Tree Position

R-M269 > L23 > L51 > P310 > L151 > S1194 > S1200 > S14328 > A8469 > S1196 > S6868 > S9254

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY2
N263873
22369512-G-C 20207626-G-C DYZ19 A+
20465676-C-A 18303790-C-A P5_Dst A+
9601586-C-CT 9763977-C-CT IR3_Prx 16×TA*
6335897-G-A 6467856-G-A IR3_Dst A*
19714097-G-T 17602217-G-T P5_Prx A*
25988615-A-G 23842468-A-G P1_Y1 A*
19732191-C-G 17620311-C-G P5_Prx A*
22310664-C-T 20148778-C-T DYZ19 A*
6298490-A-AAC 6430449-A-AAC IR3_Dst 10×ACA*
18299332-T-G 16187452-T-G P6_Prx A*
22304573-G-A 20142687-G-A DYZ19 A*
19673655-G-A 17561775-G-A P5_Prx A*
16526985-G-A 14415105-G-A BY190961 YY+
21369526-A-T 19207640-A-T BY11833 YY+
22466121-G-C 20304235-G-C BY191952 DYZ19 +
21769601-TAAG-T 19607715-TAAG-T +
22160569-T-G 19998683-T-G BY11834 YY+
21258980-C-T 19097094-C-T BY191669 YY+
6144627-CGGG-C 6276586-CGGG-C IR3_Dst +
6106212-C-G 6238171-C-G BY189680 +
16400282-C-A 14288402-C-A BY11830 YY+
14394402-G-A 12273698-G-A BY11828 YY+
23325924-G-A 21164038-G-A BY11835 YY+
16729822-C-G 14617942-C-G BY11831 YY+
8319465-A-T 8451424-A-T BY11826 YY+
18635128-G-C 16523248-G-C BY191387 YY+
18938470-C-T 16826590-C-T BY11832 YY+
17146204-G-C 15034324-G-C BY191086 YY+
17139351-A-G 15027471-A-G BY191083 YY+
8192830-C-G 8324789-C-G BY11825 YY+
16234905-T-C 14123025-T-C BY190891 YY+
16870323-G-C 14758443-G-C YY+
16807727-G-C 14695847-G-C BY191015 YY+
14005986-TA-T 11885280-TA-T +
19481361-T-C 17369481-T-C BY191604 YY+
15658259-TACAC-T 13546379-TACAC-T 11×AC*
22303259-G-A 20141373-G-A DYZ19 *
4136409-C-A 4268368-C-A **
4141756-G-T 4273715-G-T **
3440121-A-G 3572080-A-G **
2842300-G-T 2974259-G-T **
2740366-C-A 2872325-C-A **
4036999-T-A 4168958-T-A **
2680267-G-T 2812226-G-T **
2651901-T-G 2783860-T-G **
13488897-T-A 11333221-T-A **
3641526-C-A 3773485-C-A **
6330228-A-ACACG 6462187-A-ACACG IR3_Dst **
4178184-A-C 4310143-A-C **
7418707-T-G 7550666-T-G **
10009508-G-T 10171899-G-T **
9978421-T-G 10140812-T-G **
9936066-A-G 10098457-A-G **
9117223-C-A 9279614-C-A **
8853288-G-T 8985247-G-T **
8835184-C-A 8967143-C-A **
8669668-G-A 8801627-G-A **
8481080-TATAAA-T 8613039-TATAAA-T **
8481062-TATA-T 8613021-TATA-T **
7768889-C-A 7900848-C-A **
7541210-C-A 7673169-C-A **
7433391-C-A 7565350-C-A **
7320620-C-A 7452579-C-A **
5031530-C-A 5163489-C-A **
7294816-C-A 7426775-C-A **
7140457-C-A 7272416-C-A **
6976585-C-A 7108544-C-A **
6930412-T-A 7062371-T-A **
6776353-C-T 6908312-C-T **
6752429-C-A 6884388-C-A **
6667621-C-A 6799580-C-A **
6593510-T-C 6725469-T-C **
6457875-C-A 6589834-C-A **
22979179-C-A 20817293-C-A **
6188660-G-T 6320619-G-T IR3_Dst **
5796295-C-A 5928254-C-A **
7858460-C-A 7990419-C-A **
6226041-TATC-T 6358000-TATC-T IR3_Dst **
56836324-G-T **
4521552-C-A 4653511-C-A **
7363476-C-A 7495435-C-A **
9048058-C-A 9210449-C-A **
15971225-CTTTTTTT-C 13859345-CTTTTTTT-C 18×T**
56836344-C-T **
5577350-C-A 5709309-C-A **
18891184-CTTTT-C 16779304-CTTTT-C 13×T**
15604353-T-A 13492473-T-A **
25709386-G-GTT 23563239-G-GTT P1_b3 31×T**
15641869-C-A 13529989-C-A **
2845847-AAAG-A 2977806-AAAG-A **
10874376-C-A **
19465781-C-A 17353901-C-A FT257498 **
7163312-C-T 7295271-C-T 11×T**
14283399-C-A 12162693-C-A **
14093763-C-A 11973057-C-A **
22537017-A-C 20375131-A-C **
11643761-A-ACGAAT **
11643740-A-T **
17934125-C-A 15822245-C-A **
16462475-C-A 14350595-C-A **
15606830-C-A 13494950-C-A **
5863959-C-A 5995918-C-A **
21926620-C-A 19764734-C-A **
13483951-C-A 11328275-C-A **
56830594-C-G **
5687385-C-A 5819344-C-A **
14831720-GTTTTT-G 12719787-GTTTTT-G 17×T**
14449393-C-A 12328666-C-A **
9935258-C-A 10097649-C-A **
10992888-T-C **
56833328-C-G **
13711431-A-C 11555755-A-C **
6776354-A-G 6908313-A-G **
10029417-A-G 10191808-A-G **
22901916-C-A 20740030-C-A **
6957509-C-A 7089468-C-A **
7082666-C-A 7214625-C-A **
19604941-G-T 17493061-G-T P5_Prx **
8052433-C-A 8184392-C-A **
18883233-C-A 16771353-C-A 14×T**
16093022-C-A 13981142-C-A **
22936337-C-A 20774451-C-A **
22520251-C-A 20358365-C-A **
16824989-C-A 14713109-C-A **
19895437-T-G 17783557-T-G P5_Prx **
8349197-C-A 8481156-C-A **
4687631-C-A 4819590-C-A **
6693605-C-A 6825564-C-A **
18569675-C-A 16457795-C-A **
24446992-C-A 22300845-C-A **
14747346-C-A 12635415-C-A **
16561244-C-A 14449364-C-A **
13596930-C-A 11441254-C-A **
10015563-G-A 10177954-G-A **
13858286-A-G 11737580-A-G **
10050911-GA-G 10213302-GA-G **
20612190-T-G 18450304-T-G P4_Prx **
22027586-C-A 19865700-C-A **
21694822-C-A 19532936-C-A **
21559173-C-A 19397287-C-A FGC61881 **
21514795-G-A 19352909-G-A **
21082087-C-A 18920201-C-A **
21033052-A-T 18871166-A-T **
21033039-A-AT 18871153-A-AT **
21033027-TA-T 18871141-TA-T **
20988974-T-G 18827088-T-G P4_Dst **
20613212-T-C 18451326-T-C P4_Prx **
20611412-G-T 18449526-G-T P5_Dst **
22791760-AT-A 20629874-AT-A **
20505385-A-T 18343499-A-T P5_Dst **
19669850-G-A 17557970-G-A P5_Prx **
19622081-A-T 17510201-A-T P5_Prx **
19530461-C-A 17418581-C-A **
19527551-G-A 17415671-G-A **
19218175-T-C 17106295-T-C **
19135191-G-T 17023311-G-T **
19110947-A-G 16999067-A-G **
18995453-A-G 16883573-A-G **
18981170-C-A 16869290-C-A **
22578311-T-C 20416425-T-C **
22797473-C-A 20635587-C-A **
18949794-A-G 16837914-A-G **
28526976-T-C 26380829-T-C **
56839228-C-A **
56836655-G-T **
56831045-T-TCCTTTACATC **
56830847-T-A **
56830842-T-C **
56830831-A-C **
56830815-C-T **
56829430-T-A **
28659967-A-G 26513820-A-G **
28644155-A-G 26498008-A-G **
28507570-G-T 26361423-G-T **
22962593-C-A 20800707-C-A **
27872503-TAGG-T 25726356-TAGG-T P1_Y2 **
27861908-C-G 25715761-C-G P1_Y2 **
26730238-A-G 24584091-A-G P1_g2 **
26133144-G-T 23986997-G-T P1_Y1 **
24405510-C-G 22259363-C-G FT112323 **
23824813-C-A 21662927-C-A **
23804199-A-G 21642313-A-G **
23419470-T-G 21257584-T-G **
23205210-C-A 21043324-C-A **
23043275-C-A 20881389-C-A **
18980903-T-C 16869023-T-C **
18873774-T-C 16761894-T-C FT305812 **
10772689-T-A **
13705634-T-A 11549958-T-A **
14313792-C-A 12193086-C-A **
14308480-CCA-C 12187774-CCA-C **
14104316-C-T 11983610-C-T **
14041688-C-A 11920982-C-A **
14021561-C-A 11900855-C-A **
13996229-C-A 11875523-C-A FT186221 **
13885073-C-A 11764367-C-A **
21555356-C-A 19393470-C-A **
13827204-G-A 11706498-G-A FT8998 **
11673277-G-T **
13584768-T-G 11429092-T-G **
14442994-C-A 12322267-C-A **
13491277-C-A 11335601-C-A **
13472529-A-G 11316853-A-G **
13304665-C-A 11148989-C-A **
11014359-T-G **
11014355-T-G **
11014333-AT-A **
10999897-T-TG **
10924546-C-A **
10899648-C-A **
10791016-T-C **
14387061-C-A 12266357-C-A **
14993191-G-A 12881276-G-A **
18780789-A-G 16668909-A-G **
17006214-A-C 14894334-A-C **
18241709-C-A 16129829-C-A **
18176366-TGTCATTTGTGATTTATG-T 16064486-TGTCATTTGTGATTTATG-T **
18115884-C-A 16004004-C-A FT13554 **
17886413-C-A 15774533-C-A **
17871694-A-G 15759814-A-G **
17668216-C-A 15556336-C-A **
17440896-TCATTC-T 15329016-TCATTC-T **
17374787-T-C 15262907-T-C **
17313249-T-C 15201369-T-C **
17100441-C-A 14988561-C-A **
16941812-A-C 14829932-A-C **
15276949-T-C 13165038-T-C **
16819013-ATC-A 14707133-ATC-A **
16702363-C-A 14590483-C-A **
16616119-G-A 14504239-G-A FT111584 **
15956856-A-T 13844976-A-T **
15758469-T-C 13646589-T-C **
15739917-C-A 13628037-C-A **
15725881-C-A 13614001-C-A **
15606831-T-TG 13494951-T-TG **
15606817-G-C 13494937-G-C **
15429145-A-C 13317265-A-C **
15364268-C-A 13252388-C-A **
16889884-C-A 14778004-C-A **
7705640-C-A 7837599-C-A **
17013293-C-A 14901413-C-A **
10973821-T-A **
20778667-CATAT-C 18616781-CATAT-C P4_Prx 9×AT**
13462368-G-A 11306692-G-A **
5845965-CA-C 5977924-CA-C 10×A**
10885125-T-TCCACACCACC **
10885114-C-A BY83945 **
10973890-A-C **
10973874-C-A **
10973868-CAGTT-C **
10973865-T-A **
10973845-T-A **
10885166-C-T **
18346573-C-A 16234693-C-A P6_Prx **
10821924-T-G **
11025527-T-A **
11025523-C-T **
11025510-T-A **
11025499-C-A **
11025498-C-G **
11025486-T-A **
11025478-C-T **
11025476-C-T **
11025461-T-C **
10873090-T-TTAAAA **
10760417-C-T **
10973905-T-C FT92146 **
13488814-C-G 11333138-C-G **
10821889-C-G **
10760382-C-T **
28791133-A-T 26644986-A-T 4×AGTGG**
10752496-C-T **
21691945-C-A 19530059-C-A **
18050560-C-A 15938680-C-A **
24381232-C-CA 22235085-C-CA 10×A**
10801677-C-CACTGA **
10752506-T-C **
21295234-CTT-C 19133348-CTT-C 17×T**
16968321-C-A 14856441-C-A **
5969702-C-A 6101661-C-A **
11643748-G-A **
22703624-AAG-A 20541738-AAG-A **
14071379-TG-T 11950673-TG-T **
11643778-G-T **
10885224-T-C **
10885171-CCACTG-C **
10760407-T-C **
28781514-C-A 26635367-C-A **
4114685-ATT-A 4246644-ATT-A 15×T**
20634952-AT-A 18473066-AT-A P4_Prx **
11014374-T-C **
9771940-CTTT-C 9934331-CTTT-C 18×T**
6776340-C-T 6908299-C-T **
13488821-C-A 11333145-C-A **
13488800-A-G 11333124-A-G **
24247412-C-CAT 22101265-C-CAT P3_b1 **
13869119-G-C 11748413-G-C **
21133556-CAAA-C 18971670-CAAA-C 23×A**
13489790-G-A 11334114-G-A **
13600648-C-A 11444972-C-A Z9012 **
13489230-A-T 11333554-A-T **
9416730-TG-T 9579121-TG-T **
28791165-A-G 26645018-A-G **
58974979-T-A 56828832-T-A **
21929602-A-G 19767716-A-G A20295 **
58976726-C-G 56830579-C-G **
16779007-G-GAA 14667127-G-GAA 10×A**
6226036-CT-C 6357995-CT-C IR3_Dst **
23802405-G-A 21640519-G-A **
19000519-CT-C 16888639-CT-C 10×T**
58976732-T-C 56830585-T-C **
6795128-G-A 6927087-G-A S5668FGC9776 Y12649 **
58976687-T-C 56830540-T-C BY42544 **
6226034-T-A 6357993-T-A IR3_Dst **
13454828-A-T 11299152-A-T **
58978167-CTCCATCCCAT-C 56832020-CTCCATCCCAT-C **
58977001-G-C 56830854-G-C **
26834599-CAAAGAAAG-C 24688452-CAAAGAAAG-C P1_g2 16×AAAG**
58979410-C-T 56833263-C-T **
13458036-CACTGT-G 11302360-CACTGT-G **
13472527-T-G 11316851-T-G **
58976696-C-T 56830549-C-T **
13453318-G-T 11297642-G-T 12×CATTC**
13488790-C-T 11333114-C-T **
13453269-C-A 11297593-C-A **
11001409-G-T **
16305923-TC-T 14194043-TC-T **
19847672-C-A 17735792-C-A P5_Prx **
16016358-C-A 13904478-C-A **
15749575-CTT-C 13637695-CTT-C 15×T**
13453353-C-T 11297677-C-T **
13453333-C-G 11297657-C-G **
13453325-A-T 11297649-A-T **
13453319-C-CAGTTG 11297643-C-CAGTTG **
13453316-T-A 11297640-T-A **
13453283-T-TCACTG 11297607-T-TCACTG **
11001404-C-A **
15449892-C-CT 13338012-C-CT 21×T**
11001401-C-G **
10873095-T-C **
58976489-C-T 56830342-C-T **
58982467-T-G 56836320-T-G **
6828046-C-A 6960005-C-A **
5966890-GTT-G 6098849-GTT-G 14×T**
58976627-A-T 56830480-A-T **
16438097-C-A 14326217-C-A **
9371500-A-T 9533891-A-T **
13472212-C-G 11316536-C-G **
13472211-C-A 11316535-C-A **
6273857-CA-C 6405816-CA-C IR3_Dst **
10885201-C-A **
56849479-T-C **
10999875-A-AATTCT **
10752483-C-G **
10752467-T-C **
10752462-T-A **
10752461-A-C **
7897159-G-T 8029118-G-T **
16980075-C-A 14868195-C-A **
13475275-C-A 11319599-C-A **
56833267-A-T **
14724484-C-A 12612552-C-A **
17244267-G-T 15132387-G-T **
14261637-C-A 12140931-C-A **
17199615-C-A 15087735-C-A **
11643720-A-T **
28815213-T-A 26669066-T-A **
22816363-TCTC-T 20654477-TCTC-T **
13642594-C-A 11486918-C-A **
14413210-CAAAAA-C 12292507-CAAAAA-C 23×A**
22204869-G-T 20042983-G-T **
21077013-C-A 18915127-C-A **
13869162-A-G 11748456-A-G **
13717516-A-T 11561840-A-T **
17118387-T-C 15006507-T-C **
22309934-G-T 20148048-G-T DYZ19 **
7311770-C-A 7443729-C-A **
7013599-A-ATT 7145558-A-ATT 13×T**
10973922-C-A **
28095960-GT-G 25949813-GT-G P1_Y2 9×T**
18480325-TAG-T 16368445-TAG-T P6_Dst **
16789604-AT-A 14677724-AT-A 8×T**
11643764-G-T **
7075903-C-A 7207862-C-A **
14550198-C-A 12438399-C-A **
17276889-TA-T 15165009-TA-T 10×A**
16491749-C-A 14379869-C-A **
56834951-C-A **
27718969-CT-C 25572822-CT-C P1_Y2 **
17580247-C-A 15468367-C-A Y99603 **
14073164-A-C 11952458-A-C Y90222 **
7210075-C-A 7342034-C-A **
7248595-C-A 7380554-C-A **
13216488-C-A 11060812-C-A **
10980728-C-CG **
56830859-C-A **
13454833-A-G 11299157-A-G **
14310411-C-A 12189705-C-A **
14948966-C-A 12837040-C-A **
56830799-C-A **
4129812-C-A 4261771-C-A **
13458737-A-C 11303061-A-C **
22173954-GAAA-G 20012068-GAAA-G 16×A**
14539337-C-A 12427538-C-A **
11001422-C-T **
15758566-C-A 13646686-C-A **
10821850-T-C **
10776074-C-CCAATG **
2840120-G-A 2972079-G-A **
10760387-T-TTGTAC **
21635384-C-A 19473498-C-A **
23415344-T-A 21253458-T-A **
13869143-TGG-T 11748437-TGG-T **
13869120-G-A 11748414-G-A **
13489189-G-A 11333513-G-A **
10776057-T-TTATAC **
14143327-C-A 12022621-C-A **
17735563-C-A 15623683-C-A **
28708382-C-A 26562235-C-A **
17018718-T-A 14906838-T-A **
10973903-C-T **
11643742-T-C **
10973843-C-G **
27499347-C-A 25353200-C-A P1_Y2 **
13489155-G-A 11333479-G-A **
13869174-G-C 11748468-G-C **
7280942-C-A 7412901-C-A **
10999935-G-A **
10911534-C-A **
21604028-C-A 19442142-C-A **
18022155-C-CTA 15910275-C-CTA **
10986883-A-G **
56830531-A-T **
10999914-C-A ***
13450425-ATTCTATTCCATTCCATTCCATTCCATTCCA-A,ATTCCATTCCATTCCATTCCATTCCATTCCG 11294749-ATTCTATTCCATTCCATTCCATTCCATTCCA-A,ATTCCATTCCATTCCATTCCATTCCATTCCG ***
13712548-T-C 11556872-T-C ***
13489508-G-A 11333832-G-A ***
22025229-T-C 19863343-T-C FT155101 ***
21979202-C-A 19817316-C-A ***
20459042-CAA-C 18297156-CAA-C P5_Dst 21×A***
13565958-C-A 11410282-C-A ***
8599992-G-GT 8731951-G-GT 16×T***
7047797-A-AT 7179756-A-AT 10×T***
15548847-G-GAC 13436967-G-GAC 18×AC***
15197744-C-CT 13085830-C-CT 10×T***
58973911-C-G 56827764-C-G ***
21136116-C-A 18974230-C-A ***
13719475-G-A 11563799-G-A ***
21835386-CTT-C 19673500-CTT-C 12×T***
13454842-T-A 11299166-T-A 7×ATTCC***
13458710-C-T 11303034-C-T ***
22966115-G-A 20804229-G-A ***
13488254-G-T 11332578-G-T ***
13488278-C-A 11332602-C-A ***
7311551-T-TTTCC 7443510-T-TTTCC 14×TTCC***
58977694-G-A 56831547-G-A ***
13898754-G-GT 11778048-G-GT 26×T***
9935532-A-G 10097923-A-G ***
19377443-A-G 17265563-A-G BY25021 ***
28768027-G-A 26621880-G-A ***
10999895-A-ACC ***
22805341-C-A 20643455-C-A ***
17332750-CAAA-C 15220870-CAAA-C 22×A***
10999912-T-A ***
14986679-GCT-G 12874747-GCT-G ***
10999894-C-CGT,T ***
22113187-CAA-C 19951301-CAA-C 23×A***
22599184-C-A 20437298-C-A ***
13452715-A-C 11297039-A-C ***
10999930-T-G ***
8462064-CAA-C 8594023-CAA-C 26×A***
15057150-C-A 12945242-C-A ***
21112211-C-A 18950325-C-A ***
17318709-C-A 15206829-C-A ***
8874970-CTTT-C 9006929-CTTT-C 17×T***
14547033-A-G 12435234-A-G ***
14747736-C-A 12635805-C-A ***
15332085-C-A 13220203-C-A ***
16940266-C-A 14828386-C-A ***
19449009-CTT-C,CT 17337129-CTT-C,CT 13×T***
16834085-C-A 14722205-C-A ***
13488450-G-A 11332774-G-A ***
14313905-C-A 12193199-C-A ***
10999920-A-G ***
2907844-C-A 3039803-C-A ***
17895175-ATTTT-A 15783295-ATTTT-A 21×T***
16496011-A-G 14384131-A-G ***
14958016-C-A 12846091-C-A ***
15439333-C-A 13327453-C-A ***
10999893-C-A ***
15747641-A-G 13635761-A-G ***
13476617-G-C 11320941-G-C ***
15508033-C-A 13396153-C-A ***
17437089-C-A 15325209-C-A ***
17560367-C-A 15448487-C-A ***
23447275-C-A 21285389-C-A ***
22792919-C-A 20631033-C-A ***
13458709-T-G 11303033-T-G ***
22108541-C-A 19946655-C-A ***
21839939-CTT-C 19678053-CTT-C 17×T***
13488215-C-T 11332539-C-T ***
17714559-C-A 15602679-C-A ***
13488235-C-G 11332559-C-G ***
13450931-CAT-C,TAT 11295255-CAT-C,TAT ***
3436171-CTT-C,CT 3568130-CTT-C,CT 15×T***
13488275-G-A 11332599-G-A ***
19500593-GAGAAAGAAAGAA-G,GAGAA 17388713-GAGAAAGAAAGAA-G,GAGAA 15×AGAA***
22973869-TAAA-T 20811983-TAAA-T 17×A***
17840574-C-A 15728694-C-A ***
13708976-A-C 11553300-A-C ***
10999919-C-T ***
25592896-CTCTC-C,CTATA 23446749-CTCTC-C,CTATA P1_gr1 ***
13458739-T-C 11303063-T-C ***
13253992-C-A 11098316-C-A ***
18890882-AT-A,ATTT 16779002-AT-A,ATTT 17×T***
13458719-T-C 11303043-T-C ***
21617776-CAA-C,CAAA 19455890-CAA-C,CAAA 15×A***
23040157-TAA-T 20878271-TAA-T 17×A***
13458733-T-G 11303057-T-G ***
56826607-C-T ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: N263873895865774061937384281
Used in age calculations895865774061937384281
Counts of SNPs1818
Variant counts last updated 2022-07-30 03:29:58.



Big Tree Main Page