Tree Position

R-M269 > L23 > L51 > P310 > L151 > S1194 > S1200 > S14328 > 13184964-C-G > BY46915 > BY62252 > BY200917

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY3
200078
BigY2
200078
27882593-T-G 25736446-T-G P1_Y2 A+
10852734-C-G A*
3185978-G-A 3317937-G-A A*
18453975-C-CA 16342095-C-CA P6_Dst 10×AA*
18455885-C-T 16344005-C-T P6_Dst A*
13471916-C-T 11316240-C-T A*
13463921-A-T 11308245-A-T A*
58974940-C-G 56828793-C-G A*
58980401-A-G 56834254-A-G A*
10852741-C-G A*
20579299-C-CAT 18417413-C-CAT P5_Dst A*
18455894-A-G 16344014-A-G P6_Dst A*
18470750-G-C 16358870-G-C P6_Dst A*
10852764-C-A A*
10852731-T-C A*
19670770-G-GTC 17558890-G-GTC P5_Prx 8×TCA*
13860065-G-C 11739359-G-C A*
10852755-T-C A*
10852746-C-A A*
10958440-T-A A*
18455884-A-G 16344004-A-G P6_Dst A*
56830739-T-TCACTC A*
18455895-C-T 16344015-C-T P6_Dst A*
24009713-G-C 21863566-G-C YA*
20312787-C-CT 18150901-C-CT P5_Dst 16×TA*
20428495-A-AT 18266609-A-AT P5_Dst 15×TA*
18499927-G-GA 16388047-G-GA P6_Dst 13×AA*
20281549-T-C 18119663-T-C P5_Dst A*
20326700-G-A 18164814-G-A P5_Dst A*
7165693-T-C 7297652-T-C M4584 YA*
58982467-T-A 56836320-T-A A*
26204963-G-C 24058816-G-C P1_Y1 +***
8072764-T-G 8204723-T-G FT89089 Y+
10982485-C-A FT439109 +
7750425-C-A 7882384-C-A FT179095 YY++
7750424-T-A 7882383-T-A BY205913 YY++
14107467-C-T 11986761-C-T Y*
22231226-T-C 20069340-T-C DYZ19 ****
7428457-T-C 7560416-T-C CTS1472 YY*
14107429-G-A 11986723-G-A FT111220 Y*
13476906-C-A 11321230-C-A *
13648962-A-AGGAAT 11493286-A-AGGAAT 9×GGAAT****
10946819-C-A **
28818457-A-G 26672310-A-G **
56847615-C-A **
8181303-C-T 8313262-C-T **
6882265-C-A 7014224-C-A **
21476058-C-G 19314172-C-G **
9605896-A-C 9768287-A-C IR3_Prx **
10988757-C-T **
13467192-G-C 11311516-G-C **
13799230-TAATGG-T 11678524-TAATGG-T 4×AATGG*****
10839904-C-A **
17886456-C-A 15774576-C-A **
17306457-C-A 15194577-C-A **
18890965-T-C 16779085-T-C **
11006108-A-G **
10969198-T-G **
21476061-C-T 19314175-C-T **
10839556-C-A **
10685951-A-T **
6336352-T-G 6468311-T-G IR3_Dst **
10808005-C-T **
24250859-TAC-T 22104712-TAC-T P3_b1 **
28819301-G-C 26673154-G-C **
14549268-C-A 12437469-C-A **
13441643-A-G 11285967-A-G **
19739360-A-C 17627480-A-C P5_Prx **
10789962-C-A **
5888339-C-A 6020298-C-A **
11005466-T-A **
10906881-G-T **
18890962-G-T 16779082-G-T **
3478964-C-A 3610923-C-A **
3410246-A-C 3542205-A-C **
2951368-C-A 3083327-C-A **
2928604-C-A 3060563-C-A **
8181277-G-T 8313236-G-T **
8181252-G-A 8313211-G-A **
10994441-C-T **
10844542-A-C **
10983907-C-T **
19268339-C-A 17156459-C-A **
15070471-T-C 12958562-T-C **
4537878-C-A 4669837-C-A **
19720913-C-A 17609033-C-A P5_Prx **
3418613-G-C 3550572-G-C **
16396391-C-T 14284511-C-T **
14456156-C-A 12335429-C-A **
10679069-C-A **
3491486-C-T 3623445-C-T **
10844539-T-A **
10932940-C-A **
10835353-C-T **
10808011-C-A **
10844530-G-C **
20640424-G-T 18478538-G-T P4_Prx **
10839923-A-T **
20809369-T-G 18647483-T-G P4_Gap **
9013047-A-C 9175438-A-C **
27499340-AG-A 25353193-AG-A P1_Y2 **
10789966-C-A **
5060207-A-C 5192166-A-C **
10032852-C-A 10195243-C-A **
7223135-C-A 7355094-C-A **
16490764-C-A 14378884-C-A **
10932880-C-T **
14992665-C-A 12880750-C-A **
18963965-C-A 16852085-C-A **
10880926-G-T **
10880938-C-A **
10880942-C-A **
17802166-TA-T 15690286-TA-T 30×A**
14815885-C-A 12703956-C-A **
10677569-C-T **
13809781-C-A 11689075-C-A **
4788890-C-A 4920849-C-A **
7221557-C-A 7353516-C-A **
10691179-C-T **
10807987-T-A **
23884435-A-AAG 21722549-A-AAG **
13468092-A-G 11312416-A-G **
17276184-G-T 15164304-G-T **
3545908-C-A 3677867-C-A **
10829276-G-C **
8369583-C-A 8501542-C-A **
11022014-T-A **
10899074-C-G **
21323476-C-A 19161590-C-A **
10930768-C-T **
10930790-G-C **
14464331-A-T 12343604-A-T 13×T**
11031792-C-A **
13705398-A-C 11549722-A-C **
21394730-C-A 19232844-C-A **
11020153-T-G **
28819286-G-T 26673139-G-T **
10835367-A-C **
19476593-CT-C 17364713-CT-C 9×T**
10973723-C-A **
16629354-A-T 14517474-A-T **
13726404-G-T 11570728-G-T **
10829282-C-T **
10843631-T-C **
13483315-C-T 11327639-C-T **
10925625-A-ACTTCG **
10925599-CATACT-C **
4806344-G-A 4938303-G-A **
14279800-C-A 12159094-C-A **
10875995-T-G FT178416 **
17898069-C-A 15786189-C-A **
10983906-A-T **
10925610-G-C **
25885854-AG-A 23739707-AG-A P1_Y1 **
22190692-C-A 20028806-C-A **
19732412-C-GGG 17620532-C-GGG P5_Prx **
3869896-T-C 4001855-T-C **
18890967-C-A 16779087-C-A **
10877830-A-G **
10843626-G-C **
10925620-A-T **
9810892-C-A 9973283-C-A **
4919557-C-A 5051516-C-A **
8827302-C-T 8959261-C-T **
24276486-A-AC 22130339-A-AC P3_b1 **
14505905-C-A 12394110-C-A **
21515861-TCAAAAA-T 19353975-TCAAAAA-T **
10863252-G-T **
21923899-A-G 19762013-A-G **
10829280-T-C **
10930778-C-A **
28483683-C-A 26337536-C-A **
2884803-C-A 3016762-C-A **
8181357-G-A 8313316-G-A **
18463115-TG-T 16351235-TG-T P6_Dst **
13445532-C-A 11289856-C-A **
11658248-G-T **
22257942-T-A 20096056-T-A DYZ19 **
10997339-C-T **
3712057-A-C 3844016-A-C **
4865431-T-G 4997390-T-G **
4032027-C-A 4163986-C-A **
19489275-C-A 17377395-C-A **
18631043-A-C 16519163-A-C **
18687516-G-T 16575636-G-T **
18767034-G-T 16655154-G-T **
18767111-A-C 16655231-A-C **
18853514-T-C 16741634-T-C **
19043138-G-T 16931258-G-T **
19524530-A-T 17412650-A-T **
18421608-C-T 16309728-C-T P6_Gap **
19678479-G-T 17566599-G-T P5_Prx **
19705259-T-G 17593379-T-G P5_Prx **
19753405-T-TC 17641525-T-TC P5_Prx **
19826361-T-A 17714481-T-A P5_Prx **
20881862-C-CAAA 18719976-C-CAAA P4_Dst 16×A**
21002539-C-CTGGCTGACTGCCTG 18840653-C-CTGGCTGACTGCCTG P4_Dst **
18577985-C-T 16466105-C-T **
18188191-T-G 16076311-T-G **
21275538-T-A 19113652-T-A **
16004038-C-A 13892158-C-A **
15606792-G-T 13494912-G-T **
15732925-A-G 13621045-A-G **
15743839-G-T 13631959-G-T **
15749276-A-G 13637396-A-G **
15749331-A-G 13637451-A-G **
15769311-G-T 13657431-G-T **
16324100-G-A 14212220-G-A **
18014754-G-T 15902874-G-T P7_Dst **
16480949-C-A 14369069-C-A **
16607854-A-T 14495974-A-T **
17377778-G-T 15265898-G-T **
17642942-G-T 15531062-G-T **
17642949-T-C 15531069-T-C **
17870895-A-G 15759015-A-G **
18014737-A-T 15902857-A-T P7_Dst **
21242717-G-T 19080831-G-T **
21306618-GAA-G 19144732-GAA-G **
14700934-A-C 12589000-A-C **
8786161-A-G 8918120-A-G **
28700516-T-G 26554369-T-G **
28819313-T-A 26673166-T-A **
56825029-C-T **
56838306-G-T **
15100420-G-A 12988508-G-A **
56847606-C-A **
13467178-G-C 11311502-G-C **
28594323-C-A 26448176-C-A **
13467181-A-C 11311505-A-C **
13467183-A-T 11311507-A-T **
13467198-C-T 11311522-C-T **
20256961-C-A 18095075-C-A P5_Dst **
11012529-N-A **
7886003-T-C 8017962-T-C **
28601756-A-G 26455609-A-G **
27727504-C-A 25581357-C-A P1_Y2 **
21321140-G-T 19159254-G-T **
23029860-C-A 20867974-C-A **
21554357-T-C 19392471-T-C **
21886067-C-A 19724181-C-A **
22124143-C-A 19962257-C-A **
22169435-T-G 20007549-T-G **
22182969-TG-T 20021083-TG-T **
22506439-A-G 20344553-A-G FGC48171 DYZ19 **
23848545-C-A 21686659-C-A **
26379314-C-A 24233167-C-A P1_Y1 **
24250893-C-CAT 22104746-C-CAT P3_b1 **
24407371-T-G 22261224-T-G **
24524325-C-G 22378178-C-G P3_t2 **
24524343-C-G 22378196-C-G P3_t2 **
24595428-T-G 22449281-T-G P3_t2 **
25930337-G-T 23784190-G-T P1_Y1 **
26146924-A-C 24000777-A-C P1_Y1 **
15111383-GTATTTTT-G 12999470-GTATTTTT-G **
14532123-G-A 12420324-G-A **
4052618-C-A 4184577-C-A **
8966547-C-A 9128938-C-A **
7469822-T-G 7601781-T-G IR1_L **
7829015-A-C 7960974-A-C **
8181240-G-A 8313199-G-A **
8181284-C-A 8313243-C-A **
8792996-T-G 8924955-T-G **
9057363-A-C **
10016019-T-G 10178410-T-G **
7167001-G-A 7298960-G-A **
10685949-A-T **
10691182-C-G **
10692045-CATTACAATGCA-C **
10748513-C-A **
10769048-T-G **
10769070-T-G **
7341621-C-A 7473580-C-A **
7155588-C-A 7287547-C-A **
10771316-T-G **
5715258-G-A 5847217-G-A **
4163828-C-A 4295787-C-A **
4448727-A-G 4580686-A-G **
4484832-A-C 4616791-A-C **
4779889-A-C 4911848-A-C **
5546852-C-A 5678811-C-A **
5684728-T-C 5816687-T-C **
5861240-T-C 5993199-T-C **
7154731-A-T 7286690-A-T **
6163477-G-T 6295436-G-T IR3_Dst **
6517408-C-A 6649367-C-A **
6694108-TTATC-T 6826067-TTATC-T **
6765992-AT-A 6897951-AT-A **
6830625-G-A 6962584-G-A **
7081473-C-A 7213432-C-A **
10899075-C-T **
10770530-T-A **
10773144-T-G **
14514637-A-G 12402842-A-G **
13347884-G-A 11192208-G-A **
10996263-C-A **
10997293-G-A **
10997297-A-C **
10997327-C-T **
11033023-T-G **
13323330-CAA-C 11167654-CAA-C **
13468087-G-A 11312411-G-A **
10973703-C-A **
11659538-A-T **
13854763-C-A 11734057-C-A **
13858667-A-C 11737961-A-C **
13881463-C-G 11760757-C-G **
13963834-T-G 11843128-T-G **
14153074-G-A 12032368-G-A **
14251666-T-G 12130960-T-G **
10988752-T-A **
10971602-C-A **
10789982-C-A **
10839927-TA-T **
10792665-T-C **
10793527-C-A **
10794402-TCACATCC-T **
10802168-C-T **
10839892-C-G **
10839925-T-TG **
10844474-T-A **
10936200-T-C **
10844487-G-C **
10844548-C-A **
10852223-C-A **
10926822-CCACTG-C **
10930773-C-A FT436996 **
10932907-C-A **
10932927-CTCCAT-C **
7111799-T-C 7243758-T-C **
20022468-C-T 17910588-C-T P5_Prx **
10804515-T-C **
10831610-C-A **
10839894-C-T **
11033797-T-A **
11033795-G-C **
11033788-C-T **
10925584-C-A **
10999850-A-G **
10843020-C-A **
10804743-C-T **
10994279-C-A **
10980764-TAATCC-T **
10971968-A-T **
11000453-C-CACACT **
10843641-T-C **
10831605-G-C **
10817837-G-T **
10831602-T-A **
10831598-T-C **
10757502-TTCCTA-T **
10757499-A-C **
10757486-C-A **
10757479-C-T **
10757449-C-G **
26124427-C-CAAA 23978280-C-CAAA P1_Y1 31×A**
10851172-G-C **
10829313-C-A **
10829312-C-T **
10829297-C-T **
10826489-C-T **
10772622-G-A FGC80025 **
10813156-T-TTGC **
10817844-T-C **
10984451-T-A **
10987222-C-CGTTTG **
10852786-T-C **
10852783-C-G **
16897643-CAAA-C 14785763-CAAA-C 23×A**
10826495-G-T **
10826488-T-A **
10826481-C-T **
10826470-C-T **
10826463-C-A **
10826823-C-T **
3706712-T-TTA 3838671-T-TTA 8×TA**
18407144-C-A 16295264-C-A P6_Gap **
10851182-G-T **
10851180-C-T **
10932894-G-C **
6902-G-C **
10899089-C-T **
10760964-A-T **
10760963-C-T **
10664844-C-G **
10664840-A-C **
10926709-A-G **
10759814-C-A **
10759796-A-T **
11005492-C-G **
11005490-C-G **
11005478-C-A **
11005476-T-A **
10866073-A-G **
10866064-T-C **
10984482-C-A **
10984442-C-T **
10922202-T-A **
8181256-C-T 8313215-C-T **
10836537-T-A **
10836536-T-G **
27466713-G-GA 25320566-G-GA P1_Y2 21×A**
10689834-C-G **
10689825-T-C **
10689812-T-C **
10689807-T-C **
10689804-C-G **
10689767-A-T **
10689760-A-T **
22244092-C-T 20082206-C-T DYZ19 **
13453298-C-T 11297622-C-T **
27733757-G-A 25587610-G-A P1_Y2 8×A**
6444951-T-TAC 6576910-T-TAC 10×AC**
10836551-C-A **
20998361-G-A 18836475-G-A P4_Dst **
5962109-CATATAT-C 6094068-CATATAT-C 20×AT**
58855266-T-A 56735605-A-T **
5960634-TTA-T 6092593-TTA-T **
21182397-C-CT 19020511-C-CT 20×T**
17054894-C-T 14943014-C-T **
10004847-TTG-T 10167238-TTG-T 10×TG**
13453301-T-C 11297625-T-C **
9639183-C-CT 9801574-C-CT IR3_Prx 12×T**
7195307-CAA-C 7327266-CAA-C 16×A**
16050994-TTC-T 13939114-TTC-T *****
16172191-C-G 14060311-C-G CTS5264 FGC2043 **
15480111-A-T 13368231-A-T F19831 21×T**
28803937-C-A 26657790-C-A A12016BY24895 **
10836539-C-A **
10836563-C-T **
10984437-C-T **
10875791-C-A **
13453225-AAT-A 11297549-AAT-A **
11030237-G-C **
21709158-AT-A 19547272-AT-A 10×T**
10851170-T-C **
23037237-ATTT-A 20875351-ATTT-A 20×T**
6992571-G-T 7124530-G-T **
2730092-ATTTTT-A 2862051-ATTTTT-A 17×T**
10829301-G-C **
28805854-A-G 26659707-A-G **
28805853-G-A 26659706-G-A **
28805852-T-C 26659705-T-C **
17821825-GAAAAA-G 15709945-GAAAAA-G 17×A**
10875793-T-C **
10875790-C-T **
10866108-A-T **
10875782-A-G **
10875781-C-G **
10875777-A-T **
10987239-C-G **
10987233-A-T **
10987207-C-T **
10841051-C-T **
10836578-C-T **
10836570-A-T **
10836561-A-T **
10787929-T-C **
10930099-C-G **
10930091-C-T **
10930080-A-T **
10922194-A-T **
10760449-C-G **
22325309-T-A 20163423-T-A DYZ19 **
10785328-C-T **
10866485-T-G **
17095431-C-A 14983551-C-A **
10974968-T-G **
10899942-A-T **
15109099-C-A 12997186-C-A **
10770453-G-T **
10929223-G-A FGC77963 **
10997309-A-T **
6330227-CA-C 6462186-CA-C IR3_Dst **
10899062-C-T **
10663799-T-C **
19925895-A-AT 17814015-A-AT P5_Prx **
6688719-A-C 6820678-A-C **
10785331-T-C **
16896501-C-T 14784621-C-T **
10866489-T-C **
7270276-CTT-C 7402235-CTT-C 25×T**
10930782-T-A **
10795860-C-A **
10804461-C-T **
56771121-A-C **
20027998-T-TTA 17916118-T-TTA P5_Prx **
28793797-A-T 26647650-A-T **
10898393-T-A **
22774869-C-CTT 20612983-C-CTT 21×T**
10936244-C-T **
7861682-C-A 7993641-C-A **
22360175-T-A 20198289-T-A DYZ19 **
10936247-C-CACTCA **
15093588-CTT-C 12981676-CTT-C 11×T**
10932929-C-G **
10866488-T-A **
6816749-C-A 6948708-C-A **
10926694-A-T **
14743825-C-A 12631894-C-A **
26018405-G-GTT 23872258-G-GTT P1_Y1 **
10677563-T-C **
14191951-T-G 12071245-T-G **
4460688-C-A 4592647-C-A **
28818418-T-A 26672271-T-A **
28818422-A-G 26672275-A-G **
8181340-C-T 8313299-C-T **
19415390-C-A 17303510-C-A **
7131387-C-CA 7263346-C-CA **
10804505-A-T **
7039223-C-A 7171182-C-A **
10683629-C-T **
10683664-T-G FT428914 **
10804493-CCCCT-C **
5887632-C-A 6019591-C-A **
10801638-A-G **
22335159-C-A 20173273-C-A DYZ19 **
13468079-G-T 11312403-G-T **
13445351-C-A 11289675-C-A **
15971775-G-T 13859895-G-T **
8181341-A-G 8313300-A-G A3725 **
13222915-A-C 11067239-A-C **
10677558-A-C **
13453339-C-CGATTG 11297663-C-CGATTG **
9125431-G-T **
8181320-C-T 8313279-C-T **
56837309-C-A **
10926704-A-T **
7764515-C-A 7896474-C-A **
10979922-G-T **
17218300-C-CT 15106420-C-CT 16×T**
10782003-C-A **
5190004-G-T 5321963-G-T 16×A**
10989506-T-C **
19079091-C-A 16967211-C-A **
10987159-C-A **
11026266-G-A FT440030 **
11026259-G-C **
11026247-T-TTTAAC **
10760952-C-T **
13445360-G-T 11289684-G-T **
10934522-T-A **
10683667-T-C **
10683662-T-C **
6922560-C-A 7054519-C-A **
10987164-C-T **
10987156-AC-A **
11026271-A-T **
10987155-T-C **
18847786-C-A 16735906-C-A **
10987136-C-G **
10987118-CCTAA-C **
10987113-AT-A **
10987099-T-C **
10664841-C-A **
10664825-C-CATTTG **
10772632-G-A FT430542 **
10899971-C-A **
10899960-C-G **
11026269-C-G **
10987142-C-T **
5219336-A-T 5351295-A-T 19×GT**
28805858-GA-G 26659711-GA-G **
11028142-G-T **
11026276-T-A **
18365659-G-T 16253779-G-T P6_Prx **
11028137-C-T **
7252377-CAA-C 7384336-CAA-C 14×A**
5493431-CTTT-C 5625390-CTTT-C 24×T***
12371950-CAA-C ***
10682523-A-T ***
7636010-TAAAA-T 7767969-TAAAA-T 15×A***
6802130-G-GA 6934089-G-GA 11×A***
10805697-T-C ***
24388535-CTA-C 22242388-CTA-C ***
17264846-A-C 15152966-A-C A14071BY38176 ***
7338351-C-A 7470310-C-A ***
9944892-A-G 10107283-A-G ***
3509120-T-A 3641079-T-A FT317492 ***
28458910-TA-T 26312763-TA-T 10×A***
13457929-T-G 11302253-T-G ***
58997716-C-A 56851569-C-A ***
13468319-A-G 11312643-A-G ***
13456313-C-A 11300637-C-A ***
28370017-G-T 26223870-G-T BY44860 P1_gr2 ***
10746965-TTCAAC-T,TTCCAC ***
2781125-AT-A 2913084-AT-A 10×T***
19529488-GA-G 17417608-GA-G 10×A***
16409013-CTTTT-C 14297133-CTTTT-C 18×T***
58975451-CAGTCCATTCCA-C 56829304-CAGTCCATTCCA-C ***
13869149-A-G 11748443-A-G 12×GAATG***
23350819-A-AT 21188933-A-AT 12×T***
15422098-CAAAA-C 13310218-CAAAA-C 20×A***
11034683-TCATTC-T ***
4375417-C-CT 4507376-C-CT 22×T***
6091720-AT-A 6223679-AT-A 28×T***
18589666-C-A 16477786-C-A ***
10851490-C-A ***
14294342-GAA-G,GA 12173636-GAA-G,GA 13×A***
5574077-CTT-C 5706036-CTT-C 19×T***
15803538-A-G 13691658-A-G ***
10807265-T-C ***
21755795-CTTTTT-C ***
17923746-AAAAG-A 15811866-AAAAG-A 11×AAAG***
13461013-T-C 11305337-T-C ***
16568881-TAA-T 14457001-TAA-T 16×A***
10889767-T-A ***
20804004-TTGTGTG-T 18642118-TTGTGTG-T P4_Gap 19×TG***
10851502-G-T ***
21365422-C-CA 19203536-C-CA 17×A***
18138372-C-T 16026492-C-T ***
17643765-G-A 15531885-G-A ***
17364591-GC-G,GT 15252711-GC-G,GT ***
17225920-T-C 15114040-T-C ***
10866030-T-C ***
13478059-G-A 11322383-G-A F18183 ***
4521322-TAA-T 4653281-TAA-T 15×A***
13488398-C-T 11332722-C-T ***
6604084-CTTTT-C,CTTT 6736043-CTTTT-C,CTTT 17×T***
2665168-C-A 2797127-C-A ***
3253170-CTTTT-C,CTT 3385129-CTTTT-C,CTT 22×T***
4226662-T-C 4358621-T-C ***
4366587-G-C 4498546-G-C ***
7197570-ATTT-A,ATTTTT 7329529-ATTT-A,ATTTTT 19×T***
58974865-T-G 56828718-T-G ***
14135567-A-G 12014861-A-G ***
13468625-A-G 11312949-A-G ***
9410249-C-T 9572640-C-T ***
13279998-C-CA 11124322-C-CA 26×A***
13468615-T-G 11312939-T-G ***
13468623-G-A 11312947-G-A ***
13944051-CAAAAA-C,CAA 11823345-CAAAAA-C,CAA 22×A***
6585242-T-TA 6717201-T-TA ***
22903849-TAGAG-T 20741963-TAGAG-T 13×AG***
58997689-A-T 56851542-A-T ***
11022063-C-T ***
10661033-ACA-A,ACT ***
21617776-CAAA-C 19455890-CAAA-C 15×A***
16424449-G-T 14312569-G-T ***
6096437-GT-G 6228396-GT-G 11×T***
15971761-G-T 13859881-G-T 11×T***
10669521-T-C,TC ***
10980731-T-C ***
11022103-T-C ***
13480373-G-T 11324697-G-T ***
8288815-TAAA-T 8420774-TAAA-T 23×A***
10983909-G-C ***
11030246-C-T ***
11030230-T-A ***
4616754-G-A 4748713-G-A ***
26415749-GTT-G 24269602-GTT-G P1_Y1 14×T***
10756301-C-A ***
14807778-C-A 12695849-C-A ***
10971913-A-G ***
28522751-CTT-C 26376604-CTT-C 17×T***
13480469-G-C 11324793-G-C ***
13588674-TA-T 11432998-TA-T ***
13468249-C-A,T 11312573-C-A,T ***
10808593-C-T ***
13446807-ATTCCATTCCATTCCATTCCATTCCATTCCATTCCA-A,ATTCCATTCCATTCCATTCCATTCCATTCCATTCCC 11291131-ATTCCATTCCATTCCATTCCATTCCATTCCATTCCA-A,ATTCCATTCCATTCCATTCCATTCCATTCCATTCCC ***
8025155-CAAA-C 8157114-CAAA-C 14×A***
13201985-A-G 11046309-A-G ***
11021901-C-A ***
17211058-C-A 15099178-C-A ***
10746930-T-C ***
17128535-CTTT-C 15016655-CTTT-C 25×T***
28747705-ATTTT-A 26601558-ATTTT-A 27×T***
14061366-ATT-A 11940660-ATT-A 17×T***
58997698-C-T 56851551-C-T ***
19558321-G-T 17446441-G-T ***
11030279-T-A ***
10889784-C-CCTGTTGACTG ***
5460982-AT-A 5592941-AT-A 12×T***
9410236-G-A 9572627-G-A ***
5400468-C-CT 5532427-C-CT 19×T***
13453166-T-C 11297490-T-C ***
13869117-C-T 11748411-C-T ***
10772529-A-T ***
56827511-GCTTTCCTTTC-G,GCTTTC 5×CTTTC***
10971981-C-T ***
5146192-C-CT 5278151-C-CT 19×T***
6059092-CAAA-C 6191051-CAAA-C 25×A***
8125061-A-G 8257020-A-G ***
13457942-A-AT 11302266-A-AT ***
56851560-T-C ***
19486859-CTTTT-C 17374979-CTTTT-C 16×T***
56851562-C-A ***
19423125-C-A 17311245-C-A ***
56851566-A-G ***
18981175-G-T 16869295-G-T ***
56851580-A-T ***
56851596-C-A ***
56851606-G-T ***
56851611-T-A ***
56851620-G-A ***
10817345-A-T ***
18554214-C-A 16442334-C-A ***
10873135-T-C ***
13457934-T-C 11302258-T-C ***
10754974-T-A ***
13482351-C-A 11326675-C-A ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 200078986476680238047903609
Kit: 2000781502723794120398331746
Used in age calculations1502723794120398331746
Counts of SNPs83
Variant counts last updated 2022-07-30 03:29:59.



Big Tree Main Page