Tree Position

R-M269 > L23 > Z2103 > Z2106 > BY41458 > Y18961

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY2
792848
BigY3
792848
9638442-G-C 9800833-G-C FGC61342 IR3_Prx A+
22226470-T-C 20064584-T-C DYZ19 A+
16105607-G-C 13993727-G-C P8_Prx A+
25617956-A-G 23471809-A-G P1_gr1 A+
22217366-G-C 20055480-G-C DYZ19 A+
56870921-G-A A*
22225611-C-G 20063725-C-G DYZ19 A*
22275333-A-T 20113447-A-T FT454690 DYZ19 ***A*
22310954-A-T 20149068-A-T DYZ19 A*
25995037-A-ATC 23848890-A-ATC P1_Y1 A*
19809172-A-AT 17697292-A-AT P5_Prx 10×TA*
20460428-A-AT 18298542-A-AT P5_Dst 17×TA*
28395344-T-TA 26249197-T-TA P1_gr2 17×AA*
20229557-T-TAC 18067671-T-TAC P5_Dst 18×ACA*
6408665-A-C 6540624-A-C A*
20048160-C-CT 17936280-C-CT P5_Prx 10×TA*
20993598-C-CA 18831712-C-CA P4_Dst 17×AA*
20483325-C-CT 18321439-C-CT P5_Dst 14×TA*
6262638-G-GCA 6394597-G-GCA IR3_Dst 11×CAA*
19725205-A-AC 17613325-A-AC P5_Prx A*
6163642-A-C 6295601-A-C IR3_Dst A*
20479819-A-AT 18317933-A-AT P5_Dst 14×TA*
9551440-G-GT 9713831-G-GT IR3_Prx 11×TA*
59019990-G-C 56873843-G-C A*
59017245-C-T 56871098-C-T A*
59017050-C-T 56870903-C-T A*
22224494-C-A 20062608-C-A DYZ19 A*
20756688-G-A 18594802-G-A P4_Prx A*A*
58993407-C-A 56847260-C-A A*
27634132-A-C 25487985-A-C P1_Y2 A*
22232744-T-A 20070858-T-A DYZ19 A*
3529572-C-CT 3661531-C-CT 13×TA*
56879626-C-G A*
19686619-T-G 17574739-T-G P5_Prx A*
28817405-G-A 26671258-G-A A*A*
6310853-G-GCA 6442812-G-GCA IR3_Dst 17×CAA*
28817243-G-A 26671096-G-A A*A*
24612840-A-AT 22466693-A-AT P3_t2 16×TA*
27634136-A-C 25487989-A-C P1_Y2 A*
27634124-C-T 25487977-C-T P1_Y2 A*
20692838-C-G 18530952-C-G P4_Prx A*
20674106-C-G 18512220-C-G P4_Prx A*A*
6112916-A-C 6244875-A-C FT74200 A*
25982578-G-GA 23836431-G-GA P1_Y1 9×AA*
19731156-C-CT 17619276-C-CT P5_Prx 9×TA*
56879627-C-T A*
10683631-T-A A*
10683627-T-C A*
18381238-G-C 16269358-G-C P6_Prx A*A*
24296348-C-CA 22150201-C-CA P3_t1 17×AA*
19799551-T-C 17687671-T-C P5_Prx A*A*
19817956-G-T 17706076-G-T P5_Prx A*A*
19871879-T-C 17759999-T-C P5_Prx A*A*
59004836-T-A 56858689-T-A A*
20692862-A-AT 18530976-A-AT P4_Prx 12×TA*
21013084-A-AT 18851198-A-AT P4_Dst 14×TA*
20860727-G-T 18698841-G-T P4_Dst A*
58979068-T-C 56832921-T-C A*
26255500-A-G 24109353-A-G P1_Y1 A*
20442453-G-GA 18280567-G-GA P5_Dst 11×AA*
20970072-G-C 18808186-G-C P4_Dst A*
19700589-T-TA 17588709-T-TA P5_Prx 8×AA*
19939152-T-C 17827272-T-C P5_Prx A*
20279694-T-TA 18117808-T-TA P5_Dst 10×AA*
26046164-A-G 23900017-A-G P1_Y1 A*
20887486-C-T 18725600-C-T P4_Dst A*
20846133-G-A 18684247-G-A P4_Dst A*
19570853-G-A 17458973-G-A P5_Prx YA*
56827477-C-T A*
20478248-G-GT 18316362-G-GT P5_Dst 13×TA*
20798039-C-T 18636153-C-T P4_Prx A*
25903066-C-T 23756919-C-T P1_Y1 A*
20697859-G-GT 18535973-G-GT P4_Prx 9×TA*
20966227-G-GA 18804341-G-GA P4_Dst 11×AA*
20625188-C-CT 18463302-C-CT P4_Prx 9×TA*
20546586-T-G 18384700-T-G P5_Dst A*
20348015-A-AT 18186129-A-AT P5_Dst 11×TA*
22231957-G-C 20070071-G-C DYZ19 A*
20380229-A-G 18218343-A-G P5_Dst A*
18458262-C-T 16346382-C-T P6_Dst A*
27916236-T-C 25770089-T-C P1_Y2 A*
20848244-A-AT 18686358-A-AT P4_Dst 19×TA*
59004743-T-C 56858596-T-C A*
18350837-G-A 16238957-G-A P6_Prx A*
26496987-G-A 24350840-G-A P1_Y1 A*
21586189-T-G 19424303-T-G FT77198 Y+
14883599-T-C 12771665-T-C BY98233 YY+**
17288405-G-A 15176525-G-A BY197471 YY++
15005345-T-C 12893430-T-C BY197294 YY++
21044240-T-C 18882354-T-C Y++
21472836-A-G 19310950-A-G BY133175 YY++
21590329-C-A 19428443-C-A BY197700 YY++
21717414-G-A 19555528-G-A YY++
15005274-C-A 12893359-C-A FT180198 YY++
14825900-A-G 12713967-A-G FT76344 YY**+
28627835-C-A 26481688-C-A FT77628 +
4138783-C-T 4270742-C-T FGC48341 ++
22187872-T-A 20025986-T-A BY39492 YY++
14094737-G-A 11974031-G-A YY++
14803059-C-T 12691130-C-T FGC48366 YY**+
22239379-C-T 20077493-C-T BY213938 DYZ19 +
22270938-C-A 20109052-C-A BY196866 DYZ19 +**
14528968-AGAG-A 12417169-AGAG-A ++
10975204-A-G FT92151 +
15162760-AGT-A 13050846-AGT-A ++
2787803-A-G 2919762-A-G BY196910 YY++
17867597-G-A 15755717-G-A BY197525 YY++
16183275-T-C 14071395-T-C BY105791 Y++
17876835-A-T 15764955-A-T BY39490 YY++
17039709-A-G 14927829-A-G BY111922 YY++
18548679-A-G 16436799-A-G BY197566 Y++
18620869-C-T 16508989-C-T BY197571 YY++
10831654-TA-T **+
18666224-C-T 16554344-C-T BY197575 YY++
18765019-C-G 16653139-C-G BY197583 YY++
18992240-T-C 16880360-T-C BY125315 YY++
13720424-GAATGGAATGA-G 11564748-GAATGGAATGA-G ++
17140158-C-T 15028278-C-T BY197459 YY++
19077080-A-C 16965200-A-C BY197605 YY++
15783125-GT-G 13671245-GT-G ++
19307690-G-A 17195810-G-A BY128106 YY++
19312117-G-A 17200237-G-A BY39491 YY++
19442050-G-T 17330170-G-T YY++
15783126-T-A 13671246-T-A BY197366 YY++
13988391-C-T 11867685-C-T S15280S15280 YY++
13819530-C-G 11698824-C-G BY197184 ++
18645197-G-C 16533317-G-C BY197573 YY++
14245838-C-G 12125132-C-G BY197226 YY++
4643069-C-T 4775028-C-T FT74197 +
3249553-AAG-A 3381512-AAG-A +
8840997-T-A 8972956-T-A BY197123 YY++
7033880-C-T 7165839-C-T FGC48354 Y++
13915328-T-C 11794622-T-C FT76101 Y+
14989099-C-T 12877165-C-T FT76361 YY+
10653716-A-G FT428192 +
9746492-C-G 9908883-C-G L19Z21057 ++
9746494-C-T 9908885-C-T BY39489 ++
22971205-G-C 20809319-G-C FGC48387 YY++
2759845-TAA-T 2891804-TAA-T +
2972645-G-C 3104604-G-C FT74300 +
8423812-G-C 8555771-G-C BY39488 YY++
19765809-CT-C 17653929-CT-C P5_Prx 22×T+
3413298-G-T 3545257-G-T FT74472 +
9938680-T-C 10101071-T-C Y+
4373889-A-G 4505848-A-G FT74840 +
4970674-A-G 5102633-A-G FT75077 +
5275811-G-GT 5407770-G-GT +
8183833-C-T 8315792-C-T BY197059 YY++
8128373-G-T 8260332-G-T BY70163 YY++
5781506-A-T 5913465-A-T +
8099294-T-A 8231253-T-A BY197053 YY++
15763614-G-T 13651734-G-T FT76468 Y+
15334601-G-A 13222719-G-A FT1866 Y+
6880612-T-G 7012571-T-G FGC48352 YY++
13905406-C-T 11784700-C-T FT76093 Y+
7979341-A-G 8111300-A-G BY197041 YY++
7038518-A-G 7170477-A-G FT75695 YY**+
6776780-AAC-A 6908739-AAC-A ++
7750627-A-G 7882586-A-G K465 YY++
22998243-G-T 20836357-G-T BY197776 YY++
23149232-C-G 20987346-C-G BY143375 YY++
6360947-C-A 6492906-C-A FT75539 *+
9850614-G-C 10013005-G-C M9060 Z7199 YY++
23390771-CAAAT-C 21228885-CAAAT-C ++
16050909-C-T 13939029-C-T BY21335 YY11×CTTT**+
13439090-G-C 11283414-G-C FT443668 +
11667194-G-A +
6265338-A-T 6397297-A-T BY39487 IR3_Dst ++
6357604-A-T 6489563-A-T BY196939 ++
13448087-C-A 11292411-C-A *
22268573-T-G 20106687-T-G DYZ19 *
13842646-CGGAAT-C 11721940-CGGAAT-C 12×GGAAT*
13447968-C-A 11292292-C-A *
13452757-A-G 11297081-A-G FT443752 **
14379561-T-TGATAGATA 12258857-T-TGATAGATA 10×GATA*
10958359-C-T *
13814400-G-GGGAAT 11693694-G-GGGAAT 10×GGAAT**
13194286-T-TTTCCA 11038610-T-TTTCCA 9×TTCCA****
13823183-CAATGGAATGG-C 11702477-CAATGGAATGG-C 8×AATGG*
33135-T-G *
10764549-TC-T,TACTCC *
10926682-GCATTCCATTC-G ***
10958354-C-T *
8801381-G-GGAA 8933340-G-GGAA 10×GAA****
10770494-CTTCCATTCCA-C *
17662249-TGATG-T 15550369-TGATG-T 10×GATG**
6614532-ATGTG-A 6746491-ATGTG-A 13×TG*
21656836-GAAATA-G 19494950-GAAATA-G 10×AAATA*
10753557-TCCATTCCATTCCATC-T,TCCATTCCATTCCATT *
18189588-C-A 16077708-C-A **
10831445-C-A **
27719028-C-G 25572881-C-G P1_Y2 5×CTGG**
15080686-C-A 12968776-C-A **
10951344-G-T **
10896292-A-C **
13489386-G-T 11333710-G-T **
5112517-G-T 5244476-G-T **
13588579-C-A 11432903-C-A **
3364635-C-A 3496594-C-A **
5017689-G-T 5149648-G-T **
4957036-T-C 5088995-T-C **
5640706-T-C 5772665-T-C **
5645233-C-A 5777192-C-A **
5769371-C-T 5901330-C-T **
5829596-C-A 5961555-C-A **
5869456-C-A 6001415-C-A **
6003740-C-A 6135699-C-A **
6090538-C-A 6222497-C-A **
3418096-A-G 3550055-A-G **
3226702-C-A 3358661-C-A **
16019126-G-T 13907246-G-T **
14280935-C-A 12160229-C-A **
6911506-G-A 7043465-G-A **
10778284-CTCCAA-C **
10841958-C-A **
14495703-C-A 12383900-C-A **
15450220-G-A 13338340-G-A **
17014520-C-A 14902640-C-A **
5458484-C-A 5590443-C-A **
15647754-C-A 13535874-C-A **
7381667-T-C 7513626-T-C **
13489375-C-T 11333699-C-T **
4898686-T-C 5030645-T-C **
10859669-C-A **
10986444-C-T BY42669FT90165 **
28683465-T-C 26537318-T-C **
14527524-C-A 12415725-C-A **
6148745-C-CAA 6280704-C-CAA IR3_Dst **
10912845-T-A **
19547393-G-A 17435513-G-A **
10984403-C-A **
5942571-C-A 6074530-C-A **
10761045-T-C **
13705488-A-G 11549812-A-G **
18189582-C-A 16077702-C-A **
20465252-A-AG 18303366-A-AG P5_Dst **
3697090-G-T 3829049-G-T **
28620218-C-A 26474071-C-A **
26376520-C-A 24230373-C-A P1_Y1 **
27540968-C-A 25394821-C-A P1_Y2 **
10956571-T-G FGC80510 **
15450203-T-C 13338323-T-C **
28780178-A-G 26634031-A-G **
5923503-G-GT 6055462-G-GT 9×T**
13236559-C-A 11080883-C-A **
23512221-C-A 21350335-C-A **
15333735-C-A 13221853-C-A **
5289456-G-T 5421415-G-T **
13857119-C-A 11736413-C-A **
19547385-C-T 17435505-C-T **
10799617-CTCCAT-C **
19393023-C-A 17281143-C-A **
24631271-TG-T 22485124-TG-T P3_t2 **
24611464-GT-G 22465317-GT-G P3_t2 **
11026039-A-C **
7384594-C-A 7516553-C-A **
23231525-C-A 21069639-C-A **
11022796-C-A **
19071508-C-A 16959628-C-A **
21880970-G-T 19719084-G-T **
10893512-C-A **
28780155-A-G 26634008-A-G **
9769184-C-A 9931575-C-A **
10965443-G-A **
10878559-C-A **
4671540-C-A 4803499-C-A **
10796712-C-G **
10997753-C-T **
18847825-C-A 16735945-C-A **
13235511-C-A 11079835-C-A **
11026062-C-T **
20740459-G-C 18578573-G-C P4_Prx **
4123629-C-A 4255588-C-A **
11012461-C-A **
3651404-G-T 3783363-G-T **
7107079-C-T 7239038-C-T **
9605323-A-ATG 9767714-A-ATG IR3_Prx **
11033322-C-A **
9942871-C-A 10105262-C-A **
14468294-C-A 12347563-C-A **
10997744-C-G **
10831139-CTCCAT-C **
10778263-A-T **
4433372-C-A 4565331-C-A **
8988043-G-T 9150434-G-T **
14142335-C-A 12021629-C-A **
7045367-C-A 7177326-C-A **
13226515-C-A 11070839-C-A **
7149084-C-T 7281043-C-T **
19547349-G-A 17435469-G-A **
21880962-AG-A 19719076-AG-A **
21880959-G-T 19719073-G-T **
21371152-C-T 19209266-C-T **
21141195-T-TTA 18979309-T-TTA **
20611591-G-T 18449705-G-T P5_Dst **
20334852-G-T 18172966-G-T P5_Dst **
20067116-A-AC 17955236-A-AC P5_Dst **
20045283-AAAG-A 17933403-AAAG-A P5_Prx **
19726302-A-T 17614422-A-T P5_Prx **
19558834-AC-A 17446954-AC-A **
19555262-G-T 17443382-G-T **
19547395-A-G 17435515-A-G **
19547376-C-G 17435496-C-G **
19547347-G-T 17435467-G-T **
20696724-G-T 18534838-G-T P4_Prx **
19547303-AA-T 17435423-AA-T **
19547295-T-C 17435415-T-C **
19423798-C-A 17311918-C-A **
19356320-C-A 17244440-C-A **
18390171-T-C 16278291-T-C P6_Gap **
18307585-G-A 16195705-G-A P6_Prx **
18274908-A-C 16163028-A-C P6_Prx **
17823773-C-A 15711893-C-A **
17466831-C-A 15354951-C-A **
17363064-C-A 15251184-C-A **
17096802-G-T 14984922-G-T **
24252073-C-A 22105926-C-A P3_b1 **
16931809-T-C 14819929-T-C **
22037682-C-T 19875796-C-T **
22310450-G-T 20148564-G-T DYZ19 **
16467439-G-T 14355559-G-T **
28780201-C-T 26634054-C-T **
13454203-ATTCCATTCCATTCCT-A 11298527-ATTCCATTCCATTCCT-A **
8037041-T-C 8169000-T-C **
7832135-T-G 7964094-T-G **
6163562-T-G 6295521-T-G IR3_Dst **
5665267-G-C 5797226-G-C **
5275813-T-G 5407772-T-G FT259084 **
19698665-A-C 17586785-A-C P5_Prx **
25557519-C-CTT 23411372-C-CTT P1_gr1 10×T**
26364434-T-G 24218287-T-G P1_Y1 **
26329239-A-C 24183092-A-C P1_Y1 **
56881094-G-A **
56843021-C-A **
56838760-C-A **
28780174-C-T 26634027-C-T **
22537308-AT-A 20375422-AT-A **
28655257-C-A 26509110-C-A **
28549141-A-G 26402994-A-G **
27719012-T-C 25572865-T-C P1_Y2 **
25849702-A-AG 23703555-A-AG P1_Y1 **
25849701-T-A 23703554-T-A P1_Y1 9×A**
24530791-G-T 22384644-G-T P3_t2 **
24530759-C-A 22384612-C-A P3_t2 **
24124420-G-A 21978273-G-A P3_b1 **
21754270-T-C **
23066426-T-A 20904540-T-A **
22713110-C-A 20551224-C-A **
22624405-A-G 20462519-A-G **
22602330-C-CCT 20440444-C-CCT **
16652027-T-G 14540147-T-G **
16426787-G-A 14314907-G-A **
7154805-A-G 7286764-A-G **
10787559-C-T **
10896351-T-G **
10896289-A-G **
10896284-C-G **
10896276-G-A **
10896267-C-T **
10889297-CCATT-C **
10883330-G-T **
10878623-C-A **
10877508-C-A **
10866793-G-T **
10860995-C-T **
10805935-C-T FT172116 **
10797450-C-A **
10761057-C-T **
10940495-C-A **
10761040-T-C **
10744224-C-A **
10692142-T-G **
10661494-C-A **
10013894-A-G 10176285-A-G **
9885289-G-C 10047680-G-C FGC57460 **
9531215-C-A 9693606-C-A IR3_Prx **
9386125-G-A 9548516-G-A **
8981036-A-G 9143427-A-G **
8733216-C-T 8865175-C-T **
7897731-G-T 8029690-G-T **
7832121-CTT-C 7964080-CTT-C ****
7477643-C-A 7609602-C-A IR1_L **
10911784-A-G **
10941551-C-G **
16091280-A-C 13979400-A-C **
11654501-C-A **
16017669-C-A 13905789-C-A **
13938666-A-G 11817960-A-G **
15450233-A-T 13338353-A-T **
15450223-T-C 13338343-T-C **
15363958-G-A 13252078-G-A **
15122328-A-T 13010415-A-T **
25849844-G-T 23703697-G-T P1_Y1 **
14568037-C-A 12456237-C-A **
14450413-C-A 12329686-C-A **
13961483-G-A 11840777-G-A FTA30788 **
13937971-C-A 11817265-C-A **
13886257-C-A 11765551-C-A **
11654503-A-G **
13604396-C-A 11448720-C-A **
10941762-C-A **
13411344-C-A 11255668-C-A **
13273049-G-A 11117373-G-A **
13606916-C-A 11451240-C-A **
11029504-A-C **
11008908-C-A **
11004410-C-CA **
10988426-A-G **
10984629-C-A **
10968823-GCCATT-G **
10958651-TATTCC-T **
10956609-C-T **
10953704-A-C **
10946303-C-A FGC78895 **
15565939-C-CAAA 13454059-C-CAAA 16×A**
6786943-C-A 6918902-C-A **
10896293-A-C **
4094980-C-A 4226939-C-A **
11034800-A-T **
11034815-A-T **
11034820-A-G **
11034826-G-A **
11034829-C-A **
11034838-C-A **
11034844-C-T **
19745032-G-T 17633152-G-T P5_Prx **
10776048-T-TCACTC **
25466513-C-CA 23320366-C-CA P2_r2 26×A**
10986452-A-T **
10796682-C-T **
20101729-C-A 17989849-C-A P5_Dst **
10759370-C-T **
10759377-G-A **
10759380-C-G **
11034799-C-T **
11026010-G-C **
10759407-G-C **
10881319-G-T FT435341 **
10881287-C-G **
10881290-A-T **
10881292-T-C **
10881297-C-A **
10881302-C-T **
10881305-C-A **
10881317-A-C **
10881321-T-C **
10807200-T-C **
10881326-T-A **
10881337-G-T **
10881338-G-A **
10881348-G-C **
10881351-T-A **
10881353-A-C **
10881360-G-T **
10759389-A-C **
10759412-C-G **
28818157-T-C 26672010-T-C **
10684256-C-T **
10896263-C-T **
20506371-T-G 18344485-T-G P5_Dst **
16505987-TC-T 14394107-TC-T **
10911739-A-G **
18274892-GT-G 16163012-GT-G P6_Prx **
22017997-T-TA 19856111-T-TA 10×A**
10936198-G-A **
16102056-G-T 13990176-G-T P8_Prx **
10859674-A-T **
15982168-G-GAA 13870288-G-GAA 15×A**
17597920-GA-G 15486040-GA-G 11×A**
20579333-A-ATT 18417447-A-ATT P5_Dst **
22345735-T-A 20183849-T-A DYZ19 **
28818112-G-A 26671965-G-A **
28818131-A-T 26671984-A-T **
11005500-T-G **
10759994-C-CTGTT **
10845637-A-C **
10759427-A-C **
10941178-T-C **
13989006-C-A 11868300-C-A **
10796672-C-A **
10691378-A-T **
11026026-T-G **
13988861-C-A 11868155-C-A FGC64327 **
10878375-A-G **
10941170-T-A **
10941210-C-G **
10845632-A-C **
10790545-G-T **
5021991-C-A 5153950-C-A **
10846263-C-A **
17333922-C-CT 15222042-C-CT 10×T**
10654185-C-G **
11005531-C-A **
10900806-T-C **
17090874-A-T 14978994-A-T **
10881285-A-C **
18465494-AAGC-A 16353614-AAGC-A P6_Dst **
11005517-C-A **
19926996-G-T 17815116-G-T P5_Prx **
21149581-GGT-G 18987695-GGT-G **
22950033-C-A 20788147-C-A CTS11094 PF4989 **
23825774-ATATAT-A 21663888-ATATAT-A **
22310443-T-G 20148557-T-G DYZ19 **
20230152-T-TAA 18068266-T-TAA P5_Dst 16×A**
22287120-C-A 20125234-C-A DYZ19 **
9386154-A-G 9548545-A-G Z11540 **
16147477-TA-T 14035597-TA-T P8_Dst 14×A**
13705525-C-G 11549849-C-G **
16096904-A-C 13985024-A-C **
22236283-G-A 20074397-G-A DYZ19 **
13489393-T-C 11333717-T-C **
13489380-C-A 11333704-C-A **
17030789-A-T 14918909-A-T **
6298490-AACAC-A 6430449-AACAC-A IR3_Dst 10×AC**
23350626-CTTTTT-C 21188740-CTTTTT-C 21×T**
19510292-G-T 17398412-G-T **
7362048-TTA-T 7494007-TTA-T 10×TA**
19622044-C-A 17510164-C-A P5_Prx **
18354164-TAGAAAGAA-T 16242284-TAGAAAGAA-T P6_Prx 13×AGAA**
6280414-TA-T 6412373-TA-T IR3_Dst 10×A**
22236296-G-C 20074410-G-C DYZ19 **
20084142-TAG-T 17972262-TAG-T P5_Dst 13×AG**
28818204-A-G 26672057-A-G **
18857588-T-G 16745708-T-G M1145 6×TTG*****
58985627-G-T 56839480-G-T **
3152180-A-G 3284139-A-G BY41572 **
25880469-ATGTG-A 23734322-ATGTG-A P1_Y1 8×TG**
5644518-T-G 5776477-T-G FTB22261 **
6148745-C-A 6280704-C-A IR3_Dst **
58892320-G-A 56698551-C-T **
58968289-G-GTT 56822142-G-GTT 8×T**
13485707-C-A 11330031-C-A **
19268198-T-C 17156318-T-C BY53494M2084 F4384 10×C**
20333860-T-A 18171974-T-A P5_Dst **
5644508-T-A 5776467-T-A FTB22260 **
5084420-CT-C 5216379-CT-C 9×T**
10791319-C-T **
7202118-C-A 7334077-C-A **
10673604-C-A **
10751180-T-A **
10751212-T-A **
11024705-C-G FT439974 **
13705493-A-G 11549817-A-G **
10673580-T-A **
10673581-C-G **
10673601-C-CTAATA **
10673609-T-A **
10661032-C-A **
10673616-C-A **
10673618-A-T **
10673622-T-C **
10673623-T-TA **
11027305-A-C BY209861 **
11027331-C-CATTCA **
10841996-C-T **
10751176-T-C **
10962928-C-T **
10935531-A-G BY29381 **
10859675-C-T **
10962910-A-G **
10677725-T-C **
10677727-A-G **
10677728-C-T **
10797936-A-T **
11001928-C-G **
25592900-CTA-C 23446753-CTA-C P1_gr1 12×TA**
10788190-G-A **
10962914-A-AC **
10788217-A-T **
10851970-C-A **
10851994-G-A FGC77735 **
10852000-C-A **
10852010-G-C **
10852022-C-T **
23609222-ATTT-A 21447336-ATTT-A 14×T**
10941180-G-C **
10911671-A-T **
10845626-C-G **
11005519-A-T **
10759369-C-T **
11005524-C-CT **
19547311-G-A 17435431-G-A **
10811305-T-C **
17928958-C-A 15817078-C-A **
11013561-G-C **
10822667-A-T **
10841081-C-T **
10791307-T-G **
10822668-T-C **
22236311-C-G 20074425-C-G DYZ19 **
22236300-C-G 20074414-C-G DYZ19 **
22236295-A-C 20074409-A-C DYZ19 **
14118383-C-A 11997677-C-A **
5756108-G-T 5888067-G-T **
10691358-A-ACTCTG **
7238968-C-A 7370927-C-A **
13926486-CA-C 11805780-CA-C 10×A**
13938661-T-C 11817955-T-C **
17491903-A-G 15380023-A-G **
26099739-A-T 23953592-A-T P1_Y1 **
6520214-C-A 6652173-C-A **
10841963-C-G **
10841978-C-G **
21934612-T-G 19772726-T-G **
11009836-T-G **
10982858-C-CACCAT **
10982864-T-TCCTCC **
10982873-C-A **
28780152-T-C 26634005-T-C **
27837978-GT-G 25691831-GT-G P1_Y2 29×T**
11026066-TGCACA-T **
19547402-C-T 17435522-C-T **
10911676-A-G **
11024761-C-A **
7097485-G-T 7229444-G-T **
28780194-A-C 26634047-A-C **
2729648-CTTTTTT-C 2861607-CTTTTTT-C 25×T**
14361906-C-A 12241201-C-A **
13855609-C-A 11734903-C-A **
27801658-T-TC 25655511-T-TC P1_Y2 **
10797881-T-A **
17440640-C-A 15328760-C-A **
8076082-C-A 8208041-C-A **
10898914-A-C **
10898914-ACAGTG-A **
3995240-C-A 4127199-C-A **
10796658-A-T **
28780153-G-A 26634006-G-A **
10896344-A-T **
10982898-C-A **
10796653-A-G **
18794908-TA-T 16683028-TA-T 10×A**
10811295-A-C **
14888076-C-CTTTT 12776142-C-CTTTT 17×T**
11024713-CATTCT-C **
14888095-A-T 12776161-A-T **
22017984-C-A 19856098-C-A **
13705517-A-T 11549841-A-T A12739 **
28625805-T-A 26479658-T-A FT27194 **
7254596-C-A 7386555-C-A **
4374909-C-A 4506868-C-A **
17500222-C-CCT 15388342-C-CCT **
11007434-C-A **
19839642-AG-A 17727762-AG-A P5_Prx **
6510709-C-A 6642668-C-A **
10822677-A-T **
2768019-G-T 2899978-G-T **
11024762-T-A **
23831315-C-T 21669429-C-T **
11024751-T-C **
20506357-G-T 18344471-G-T P5_Dst **
10993459-T-C **
10993444-A-C **
6268768-A-AC 6400727-A-AC IR3_Dst **
22949874-C-A 20787988-C-A **
10993433-T-A **
10993427-C-G **
11024748-A-C FT439977 **
10993408-ATTT-A **
10993410-T-TCC **
10993406-C-A **
11005547-C-A **
10898971-T-A **
10898940-C-G **
18174762-C-A 16062882-C-A **
10984425-C-A **
10956594-C-T **
56698576-T-C **
4374792-C-A 4506751-C-A **
13995782-C-CT 11875076-C-CT 9×T**
6510719-C-A 6642678-C-A **
22816356-G-T 20654470-G-T **
7221537-C-A 7353496-C-A **
10982891-T-C **
13453226-ATCCATTCCAT-A 11297550-ATCCATTCCAT-A 10×TCCAT**
10841094-A-T FT47026 **
10841072-CATTCA-C **
5215666-C-A 5347625-C-A **
13287709-A-C 11132033-A-C **
28234461-C-A 26088314-C-A P1_b4 **
11005549-C-T FT393387 **
21766274-AACAC-A **
10993422-C-A **
10811312-C-T **
3271644-CTT-C 3403603-CTT-C 11×T**
20230190-C-A 18068304-C-A P5_Dst **
15450216-A-C 13338336-A-C **
5313621-C-A 5445580-C-A **
11034879-A-G **
23512288-C-A 21350402-C-A **
11024706-T-G **
10684223-C-A **
14219518-C-A 12098812-C-A **
10752496-C-A **
56850916-A-G **
11024712-C-G **
10787327-C-T **
10936198-GTTCCATTCCT-G **
11024724-T-C **
21556957-G-T 19395071-G-T **
5587103-G-T 5719062-G-T FT308362 **
5894968-G-A 6026927-G-A FT28606 **
11024739-G-A **
10684188-C-T **
10684196-T-C **
22236266-C-A 20074380-C-A DYZ19 **
10683352-A-C,T ***
17675541-GAA-G 15563661-GAA-G 20×A***
19547549-A-C 17435669-A-C ***
5486366-G-C 5618325-G-C ***
13470616-C-T 11314940-C-T ***
6918535-CAA-C 7050494-CAA-C 31×A***
22916946-CAATA-C 20755060-CAATA-C BY20297 6×AATA***
13846224-T-TGAATG 11725518-T-TGAATG 11×GAATG******
24485692-GTTATTTTATTTTATT-G 22339545-GTTATTTTATTTTATT-G 13×TTATT***
13811097-T-C 11690391-T-C ***
13236471-C-CAT 11080795-C-CAT ***
13452873-G-GCATTC 11297197-G-GCATTC 14×CATTC***
10658450-C-A ***
7363157-T-TA 7495116-T-TA 18×A***
13450166-CCATTC-C,CCATTT 11294490-CCATTC-C,CCATTT ***
13845541-AAATGGAATGG-A 11724835-AAATGGAATGG-A 8×AATGG***
14381427-A-G 12260723-A-G ***
13489619-ACCCCCACCACCACCCACCACCC-A,ACACTCCACACACAAACCCCACCC 11333943-ACCCCCACCACCACCCACCACCC-A,ACACTCCACACACAAACCCCACCC ***
21617776-CA-C,CAA 19455890-CA-C,CAA 15×A***
13606901-AAG-A 11451225-AAG-A ***
21394353-T-C 19232467-T-C ***
21464798-CTTCTTCTTCTTC-C,CTTCTTCTTCT 19302912-CTTCTTCTTCTTC-C,CTTCTTCTTCT ***
9141882-G-T 9304273-G-T ***
7029469-TTC-T 7161428-TTC-T ***
4917601-CTT-C 5049560-CTT-C 16×T***
18454783-TTC-T,TTCTTTCTTTCTTTC 16342903-TTC-T,TTCTTTCTTTCTTTC P6_Dst ***
25995037-A-C 23848890-A-C BY164453 P1_Y1 ***
10755389-CTCATCTCTGTTTCAT-C,CTCACTCCGTTACAT ***
25995035-A-C 23848888-A-C BY30070 P1_Y1 ***
14379598-GATACATAC-G 12258894-GATACATAC-G ***
13489294-G-T 11333618-G-T ***
13489304-G-T 11333628-G-T ***
22868830-C-CA 20706944-C-CA 10×A***
10757346-C-A,T ***
11643760-A-C ***
16908451-T-TA 14796571-T-TA 21×A***
11001444-T-A ***
19020224-A-G 16908344-A-G ***
21554473-ATTT-A 19392587-ATTT-A 17×T***
4498179-ATT-A 4630138-ATT-A 23×T***
10934813-A-C,G ***
15940329-AAG-A 13828449-AAG-A ***
16520992-CA-C,CAA 14409112-CA-C,CAA 16×A***
9371515-C-A 9533906-C-A ***
11030175-T-C ***
10999880-A-T ***
16707454-G-A 14595574-G-A ***
13488729-C-A 11333053-C-A ***
3131517-TTCTCTTCTCTTCTCC-T,TTCTCTTCTCC 3263476-TTCTCTTCTCTTCTCC-T,TTCTCTTCTCC ***
8214333-A-G 8346292-A-G FTB39723 ***
19268197-TT-T,TC 17156317-TT-T,TC ***
8466192-A-G 8598151-A-G ***
11673697-G-T ***
10669494-A-C ***
10685762-C-G ***
10685774-T-C ***
10685811-C-G ***
9852678-G-A 10015069-G-A ***
22430134-G-T 20268248-G-T DYZ19 ***
18688500-CA-C 16576620-CA-C 20×A***
11030180-T-C ***
10682489-T-A ***
56832972-T-TCCATTCCATC ***
19517593-C-A 17405713-C-A ***
10691364-T-C ***
3446607-CAA-C 3578566-CAA-C 25×A***
10988041-G-T ***
56848732-A-C,G ***
28492932-AT-A,ATT 26346785-AT-A,ATT 22×T***
10935566-C-A ***
13477276-G-T 11321600-G-T ***
13459276-C-A 11303600-C-A ***
10935539-T-A ***
10935575-T-A ***
10759846-A-G ***
10797935-C-T ***
10989874-T-C ***
14517555-C-A 12405756-C-A ***
17584130-ATTTT-A 15472250-ATTTT-A 26×T***
13811137-T-C 11690431-T-C ***
22173954-G-GAA 20012068-G-GAA 16×A***
11014369-C-T ***
14413210-CAA-C,CA 12292507-CAA-C,CA 23×A***
10789368-T-G ***
13462333-C-A 11306657-C-A ***
10670998-CTCCATTCCAT-C ***
7141980-C-A 7273939-C-A ***
56830417-G-T ***
10789329-C-A ***
11014344-T-C ***
10807229-A-C ***
13462342-A-T 11306666-A-T ***
13462348-C-G 11306672-C-G ***
14324894-CTTTT-C 12204188-CTTTT-C 26×T***
19436766-GAA-G,GAG 17324886-GAA-G,GAG ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 792848997950581266498002219
Kit: 7928481456826891651168174738
Used in age calculations1456826891651168174738
Counts of SNPs5443
Variant counts last updated 2022-07-13 03:00:33.



Big Tree Main Page