Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > ZZ10 > Z253 > BY39781

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY2
631312
22296808-G-A 20134922-G-A DYZ19 A+
22285313-A-G 20123427-A-G DYZ19 A*
28817196-G-C 26671049-G-C A*
19666631-G-C 17554751-G-C P5_Prx A*
19634571-T-TAA 17522691-T-TAA P5_Prx A*
22304994-C-G 20143108-C-G DYZ19 A*
20041368-A-G 17929488-A-G P5_Prx A*
6309245-A-G 6441204-A-G A14844 A14828 IR3_Dst A*
25888470-C-T 23742323-C-T P1_Y1 A*
26106381-C-T 23960234-C-T P1_Y1 A*
6244485-C-CCA 6376444-C-CCA IR3_Dst 9×CAA*
28816741-T-G 26670594-T-G A*
16183412-A-C 14071532-A-C YA*
14173115-T-A 12052409-T-A BY190505 YY+
19184871-G-A 17072991-G-A BY191516 Y+
23056767-C-T 20894881-C-T YY+
22555744-T-G 20393858-T-G BY191983 YY+
7654555-G-A 7786514-G-A BY189908 YY+
19079430-G-A 16967550-G-A BY191487 YY+
22053358-G-T 19891472-G-T BY191869 YY+
27872862-T-A 25726715-T-A BY226943 P1_Y2 +
19246447-G-A 17134567-G-A BY191543 YY+
21445883-AC-A 19283997-AC-A +
7588469-T-A 7720428-T-A BY189887 YY+
13210100-T-C 11054424-T-C BY209942 +
19458451-T-C 17346571-T-C BY191600 YY+
17200713-G-A 15088833-G-A YY+
7096757-T-G 7228716-T-G BY189806 YY+
7978977-T-G 8110936-T-G BY190013 YY+
23483631-C-T 21321745-C-T BY192200 YY+
8168320-G-A 8300279-G-A BY190055 YY+
8757764-G-A 8889723-G-A BY190228 YY+
17880481-A-G 15768601-A-G BY191248 YY+
9396372-T-G 9558763-T-G BY190336 YY+
18047899-T-C 15936019-T-C BY191310 YY+
18123858-G-A 16011978-G-A BY191333 YY+
28789110-C-A 26642963-C-A BY227274 +
15229985-C-T 13118071-C-T BY190711 Y+
6286963-GCACACA-G 6418922-GCACACA-G IR3_Dst +
14987611-T-C 12875677-T-C BY190660 YY+
28790173-G-C 26644026-G-C BY227289 +
4863051-G-A 4995010-G-A BY189671 +
24410154-T-C 22264007-T-C BY192306 Y+
23978960-CA-C 21832813-CA-C +
28805602-G-A 26659455-G-A *
8801381-G-GGAAGAA 8933340-G-GGAAGAA 10×GAA*
8504198-TTGTG-T 8636157-TTGTG-T 19×TG*
22345674-G-T 20183788-G-T DYZ19 *
10779604-C-A **
10774023-C-A **
10772437-A-ACCCCT **
56835383-T-G **
10801717-C-GGGTAAATCA **
13453145-A-ATTCTT 11297469-A-ATTCTT **
13851154-A-T 11730448-A-T **
13817803-G-T 11697097-G-T **
13698703-G-T 11543027-G-T **
13593660-C-A 11437984-C-A **
13482192-T-A 11326516-T-A **
13462120-G-T 11306444-G-T **
13453172-T-TACCTG 11297496-T-TACCTG **
13453164-C-CGTTAG 11297488-C-CGTTAG **
13453130-A-ATTCCTTTCTT 11297454-A-ATTCCTTTCTT **
10808601-C-G **
10625666-T-C **
13453100-A-C 11297424-A-C **
13332632-G-T 11176956-G-T **
13327756-C-T 11172080-C-T **
13320759-G-C 11165083-G-C **
13205644-C-A 11049968-C-A **
11025796-G-A **
10857887-C-A **
10843236-C-A **
10671129-C-A **
7145709-G-A 7277668-G-A **
10023066-T-C 10185457-T-C **
5543399-T-C 5675358-T-C **
24598280-A-AG 22452133-A-AG P3_t2 **
58982167-A-C 56836020-A-C **
14273331-G-T 12152625-G-T **
2738720-A-G 2870679-A-G **
2859138-G-A 2991097-G-A **
2903232-C-T 3035191-C-T BY209220 18×TCCT**
3332392-C-A 3464351-C-A **
3366599-C-A 3498558-C-A **
4077878-C-A 4209837-C-A **
4371914-G-A 4503873-G-A **
4609120-C-A 4741079-C-A **
5215880-T-A 5347839-T-A **
5215881-T-A 5347840-T-A **
5759278-G-A 5891237-G-A **
10016027-T-G 10178418-T-G **
5870247-A-T 6002206-A-T **
6881453-T-G 7013412-T-G **
6998059-C-A 7130018-C-A **
7015578-C-A 7147537-C-A **
7028078-T-C 7160037-T-C **
7044596-A-G 7176555-A-G **
7048372-A-C 7180331-A-C **
7097251-G-T 7229210-G-T **
7130638-T-G 7262597-T-G **
7132023-A-G 7263982-A-G **
7332689-G-T 7464648-G-T **
9076403-G-T 9238794-G-T FT32363 **
9983405-C-A 10145796-C-A **
10013572-C-A 10175963-C-A **
13871011-C-A 11750305-C-A **
15635851-A-C 13523971-A-C **
13946113-G-T 11825407-G-T **
22202284-T-C 20040398-T-C **
18902970-C-A 16791090-C-A **
19436852-G-A 17324972-G-A **
19530414-G-A 17418534-G-A **
19891027-T-TAA 17779147-T-TAA P5_Prx **
19891064-G-GTT 17779184-G-GTT P5_Prx 10×T**
20104115-G-T 17992235-G-T P5_Dst **
20217957-C-CAATA 18056071-C-CAATA P5_Dst **
20579339-ACCATAT-A 18417453-ACCATAT-A P5_Dst **
20637629-AG-A 18475743-AG-A P4_Prx 16×GT**
20707537-C-A 18545651-C-A BY212313 P4_Prx **
21238939-G-T 19077053-G-T **
21262163-GT-G 19100277-GT-G **
21323692-G-A 19161806-G-A **
21861288-C-A 19699402-C-A **
22212056-T-C 20050170-T-C **
18756347-T-C 16644467-T-C **
25967787-C-A 23821640-C-A P1_Y1 **
56832539-C-CTCCAATCCATTCCATTCCAT **
28782145-C-A 26635998-C-A **
28732975-C-T 26586828-C-T **
28720701-C-A 26574554-C-A **
27968355-T-TG 25822208-T-TG P1_Y2 **
26563219-G-T 24417072-G-T P1_g2 **
25859352-A-G 23713205-A-G P1_Y1 **
23297600-C-T 21135714-C-T **
25839804-A-G 23693657-A-G P1_b3 **
25593210-G-T 23447063-G-T P1_gr1 **
24676152-G-T 22530005-G-T P3_b2 **
24472444-TTTG-T 22326297-TTTG-T **
23848648-C-A 21686762-C-A **
23609490-C-T 21447604-C-T **
18761913-G-A 16650033-G-A **
18443625-G-T 16331745-G-T P6_Dst **
13952809-C-A 11832103-C-A **
15791470-A-C 13679590-A-C **
13961454-T-C 11840748-T-C **
14148183-G-C 12027477-G-C **
14155580-G-A 12034874-G-A **
14187237-C-A 12066531-C-A **
14463489-C-A 12342762-C-A **
14566433-T-A 12454633-T-A **
14609794-C-G 12497996-C-G **
14753237-G-C 12641306-G-C **
15410672-A-T 13298792-A-T **
15439885-A-G 13328005-A-G **
15533106-A-G 13421226-A-G **
15572600-G-C 13460720-G-C **
15605522-C-A 13493642-C-A **
13462153-C-G 11306477-C-G **
15923445-GT-G 13811565-GT-G **
18136290-G-A 16024410-G-A **
17307934-C-T 15196054-C-T **
17860803-A-G 15748923-A-G **
17808135-A-G 15696255-A-G **
17702639-C-A 15590759-C-A **
17571921-A-G 15460041-A-G **
17355680-T-C 15243800-T-C **
17355623-A-G 15243743-A-G **
17285240-A-G 15173360-A-G **
15963860-G-T 13851980-G-T **
17203498-A-AAT 15091618-A-AAT **
17203485-A-G 15091605-A-G **
16987802-C-A 14875922-C-A **
16729436-G-A 14617556-G-A **
16245030-C-A 14133150-C-A **
16035542-C-T 13923662-C-T **
13462160-G-T 11306484-G-T **
2817916-C-A 2949875-C-A **
17203479-C-T 15091599-C-T **
13585502-C-A 11429826-C-A **
10877825-T-C **
10877823-T-G **
10877822-C-T **
10801765-T-G **
17385563-C-A 15273683-C-A **
10656890-C-G **
24210538-C-A 22064391-C-A P3_b1 **
10801672-C-T **
22580068-CTTTTT-C 20418182-CTTTTT-C 19×T**
16345076-TTCC-T 14233196-TTCC-T 5×TCC**
10999889-C-T **
10983918-T-C **
13487754-C-G 11332078-C-G **
13487736-C-A 11332060-C-A **
13487732-C-G 11332056-C-G **
16269439-C-A 14157559-C-A **
28805853-G-C 26659706-G-C **
10877828-CA-C **
19600618-GTA-G 17488738-GTA-G P5_Prx **
11676462-C-T **
10801727-C-T **
16747431-CT-C 14635551-CT-C 9×T**
7142169-C-A 7274128-C-A **
4222658-C-A 4354617-C-A **
8001980-TA-T 8133939-TA-T 9×A**
23442581-C-A 21280695-C-A **
15504209-C-A 13392329-C-A **
10992987-T-A **
26328697-C-A 24182550-C-A P1_Y1 **
11664987-C-A **
5459305-C-A 5591264-C-A **
18215757-C-A 16103877-C-A **
20579234-C-A 18417348-C-A P5_Dst **
10656880-C-T **
21238678-A-C 19076792-A-C **
10789385-C-T **
21316797-C-A 19154911-C-A **
10877858-C-T **
8824197-C-A 8956156-C-A **
4387995-C-A 4519954-C-A **
6214815-TG-T 6346774-TG-T IR3_Dst **
9927326-GAC-G 10089717-GAC-G **
17662167-GTAGATAGATAGATAGATAGATAGA-G 15550287-GTAGATAGATAGATAGATAGATAGA-G 16×TAGA**
17047106-G-A 14935226-G-A FGC57907FGC57914 **
17604931-G-GTTTT 15493051-G-GTTTT 24×T**
22487794-G-A 20325908-G-A DYZ19 **
19511876-A-AT 17399996-A-AT 9×T**
58974940-C-G 56828793-C-G **
16692116-CCA-C 14580236-CCA-C **
17071107-A-G 14959227-A-G 4×GAAG**
56836040-C-A **
13330312-T-TTA 11174636-T-TTA **
7081561-T-C 7213520-T-C FGC66 CTS910 **
15918592-C-T 13806712-C-T CTS4944 V3240 **
15842844-A-G 13730964-A-G V3169 **
22273552-T-A 20111666-T-A DYZ19 **
3436391-T-C 3568350-T-C L344 **
13459116-GATTCCATTCC-G 11303440-GATTCCATTCC-G 10×ATTCC**
58982166-A-C 56836019-A-C **
13489250-A-T 11333574-A-T **
56836045-T-C **
28734771-C-A 26588624-C-A **
10789397-T-G **
17192946-A-AAT 15081066-A-AAT **
13855523-A-AACG 11734817-A-AACG **
56836017-A-T **
56836011-T-C **
7243774-C-A 7375733-C-A **
28800728-A-T 26654581-A-T **
10789410-C-T **
10789400-C-A **
10789363-T-G **
56836067-A-AATCCC **
10789346-A-T **
7228488-C-A 7360447-C-A **
28537092-C-A 26390945-C-A **
5455113-C-A 5587072-C-A **
10877795-C-G **
19600439-G-T 17488559-G-T P5_Prx **
21709158-AT-A 19547272-AT-A 10×T**
28658387-AT-A 26512240-AT-A 9×T**
10801733-T-G **
23316125-C-A 21154239-C-A **
16779111-C-A 14667231-C-A **
18996551-C-A 16884671-C-A **
11003769-A-C **
3850000-C-A 3981959-C-A **
7202280-C-A 7334239-C-A **
18368636-G-GTT 16256756-G-GTT P6_Prx **
15193548-C-A 13081634-C-A **
17203466-A-G 15091586-A-G **
28483844-C-A 26337697-C-A **
16642139-C-A 14530259-C-A **
21891004-G-A 19729118-G-A **
10825279-C-G **
15756257-C-A 13644377-C-A **
5359673-G-T 5491632-G-T **
16620473-C-A 14508593-C-A **
14568194-C-A 12456394-C-A **
14753235-C-A 12641304-C-A **
17203508-G-T 15091628-G-T **
11003732-C-G **
10750800-A-ACTCCC **
13488536-G-GT 11332860-G-GT **
4902104-C-A 5034063-C-A **
5335441-C-A 5467400-C-A **
20579235-C-T 18417349-C-T P5_Dst **
13664697-AGGAATGGAATGGAAT-A 11509021-AGGAATGGAATGGAAT-A 10×GGAAT**
5367028-C-A 5498987-C-A **
22128705-C-A 19966819-C-A **
21754205-G-T **
56829766-C-CATTGCATGCT **
17032491-C-A 14920611-C-A **
21514093-C-A 19352207-C-A **
15221467-C-A 13109553-C-A **
13453154-C-A 11297478-C-A **
13228225-C-A 11072549-C-A **
17203487-T-C 15091607-T-C **
17203457-C-T 15091577-C-T **
14589443-C-A 12477643-C-A **
17375588-C-A 15263708-C-A **
5669248-C-A 5801207-C-A **
5528018-G-T 5659977-G-T **
10657283-TC-T **
17575515-T-A 15463635-T-A **
10958334-C-CT **
13489322-T-A 11333646-T-A **
10801714-T-C **
10999041-C-A **
14574527-C-A 12462727-C-A **
10657281-A-AC **
19060008-C-A 16948128-C-A **
13299513-C-A 11143837-C-A **
22649595-C-A 20487709-C-A **
11003757-C-G **
14755578-C-A 12643647-C-A **
21754373-G-T **
15302738-G-GTT 13190837-G-GTT 13×T**
56829764-T-C **
17203494-G-A 15091614-G-A **
13488515-G-T 11332839-G-T **
22529556-A-G 20367670-A-G **
23439883-C-A 21277997-C-A **
22587767-C-A 20425881-C-A **
56834580-C-CTCCAT **
10972820-T-C **
9956363-C-A 10118754-C-A **
22797931-G-T 20636045-G-T **
14743244-C-A 12631312-C-A ***
2807033-TA-T 2938992-TA-T ***
13832334-G-T 11711628-G-T ***
13832329-G-C 11711623-G-C ***
10627274-CTTCCATTCCATTCCATTCCATTCCATTCCATTCCA-C,CTTCCATTCCATTCCATTCCATTCCATTCCA 12×TTCCA***
20459042-CAAAAA-C 18297156-CAAAAA-C P5_Dst 21×A***
21062762-ATGTG-A 18900876-ATGTG-A 17×TG***
28159218-T-TAC 26013071-T-TAC P1_b4 17×AC***
13454847-C-T 11299171-C-T ***
13832344-A-G 11711638-A-G ***
13860100-C-T 11739394-C-T ***
21983827-T-C 19821941-T-C ***
21358553-A-G 19196667-A-G ***
18865298-T-C 16753418-T-C ***
9153976-G-C 9316367-G-C ***
13832323-T-TG 11711617-T-TG ***
19333229-ATT-A,AT 17221349-ATT-A,AT 21×T***
13489652-C-A 11333976-C-A ***
7241635-C-T 7373594-C-T ***
14296782-C-A 12176076-C-A ***
13705676-G-A 11550000-G-A ***
9997032-C-A 10159423-C-A ***
19300537-G-A 17188657-G-A ***
13996200-A-G 11875494-A-G ***
8704312-C-A 8836271-C-A ***
2750686-CA-C 2882645-CA-C 8×A***
17289497-A-T 15177617-A-T ***
16908228-C-CT 14796348-C-CT ***
19508177-CTTTTTT-C 17396297-CTTTTTT-C 19×T***
16555058-A-G 14443178-A-G ***
6858592-CT-C,CTT 6990551-CT-C,CTT 25×T***
6645821-C-A 6777780-C-A ***
22444210-C-A 20282324-C-A DYZ19 ***
14367572-C-A 12246868-C-A ***
23421860-T-C 21259974-T-C ***
7310757-C-A 7442716-C-A ***
13832318-A-T 11711612-A-T ***
13493962-C-T 11338286-C-T ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 631312939086877311537678814
Used in age calculations939086877311537678814
Counts of SNPs2321
Variant counts last updated 2019-04-19 15:45:06.



Big Tree Main Page