A **
13460842-T-A 11305166-T-A **
10772459-T-A **
8013511-C-A 8145470-C-A **
23397192-C-A 21235306-C-A **
15873397-C-A 13761517-C-A **
22755400-GAA-G 20593514-GAA-G 14×A**
13468986-C-A 11313310-C-A **
10927010-C-T **
11018265-T-C **
10979883-A-C **
9307438-C-A 9469829-C-A **
10772465-C-A **
13453280-GT-G 11297604-GT-G **
18994663-AAAAG-A 16882783-AAAAG-A 5×AAAG**
14886398-TC-T 12774464-TC-T **
10808627-A-T **
10755380-T-A **
18443451-C-A 16331571-C-A P6_Dst **
10750058-C-T **
20778610-C-A 18616724-C-A P4_Prx **
22764750-C-A 20602864-C-A ***
7718018-T-A 7849977-T-A ***
28600983-AT-A,ATT 26454836-AT-A,ATT 17×T***
22040048-C-A 19878162-C-A ***
56837335-T-A ***
56830331-T-A ***
22068442-A-G 19906556-A-G ***
22123914-C-A 19962028-C-A ***
22200565-AA-A,AG 20038679-AA-A,AG ***
7718008-C-G 7849967-C-G ***
19529079-T-C 17417199-T-C ***
13461844-G-T 11306168-G-T ***
15588715-CA-C,CAA 13476835-CA-C,CAA 14×A***
19513143-CTTTTTTT-C 17401263-CTTTTTTT-C 20×T***
22835395-C-A 20673509-C-A ***
14883700-GT-G 12771766-GT-G 11×T***
13881112-C-A 11760406-C-A ***
22617199-C-A 20455313-C-A ***
13273298-C-A 11117622-C-A ***
23062167-C-A 20900281-C-A ***
8745739-C-A 8877698-C-A ***
18924602-T-TATTCATTC 16812722-T-TATTCATTC 9×ATTC***
14979496-TA-T 12867572-TA-T 10×A***
21211181-A-G 19049295-A-G ***
22006541-C-A 19844655-C-A ***
21773101-C-A 19611215-C-A ***
10794278-C-T ***
10794259-CAATCCACTCT-C,CAATCCATTCC ***
21362506-C-A 19200620-C-A ***
56843954-C-A ***
21211179-A-C 19049293-A-C ***
21606286-C-A 19444400-C-A ***
21672399-G-A 19510513-G-A ***
21686254-C-A 19524368-C-A ***
21211170-G-C 19049284-G-C ***
9138162-G-T 9300553-G-T ***
18627961-C-A 16516081-C-A ***
9047912-G-T 9210303-G-T ***
21165361-C-A 19003475-C-A ***
21827740-A-G 19665854-A-G ***
9452283-C-T 9614674-C-T ***
21934980-ATTTT-A,ATT 19773094-ATTTT-A,ATT 17×T***
21939450-C-A 19777564-C-A ***
21948336-C-A 19786450-C-A ***
15205668-GAA-G 13093754-GAA-G 11×A***
10992847-C-A ***
4862655-G-GA 4994614-G-GA 10×A***
9458021-C-A 9620412-C-A ***
13483329-A-G,T 11327653-A-G,T ***
7718031-T-A 7849990-T-A ***
16275740-CA-C 14163860-CA-C ***
7583290-CT-C 7715249-CT-C 9×T***
9416098-C-A 9578489-C-A ***
7978267-C-A 8110226-C-A ***
8600115-C-A 8732074-C-A ***
24460373-GTTTGAGGATTTTTTTTTTAAATAATGGAGAAGTTTTCAAGGAA-G,GTTTGAGGATTTTTTTTTAAAATAATGGAGAAGTTTTCAAGGAA 22314226-GTTTGAGGATTTTTTTTTTAAATAATGGAGAAGTTTTCAAGGAA-G,GTTTGAGGATTTTTTTTTAAAATAATGGAGAAGTTTTCAAGGAA ***
15635608-C-A 13523728-C-A ***
9842959-G-GA 10005350-G-GA 12×A***
10982272-C-A ***
7101772-TA-T 7233731-TA-T 10×A***
21907711-GT-G 19745825-GT-G 11×T***
14251935-TA-T 12131229-TA-T 10×A***
8274571-C-CT 8406530-C-CT 12×T***
10849652-A-C ***
24440107-C-A 22293960-C-A ***
14186864-C-A 12066158-C-A ***
28099410-C-T 25953263-C-T P1_Y2 ***
28497834-C-A 26351687-C-A ***
58981827-A-C 56835680-A-C ***
7994044-C-A 8126003-C-A ***
8105396-CA-C 8237355-CA-C 10×A***
10667004-C-G,GGTTTA ***
28794100-G-A 26647953-G-A ***
56830345-TTGCAT-T,TTGCAG ***
16626085-TAA-T 14514205-TAA-T 13×A***
22167767-C-A 20005881-C-A ***
8607610-CTT-C,CT 8739569-CTT-C,CT 12×T***
8627544-G-A 8759503-G-A ***
7718027-A-AC 7849986-A-AC ***
23389531-CTTTTT-C,CTTTT 21227645-CTTTTT-C,CTTTT 18×T***
22865106-C-A 20703220-C-A ***
22869167-C-A 20707281-C-A ***
8718211-A-G 8850170-A-G ***
23007571-G-A 20845685-G-A ***
15158591-C-A 13046677-C-A ***
23033879-C-A 20871993-C-A ***
21407291-GT-G 19245405-GT-G 11×T***
18901668-C-A 16789788-C-A ***
23207074-C-A 21045188-C-A ***
23304357-C-A 21142471-C-A ***
16778333-CT-C 14666453-CT-C 10×T***
23396593-T-C 21234707-T-C ***
24365892-C-A 22219745-C-A ***
15483839-C-A 13371959-C-A ***
17047880-ATT-A,AT 14936000-ATT-A,AT 16×T***
23499024-C-A 21337138-C-A ***
8713888-C-A 8845847-C-A ***
23741800-C-A 21579914-C-A ***
23248560-TA-T 21086674-TA-T 11×A***
9901684-C-CT 10064075-C-CT 12×T***
7718033-GT-G 7849992-GT-G ***
23809489-G-T 21647603-G-T ***
17473821-TA-T 15361941-TA-T 10×A***
24359805-C-A 22213658-C-A ***
6400850-C-A 6532809-C-A ***
11014466-C-G ***
23005215-CG-C 20843329-CG-C ***
10987805-A-T ***
15576117-C-A 13464237-C-A ***
18336231-CAAAT-C 16224351-CAAAT-C P6_Prx 4×AAAT***
15712125-C-A 13600245-C-A ***
9105202-CAAA-C 9267593-CAAA-C 15×A***
23257927-C-CT 21096041-C-CT 9×T***
10971924-T-C ***
18942219-C-A 16830339-C-A FT297850 ***
10987813-C-T ***
15940520-C-CTT 13828640-C-CTT 12×T***
10987810-A-T ***
16250817-C-A 14138937-C-A ***
15360653-C-A 13248773-C-A ***
8702806-C-A 8834765-C-A ***
6012848-C-A 6144807-C-A ***
10682574-T-G ***
16350517-GAAAA-G,GAAA 14238637-GAAAA-G,GAAA 12×A***
16401962-C-A 14290082-C-A ***
16453221-C-A 14341341-C-A ***
16527745-C-A 14415865-C-A ***
56827687-T-C,GCATGCCATCCGATTC ***
11014468-A-G ***
7247821-C-A 7379780-C-A ***
21564033-C-A 19402147-C-A ***
15411786-C-A 13299906-C-A ***
6846782-C-A 6978741-C-A ***
16863817-T-C 14751937-T-C ***
2761036-A-G 2892995-A-G ***
3409255-C-A 3541214-C-A ***
13464423-CC-C,CT 11308747-CC-C,CT ***
4442784-C-A 4574743-C-A ***
13935351-C-A 11814645-C-A ***
11014358-A-T ***
14266742-C-A 12146036-C-A ***
56837328-C-A ***
56837331-G-C ***
2841004-C-A 2972963-C-A ***
2793690-C-A 2925649-C-A ***
56837347-C-T ***
14504953-C-A 12393158-C-A ***
15239874-C-A 13127960-C-A ***
6444930-C-A 6576889-C-A ***
14825110-C-A 12713177-C-A ***
14840825-C-A 12728892-C-A ***
6662184-G-A 6794143-G-A ***
14887094-CTT-C 12775160-CTT-C 11×T***
10849655-C-G ***
14548967-C-A 12437168-C-A ***
21211168-T-C 19049282-T-C ***
15104087-C-T 12992175-C-T ***
15128908-C-A 13016995-C-A ***
2780236-T-TA 2912195-T-TA 11×A***
16781257-C-A 14669377-C-A ***
16863820-A-G 14751940-A-G ***
9458669-G-GA 9621060-G-GA ***
18758753-C-A 16646873-C-A ***
9869993-C-A 10032384-C-A ***
13488622-GC-G 11332946-GC-G ***
10987832-TCC-T ***
9847622-C-A 10010013-C-A ***
56837341-C-T ***
18605985-C-G 16494105-C-G ***
18606973-C-A 16495093-C-A ***
18637295-ATT-A 16525415-ATT-A 10×T***
18650305-C-A 16538425-C-A ***
13457810-C-G 11302134-C-G ***
17529141-TAAA-T 15417261-TAAA-T 14×A***
18929270-C-A 16817390-C-A ***
18392972-C-A 16281092-C-A P6_Gap ***
18985208-C-A 16873328-C-A ***
13453474-C-CCGAAT 11297798-C-CCGAAT ***
19133347-C-A 17021467-C-A ***
19205828-C-G 17093948-C-G ***
19214910-G-A 17103030-G-A ***
19269186-C-A 17157306-C-A FTA46471 ***
9837243-A-G 9999634-A-G ***
23482894-CAA-C,CA 21321008-CAA-C,CA 15×A***
9013257-CAAAAA-C 9175648-CAAAAA-C 18×A***
15506880-C-A 13395000-C-A ***
10678656-T-C ***
18416533-C-A 16304653-C-A P6_Gap ***
18384151-C-A 16272271-C-A P6_Gap ***
16869303-C-T 14757423-C-T ***
8773858-CAAA-C,CA 8905817-CAAA-C,CA 16×A***
16890840-G-T 14778960-G-T ***
13842711-C-T 11722005-C-T ***
16992567-C-A 14880687-C-A ***
18737764-C-A 16625884-C-A ***
17091285-C-A 14979405-C-A ***
17149566-C-T 15037686-C-T BY156638 ***
7266320-C-A 7398279-C-A ***
21555238-CTT-C,CT 19393352-CTT-C,CT 15×T***
9520147-C-A 9682538-C-A ***
17386633-G-T 15274753-G-T ***
17392457-C-CA 15280577-C-CA ***
18854150-C-A 16742270-C-A ***
18247478-C-A 16135598-C-A ***
17710493-C-A 15598613-C-A ***
10925496-CTCCAT-C ***
13489505-C-G 11333829-C-G ***
10906370-G-T FT436138 ***
15472408-C-A 13360528-C-A ***
13842715-G-T 11722009-G-T ***
18593205-CT-C 16481325-CT-C 10×T***
17938885-C-A 15827005-C-A ***
7402446-C-A 7534405-C-A ***
10781648-G-T ***
10757984-CCACTA-C ***
17207791-C-A 15095911-C-A ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 287464832364068551206821558
Used in age calculations832364068551206821558
Counts of SNPs2621
Variant counts last updated 2022-07-13 03:00:34.



Big Tree Main Page