Tree Position

R-M269 > L23 > L51 > P310 > L151 > S1194 > S1200 > S14328 > A8469 > S1196 > 11933437-T-G

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY3
826795
BigY2
826795
19576142-T-C 17464262-T-C ZS1874 P5_Prx YA+
21745928-C-T A+
30520-C-A FGCLR36 A+
19678517-G-GC 17566637-G-GC P5_Prx A*
28817918-G-A 26671771-G-A A*
3411996-T-TTG 3543955-T-TTG 23×TGA*
58983143-C-T 56836996-C-T A*
28817564-G-T 26671417-G-T A*
56831135-G-A A*
18326477-C-G 16214597-C-G P6_Prx A*A*
56835381-C-A A*
28817568-C-G 26671421-C-G A*
3011969-A-AGG 3143928-A-AGG A****
20757284-C-CT 18595398-C-CT P4_Prx 26×TA*
28817539-A-G 26671392-A-G A*
28816978-A-G 26670831-A-G A*
13451764-C-A 11296088-C-A A*
56837155-T-C A*
58983150-C-T 56837003-C-T A*
18328428-G-T 16216548-G-T P6_Prx A*A*
10651982-T-TATTCC A*
56829554-C-G A*
26390471-A-C 24244324-A-C P1_Y1 A*
18480675-C-A 16368795-C-A P6_Dst A*
6247619-A-G 6379578-A-G IR3_Dst A*
5336277-A-T 5468236-A-T A*
56827053-A-AATCCC A*
13489674-A-G 11333998-A-G A*
22454276-G-C 20292390-G-C FGC6545 DYZ19 A*
56832630-A-G A*
28816977-C-G 26670830-C-G A*A*
25552574-G-A 23406427-G-A P1_gr1 A*A*
24271496-C-T 22125349-C-T P3_b1 A*A*
22454537-A-T 20292651-A-T DYZ19 A*
22291222-T-A 20129336-T-A DYZ19 A*A*
22265788-C-A 20103902-C-A DYZ19 A*
19913278-C-G 17801398-C-G P5_Prx A*A*
56831385-A-ATTCTT A*
58982958-T-C 56836811-T-C A*
13449037-C-T 11293361-C-T A*
3011969-A-G 3143928-A-G A****
58982973-T-C 56836826-T-C A*
58978394-A-G 56832247-A-G A*
19237524-C-G 17125644-C-G BY1516 YY++
18167862-G-A 16055982-G-A BY1407 YY++
18255163-A-T 16143283-A-T BY11805 Y++
8060132-A-G 8192091-A-G BY755 YY++
18593766-G-A 16481886-G-A BY1442 YY++
18648494-C-G 16536614-C-G BY1453 YY++
7827515-T-C 7959474-T-C BY184864 YY++
5511878-C-CT 5643837-C-CT 12×T+
5443736-C-T 5575695-C-T FT110480 +**
21560030-G-A 19398144-G-A BY11808 YY+**
8270158-G-A 8402117-G-A BY184926 YY++
22462047-G-A 20300161-G-A BY220812 DYZ19 ++
16775689-C-CA 14663809-C-CA 9×A+***
23367845-T-G 21205959-T-G BY185870 YY++
24004350-T-C 21858203-T-C Y++
24892644-C-T 22746497-C-T g1 ++
9038668-T-TA 9201059-T-TA A5388 9×A**+
22139215-A-G 19977329-A-G YY++
17305601-T-C 15193721-T-C BY1326 YY++
17972285-G-T 15860405-G-T BY185506 YY++
10999228-A-G FT225266 +**
13830116-A-T 11709410-A-T ++
13633861-G-T 11478185-G-T FT225265 +**
13852976-T-C 11732270-T-C ++
14048276-C-T 11927570-C-T FGC14435 YY+**
14223343-C-T 12102637-C-T BY185147 YY++
14648251-G-C 12536316-G-C BY1108 YY++
13221956-C-T 11066280-C-T BY73349 +**
14730635-GA-G 12618703-GA-G +**
14850525-G-A 12738591-G-A BY11801 YY++
14043335-G-A 11922629-G-A BY60300S15363 YY++
15527251-C-T 13415371-C-T BY11802 YY+**
10031952-C-T 10194343-C-T Y+**
9161751-T-A 9324142-T-A BY185057 ++
8754755-T-A 8886714-T-A BY185007 YY++
16874377-C-T 14762497-C-T FT111624 YY+**
16959530-T-C 14847650-T-C BY1303 YY++
8537033-G-A 8668992-G-A BY184976 YY++
8429097-A-C 8561056-A-C BY803 YY++
10815878-C-T FT225267 +
13813440-T-C 11692734-T-C FT111101 +**
14918090-A-T 12806157-A-T M9119 YY++
5990153-C-T 6122112-C-T FT70673 +
19355316-A-T 17243436-A-T FT73464 Y+
3977450-CAT-C 4109409-CAT-C +
14797779-T-C 12685850-T-C FT111358 Y+
5481885-A-G 5613844-A-G FT70631 +
13997611-G-T 11876905-G-T YY+
18156809-G-T 16044929-G-T FT111809 Y+
16054926-C-T 13943046-C-T YY+
4510545-AT-A 4642504-AT-A +
13252233-T-C 11096557-T-C FT225275 +
19501787-G-A 17389907-G-A BY20954FGC65830 BY20969 YY++
14435894-T-C 12315167-T-C S1259 Y++
9524021-A-G 9686412-A-G BY175564BY34316 +
14435899-A-T 12315172-A-T BY40844S1260 Y++
5489434-A-G 5621393-A-G FT73271 +
10781460-T-A FT225274 +
5015519-C-A 5147478-C-A FT70600 +
19355314-G-T 17243434-G-T FT73463 Y+
22432757-AC-A 20270871-AC-A DYZ19 **
13449755-ACCC-A 11294079-ACCC-A *
56843626-G-T *
13829430-TAATGG-T 11708724-TAATGG-T 9×AATGG**
17313273-CTGTATTGTAT-C 15201393-CTGTATTGTAT-C 11×TGTAT*
22318193-G-T 20156307-G-T DYZ19 ****
4550201-C-T 4682160-C-T *
22280296-C-G 20118410-C-G BY215944 DYZ19 *
13869404-CGAATGGAATG-C 11748698-CGAATGGAATG-C 9×GAATG***
22255434-C-A 20093548-C-A DYZ19 ****
22253315-G-T 20091429-G-T BY214126 DYZ19 ****
13451979-A-T 11296303-A-T *
10983470-GCATTC-G *
10921118-C-CTCCAT *
28661351-G-GATCC 26515204-G-GATCC 10×ATCC****
10664773-CCCATT-C *
13838485-A-AGGAAT 11717779-A-AGGAAT 9×GGAAT****
10795051-GCATTCCATTC-G *
23063170-T-TA 20901284-T-TA 10×A***
23761675-AAGC-A,AAGA 21599789-AAGC-A,AAGA *
28797587-T-C 26651440-T-C **
13960586-AGGAT-A 11839880-AGGAT-A 13×GGAT*
5338087-ATTT-A 5470046-ATTT-A 16×T*
4272991-T-TTGTG 4404950-T-TTGTG 11×TG*
18096283-G-A 15984403-G-A Z19998 YP4765 YY****
10823854-G-T **
6930711-C-A 7062670-C-A **
13493740-T-C 11338064-T-C **
14196329-C-A 12075623-C-A **
13571088-G-T 11415412-G-T **
8153875-G-T 8285834-G-T **
13523733-G-A 11368057-G-A **
8058521-C-T 8190480-C-T **
13488536-G-GT 11332860-G-GT **
23034415-C-T 20872529-C-T **
13309813-G-A 11154137-G-A **
13490670-C-A 11334994-C-A **
8720560-C-A 8852519-C-A **
10669443-C-T **
13254299-C-A 11098623-C-A **
13222123-AGG-A 11066447-AGG-A **
13222114-GA-G 11066438-GA-G **
25990634-GTTTTTTTTT-G 23844487-GTTTTTTTTT-G P1_Y1 23×T**
16399957-C-A 14288077-C-A **
15851021-G-T 13739141-G-T A8506 ****
10772483-ATC-A **
10767171-T-C **
9422965-C-T 9585356-C-T **
10746885-T-TA **
10652635-C-A **
10746881-TC-T **
9507982-CTTTTTT-C 9670373-CTTTTTT-C 34×T**
26922019-C-A 24775872-C-A P1_r3 **
28808553-CAAAGC-T 26662406-CAAAGC-T **
4534077-C-A 4666036-C-A **
28600474-T-C 26454327-T-C **
17859284-C-A 15747404-C-A **
7107605-C-A 7239564-C-A **
17779457-C-A 15667577-C-A **
18987140-C-A 16875260-C-A **
13932489-C-A 11811783-C-A **
18200951-C-A 16089071-C-A **
13946159-C-A 11825453-C-A **
23034414-C-T 20872528-C-T **
10747107-G-A **
13324778-C-A 11169102-C-A **
21753307-T-C **
21753306-T-C **
16692780-AAAAAG-A 14580900-AAAAAG-A **
13726094-A-T 11570418-A-T **
56826694-TTTGCATCCATTCAA-T **
58975901-CCCATTCCATTCCTCT-C 56829754-CCCATTCCATTCCTCT-C **
4919564-C-A 5051523-C-A **
28808563-T-TAGATA 26662416-T-TAGATA **
13719459-G-C 11563783-G-C **
7318568-C-A 7450527-C-A **
5212170-C-A 5344129-C-A **
7048622-C-A 7180581-C-A **
59004357-G-T 56858210-G-T **
6771435-C-A 6903394-C-A **
6240989-C-CAGA 6372948-C-CAGA IR3_Dst **
6240959-C-A 6372918-C-A IR3_Dst **
5869482-C-A 6001441-C-A **
5613376-G-A 5745335-G-A **
10661660-AT-A **
5214047-C-A 5346006-C-A **
6520287-C-A 6652246-C-A **
7094396-C-A 7226355-C-A **
4534149-G-A 4666108-G-A **
3853324-C-A 3985283-C-A **
56835648-C-T **
28808515-G-T 26662368-G-T **
10669514-C-T **
5204352-G-A 5336311-G-A **
4861922-C-A 4993881-C-A **
11653834-C-A **
22297887-CAG-C 20136001-CAG-C DYZ19 **
13696363-G-A 11540687-G-A **
9062074-C-A 9224465-C-A **
24423214-CAT-C 22277067-CAT-C **
11654130-A-G **
28555594-G-A 26409447-G-A **
13351185-TC-T 11195509-TC-T **
13457924-T-G 11302248-T-G **
26314357-T-A 24168210-T-A P1_Y1 **
56831352-G-T **
58976527-C-T 56830380-C-T **
28808531-A-T 26662384-A-T **
28762862-G-T 26616715-G-T **
28719904-C-T 26573757-C-T **
28567072-C-A 26420925-C-A **
26415673-TCTC-T 24269526-TCTC-T P1_Y1 **
20622519-CAAAA-C 18460633-CAAAA-C P4_Prx 17×A**
25865673-T-G 23719526-T-G P1_Y1 **
22457412-T-G 20295526-T-G YFS033283 DYZ19 **
25466772-G-T 23320625-G-T P2_r2 **
23761675-AAGC-A 21599789-AAGC-A **
23019886-G-A 20858000-G-A **
22869073-C-A 20707187-C-A **
22713102-G-A 20551216-G-A **
22594401-T-C 20432515-T-C **
22537524-A-C 20375638-A-C **
25542210-GCTCT-G 23396063-GCTCT-G P1_gr1 11×CT**
13455816-T-C 11300140-T-C **
22438672-C-A 20276786-C-A FT456300 DYZ19 ****
6305854-A-ACT 6437813-A-ACT IR3_Dst **
13140193-T-C 10629679-T-C **
26354545-G-C 24208398-G-C P1_Y1 **
23114014-AATATAT-A 20952128-AATATAT-A 22×AT**
22476346-T-C 20314460-T-C DYZ19 **
19871485-T-C 17759605-T-C P5_Prx **
58972861-A-G 56826714-A-G **
13386807-G-A 11231131-G-A FTB79366 **
9924365-A-G 10086756-A-G **
9888621-T-C 10051012-T-C **
59004587-G-A 56858440-G-A **
13606877-CAAA-C 11451201-CAAA-C 25×A**
5502023-AG-A 5633982-AG-A **
58976506-ATTCTG-A 56830359-ATTCTG-A **
26314424-C-A 24168277-C-A P1_Y1 **
58976522-C-T 56830375-C-T **
13850305-T-A 11729599-T-A **
14047600-CTT-C 11926894-CTT-C 15×T**
13457919-T-A 11302243-T-A **
13457917-A-G 11302241-A-G **
13457911-C-T 11302235-C-T **
13489696-C-A 11334020-C-A **
22427054-T-C 20265168-T-C DYZ19 **
13850242-G-T 11729536-G-T **
14965443-C-A 12853518-C-A **
16180669-G-A 14068789-G-A **
16046469-C-A 13934589-C-A **
15918458-T-C 13806578-T-C **
15823295-A-C 13711415-A-C **
15657175-GCCA-G 13545295-GCCA-G **
15432044-G-T 13320164-G-T **
15321306-G-T 13209424-G-T **
15238910-C-A 13126996-C-A **
15143519-A-T 13031606-A-T **
14754094-TGAGA-T 12642163-TGAGA-T **
17211167-AT-A 15099287-AT-A **
14704739-T-C 12592805-T-C **
14550667-C-A 12438868-C-A **
14501883-C-A 12390088-C-A **
14367804-G-A 12247100-G-A FT116648 **
14300833-C-A 12180127-C-A **
14218743-GC-G 12098037-GC-G **
14149305-A-C 12028599-A-C **
13873929-A-G 11753223-A-G **
13873921-C-A 11753215-C-A **
18711418-C-A 16599538-C-A **
17929340-A-T 15817460-A-T **
22360556-G-C 20198670-G-C DYZ19 **
21171929-A-G 19010043-A-G **
22360513-C-G 20198627-C-G DYZ19 **
22360507-T-G 20198621-T-G DYZ19 **
13447226-A-C 11291550-A-C **
13489620-C-T 11333944-C-T **
22259400-T-G 20097514-T-G DYZ19 **
22259372-A-G 20097486-A-G DYZ19 **
21416672-C-A 19254786-C-A **
21248517-C-A 19086631-C-A **
21184534-G-A 19022648-G-A **
20622519-C-CAAAA 18460633-C-CAAAA P4_Prx 17×A**
18020348-C-A 15908468-C-A **
20408926-G-T 18247040-G-T P5_Dst **
8389569-C-CT 8521528-C-CT 25×T**
19844780-G-T 17732900-G-T P5_Prx **
19088162-C-A 16976282-C-A **
18905325-C-A 16793445-C-A **
18844267-C-A 16732387-C-A **
18395862-C-T 16283982-C-T P6_Gap **
18385498-C-A 16273618-C-A P6_Gap **
17946917-TTG-T 15835037-TTG-T **
18106603-C-A 15994723-C-A **
13488515-G-T 11332839-G-T **
10747093-G-A **
10669458-C-G **
22836685-C-A 20674799-C-A **
10658566-C-T **
13850301-G-T 11729595-G-T **
11014506-C-A **
21022788-A-AG 18860902-A-AG P4_Dst **
13487734-C-G 11332058-C-G **
13487773-C-T 11332097-C-T **
10689067-C-A **
10689060-A-C **
10689053-C-CACTGT **
10689049-A-T **
10689041-T-C **
22914674-CAAAA-C 20752788-CAAAA-C 27×A**
3165014-G-GTT 3296973-G-GTT 13×T**
11030169-A-T **
4756084-C-A 4888043-C-A **
13705503-A-G 11549827-A-G **
9221653-G-T 9384044-G-T **
23723607-G-T 21561721-G-T BY147129 **
10965582-T-C **
10982521-C-A **
10982518-T-C **
13705499-T-A 11549823-T-A **
22122999-C-A 19961113-C-A **
9398062-C-A 9560453-C-A **
16519316-CAAA-C 14407436-CAAA-C 15×A**
10658377-C-T **
6910-A-C **
20022-G-A **
10965577-T-TGTATTCCATCCTATC **
15477841-C-A 13365961-C-A **
13726003-T-A 11570327-T-A **
10982564-TTCATTCCATTCCATTCTACTTCACT-A **
28805851-T-A 26659704-T-A **
27733770-G-T 25587623-G-T P1_Y2 **
11014482-C-CTCTAA **
10658430-C-T **
10658398-C-CATTAA **
10658388-C-A **
10747118-T-A **
13462253-G-A 11306577-G-A **
10965562-T-C **
10658556-T-C **
10669471-T-C **
19226540-C-A 17114660-C-A **
6775349-C-A 6907308-C-A **
19379621-C-A 17267741-C-A **
10896387-G-C **
10661654-C-A **
13487780-C-T 11332104-C-T **
13487768-C-A 11332092-C-A **
13487762-C-G 11332086-C-G **
13487731-C-T 11332055-C-T **
10988622-T-A **
11003692-C-G **
11003715-C-T **
19990-C-T **
10747056-T-C **
20865487-GTATA-G 18703601-GTATA-G P4_Dst 9×TA**
10831520-G-A **
13487748-A-T 11332072-A-T **
13850316-G-C 11729610-G-C **
13488544-T-C 11332868-T-C **
13487741-C-T 11332065-C-T **
15928702-CAAA-C 13816822-CAAA-C 19×A**
9221660-CATAT-C 9384051-CATAT-C 27×AT**
13487817-G-A 11332141-G-A **
7723948-CTTT-C 7855907-CTTT-C 25×T**
58983182-C-A 56837035-C-A **
6858592-CTTTT-C 6990551-CTTTT-C 25×T**
13697770-A-C 11542094-A-C **
10831532-T-C **
13488606-G-T 11332930-G-T **
21617603-TAC-T 19455717-TAC-T **
16515920-T-C 14404040-T-C Y17550 **
14031754-T-C 11911048-T-C BZ274 **
14031752-C-T 11911046-C-T BZ273 **
13860587-C-A 11739881-C-A **
4976614-T-C 5108573-T-C FGC18671 **
17569226-G-GAA 15457346-G-GAA 25×A**
17030757-A-T 14918877-A-T 24×T**
18688500-C-CAAA 16576620-C-CAAA 20×A**
59004360-G-A 56858213-G-A **
8153866-A-G 8285825-A-G **
10831530-A-C **
10831551-C-A **
19977-G-A **
10985048-T-C **
19915-C-A **
19904-G-T **
10746956-T-TACAAA **
23034416-A-G 20872530-A-G **
10689076-T-G **
10689075-C-T **
7197399-C-CT 7329358-C-CT 12×T**
10673904-A-G **
10673900-T-A **
10673895-T-TTTTGC **
7259146-C-A 7391105-C-A **
10985091-C-T **
10985043-C-T **
10831560-C-T **
10985041-C-T **
10985033-C-G **
10658421-G-T **
22316194-A-T 20154308-A-T DYZ19 **
10965546-G-C **
10965541-C-T **
10965597-T-A **
10965567-T-C **
10896385-A-T **
10831613-T-G **
10831593-T-C **
10831572-A-T **
13697806-C-A 11542130-C-A **
10747005-T-C **
10988631-A-T **
20229558-AC-A 18067672-AC-A P5_Dst **
23825204-C-T 21663318-C-T FTB65032 **
20717073-A-C 18555187-A-C P4_Prx **
22774911-C-A 20613025-C-A **
9537707-TG-T 9700098-TG-T IR3_Prx **
2817936-C-A 2949895-C-A **
10747027-CCAT-C **
10747024-A-ATTT **
12826705-GAAA-G 18×A**
23045411-C-A 20883525-C-A **
56847594-A-T **
10032818-C-A 10195209-C-A **
10988597-TTCC-T **
10988593-TTC-T **
6757051-A-C 6889010-A-C **
7255476-C-A 7387435-C-A **
56847555-C-T **
13488561-G-T 11332885-G-T **
17029243-C-A 14917363-C-A **
16424939-C-T 14313059-C-T **
10747096-G-T **
13488576-TC-T 11332900-TC-T **
28791345-T-A 26645198-T-A **
56847590-C-A **
17370902-C-A 15259022-C-A **
13490665-C-A 11334989-C-A **
13141938-T-C 10631424-T-C 4×TCCAC**
15957603-C-A 13845723-C-A **
3407926-C-A 3539885-C-A **
28791130-A-G 26644983-A-G **
15631938-C-A 13520058-C-A **
8668310-C-A 8800269-C-A **
10658433-C-T **
56847567-C-T **
56847570-A-G **
10658428-C-A **
18747081-C-G 16635201-C-G **
27847763-TG-T 25701616-TG-T P1_Y2 **
18747078-C-A 16635198-C-A **
16092743-C-CT 13980863-C-CT 10×T**
13942350-C-A 11821644-C-A **
10658545-T-C **
9531232-GT-G 9693623-GT-G IR3_Prx **
10658412-C-A **
56847573-A-C **
10658411-C-A **
13725991-G-T 11570315-G-T **
10669465-A-T **
13488539-TC-T 11332863-TC-T **
56847566-A-T **
10747090-A-G **
17143891-ATTT-A 15032011-ATTT-A 35×T**
11003696-T-G **
10925526-T-A **
17079014-C-A 14967134-C-A **
28791134-A-T 26644987-A-T **
7184080-C-A 7316039-C-A **
2688585-C-A 2820544-C-A 19×AT**
7281866-C-A 7413825-C-A **
11003745-C-CTAAACTCCATTCTGT **
14470369-C-A 12349638-C-A **
10925499-C-A **
6514102-C-A 6646061-C-A **
3279949-C-A 3411908-C-A **
10982613-T-G **
10896355-C-G **
11003695-TTCCGTTCCAC-T **
10988629-C-G **
10807259-T-C **
10896359-A-G **
13488571-G-C 11332895-G-C **
9109575-G-T **
11003752-C-CAAGTT **
10934772-C-G **
10747049-A-T **
17071343-AAAGG-A 14959463-AAAGG-A 4×AAGG**
9941491-C-A 10103882-C-A **
13692794-G-C 11537118-G-C **
14229838-C-A 12109132-C-A ***
15848649-A-G 13736769-A-G ***
5272101-G-A 5404060-G-A ***
21922080-CAAA-C,CAAAAA 19760194-CAAA-C,CAAAAA 23×A***
22476452-A-G 20314566-A-G DYZ19 ***
21078604-T-G 18916718-T-G YFC156739 ***
13446542-T-C 11290866-T-C ZS7980 ***
15208845-CAAAAA-C 13096931-CAAAAA-C 23×A***
16908451-TA-T,TAA 14796571-TA-T,TAA 21×A***
28619573-C-CA 26473426-C-CA 16×A***
13450939-TC-T 11295263-TC-T ***
13457939-T-A 11302263-T-A ***
17584130-ATTT-A 15472250-ATTT-A 26×T***
15230842-C-CT 13118928-C-CT 13×T***
17815787-TGAGA-T,TGA 15703907-TGAGA-T,TGA 14×GA***
14356890-CTTTT-C 12236185-CTTTT-C 17×T***
8069959-ATTT-A 8201918-ATTT-A 19×T***
13446531-ATTC-A,ACTC 11290855-ATTC-A,ACTC ***
2747770-T-C 2879729-T-C BY39289 ***
13588777-A-G 11433101-A-G ***
3463851-CA-C 3595810-CA-C 18×A***
14564938-T-A 12453138-T-A ***
6867680-GTT-G,GTTT 6999639-GTT-G,GTTT 18×T***
13930171-C-CA 11809465-C-CA 21×A***
14471469-C-CT 12350738-C-CT 19×T***
14564948-G-A 12453148-G-A ***
22103776-CA-C 19941890-CA-C A6296 10×A***
9913042-A-AT 10075433-A-AT 14×T***
18195154-ATTT-A,ATTTTT 16083274-ATTT-A,ATTTTT 29×T***
6929132-CTTTTTTTT-C,CT 7061091-CTTTTTTTT-C,CT 26×T***
5438997-T-A 5570956-T-A FT323898 ***
19513578-ATTT-A 17401698-ATTT-A 20×T***
4336695-ATTTTTT-A 4468654-ATTTTTT-A 30×T***
4505414-ATTTTTTT-A 4637373-ATTTTTTT-A 22×T***
23364100-A-G 21202214-A-G Z8021 ***
16298533-TA-T 14186653-TA-T ***
16494338-ATG-A 14382458-ATG-A ***
8057169-G-GTA 8189128-G-GTA 12×TA***
15750502-CTT-C 13638622-CTT-C 18×T***
56835857-TCCAATCCGTG-T,TCCAATCCATG ***
14600343-C-A 12488543-C-A ***
18206971-C-A 16095091-C-A ***
56831889-ATTCCATTCCT-A ***
10040392-C-A 10202783-C-A ***
56829273-C-G ***
11009064-T-C ***
15221623-C-T 13109709-C-T ***
14927372-A-G 12815437-A-G ***
13254796-GTT-G,GT 11099120-GTT-G,GT 12×T***
13268727-C-A 11113051-C-A ***
13453830-T-A 11298154-T-A ***
21836738-CTT-C,CT 19674852-CTT-C,CT 15×T***
15495460-CA-C,CAA 13383580-CA-C,CAA 16×A***
8073731-C-A 8205690-C-A ***
2706841-GAAAA-G 2838800-GAAAA-G 16×A***
14432659-C-A 12311932-C-A ***
13458703-C-G 11303027-C-G ***
13458746-C-A 11303070-C-A ***
13467361-C-A 11311685-C-A ***
13476861-G-A 11321185-G-A ***
13476863-T-C 11321187-T-C ***
15677333-G-T 13565453-G-T ***
13481466-A-G 11325790-A-G ***
10987874-C-T ***
15406939-TAAA-T 13295059-TAAA-T 20×A***
10807276-C-T ***
13446544-C-T 11290868-C-T ***
56871650-AT-A ***
19449428-GAAAA-G 17337548-GAAAA-G 23×A***
28791226-TGGAAA-T,TGGAAT 26645079-TGGAAA-T,TGGAAT ***
7636010-TAA-T,TA 7767969-TAA-T,TA 15×A***
13489617-CCACCCCCACCACCACCCACC-C,CCTCTCCCCACACCCACCCCCA 11333941-CCACCCCCACCACCACCCACC-C,CCTCTCCCCACACCCACCCCCA ***
15669932-C-A 13558052-C-A ***
13446578-T-C 11290902-T-C A18103 ***
8030030-TAAA-T 8161989-TAAA-T 26×A***
2960095-G-GA 3092054-G-GA 9×A***
13808743-T-C 11688037-T-C ***
14324894-CTTTTTTTT-C 12204188-CTTTTTTTT-C 26×T***
23024951-G-A 20863065-G-A FT87321 ***
28805866-G-A 26659719-G-A ***
28805865-T-A 26659718-T-A ***
7657068-C-A 7789027-C-A ***
22529421-C-A 20367535-C-A ***
19531117-C-A 17419237-C-A ***
4103357-C-A 4235316-C-A ***
10796639-CTCCATTCCATTCCAT-C ***
16060102-C-A 13948222-C-A ***
17333906-CT-C 15222026-CT-C 10×T***
4841599-C-T 4973558-C-T ***
4968698-G-A 5100657-G-A ***
4968710-A-G 5100669-A-G ***
19431604-C-CA 17319724-C-CA 11×A***
13476892-C-G 11321216-C-G ***
6756908-C-CA 6888867-C-CA 26×A***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 826795938879877540687715601
Kit: 8267951504888094131988331930
Used in age calculations1504888094131988331930
Counts of SNPs3729
Variant counts last updated 2022-07-13 03:00:33.



Big Tree Main Page