Tree Position

R-P312/S116 > Z40481 > ZZ11 > DF27/S250 > Z195/S355 > Z198 > L165/S68 > BY129 > Y5125

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY3
337939
BigY2
337939
56834119-A-ATCCATGCCAC A*
56832505-T-C A*
13449710-A-T 11294034-A-T A*
13451178-C-CACTCT 11295502-C-CACTCT A*
56832466-C-A A*
56833886-A-T A*
56830068-C-T A*
13449080-C-A 11293404-C-A A*
2951810-T-C 3083769-T-C A*
9571868-T-TTG 9734259-T-TTG IR3_Prx 10×TGA*
13489658-C-T 11333982-C-T A*
13449831-C-T 11294155-C-T A*
56833945-C-A A*
25617533-C-T 23471386-C-T P1_gr1 A*A*
56834432-C-T A*
21003227-G-GT 18841341-G-GT P4_Dst 14×TA*
56835588-A-G A*
13450025-C-G 11294349-C-G A*
20893454-C-CA 18731568-C-CA P4_Dst 10×AA*
56833828-T-G A*
21123539-T-TA 18961653-T-TA 13×AA*
13450420-A-G 11294744-A-G A*
19572258-A-G 17460378-A-G P5_Prx YA*
56835386-C-T A*
13479165-G-A 11323489-G-A A*
13450423-C-G 11294747-C-G A*
13489721-A-T 11334045-A-T A*
13450390-A-G 11294714-A-G A*
27708953-A-G 25562806-A-G P1_Y2 A*
25522053-A-G 23375906-A-G P1_gr1 A*
56836537-C-A A*
56831620-C-A A*
58980052-C-T 56833905-C-T A*
19659655-C-T 17547775-C-T P5_Prx A*
59017050-C-T 56870903-C-T A*
13654747-G-A 11499071-G-A BY153364 ++
16765371-T-C 14653491-T-C BY154206 YY++
16288953-A-G 14177073-A-G BY154077 YY++
14976049-C-T 12864124-C-T BY153770 YY++
7018229-T-C 7150188-T-C BY152515 Y++
7610205-G-A 7742164-G-A Y34267 YY++
7822616-T-C 7954575-T-C BY152727 YY++
14442088-G-A 12321361-G-A BY153649 Y++
17833104-C-T 15721224-C-T BY154483 YY++
17970863-T-G 15858983-T-G BY154519 YY++
8808906-G-T 8940865-G-T BY153042 YY++
24475309-C-T 22329162-C-T Y+**
9023046-T-G 9185437-T-G BY153091 Y++
23334054-C-T 21172168-C-T BY155580 YY++
22932200-A-G 20770314-A-G BY155466 YY++
15472415-G-A 13360535-G-A BY153873 YY++
17882577-C-A 15770697-C-A BY154495 YY++
21190198-A-G 19028312-A-G BY154966 YY++
19234077-G-A 17122197-G-A BY154840 YY++
16561863-A-C 14449983-A-C BY154151 YY++
18687429-A-G 16575549-A-G BY154690 YY++
9911974-T-C 10074365-T-C Y+
6576080-T-C 6708039-T-C +
21523107-C-T 19361221-C-T Y+
5848698-C-T 5980657-C-T +
2978500-T-C 3110459-T-C +
22317084-G-C 20155198-G-C DYZ19 ****
5633493-GTC-G 5765452-GTC-G *
21237694-G-GAC 19075808-G-GAC **
19346418-C-T 17234538-C-T YY*
3718831-T-A 3850790-T-A **
28813230-C-G 26667083-C-G *
21112410-T-TAC 18950524-T-TAC 17×AC*
10919484-C-A **
10892472-C-A **
10878473-CT-C **
10869339-C-A **
22511362-A-C 20349476-A-C DYZ19 **
10826549-T-G **
10801704-T-A **
10787232-C-A **
10782473-T-G **
10750470-C-A **
10692266-T-G **
10663355-C-T **
10660842-C-T **
10660830-CATTCT-C **
10660804-C-G **
10813209-C-A **
11017633-C-A **
10971947-C-A **
13902039-G-T 11781333-G-T **
14559303-C-G 12447504-C-G **
14508334-G-A 12396539-G-A **
20648576-G-A 18486690-G-A P4_Prx **
14420223-G-T 12299498-G-T **
14397656-A-C 12276952-A-C **
14339186-C-A 12218481-C-A **
14339094-T-A 12218389-T-A **
14292366-G-T 12171660-G-T **
13995780-C-A 11875074-C-A **
11650117-G-T **
10973394-C-A **
11650062-T-G **
11645856-A-G **
13714355-C-A 11558679-C-A **
20648577-G-GA 18486691-G-GA P4_Prx **
13509187-G-A 11353511-G-A **
13491846-G-A 11336170-G-A **
13421650-T-A 11265974-T-A **
11029597-C-A **
10660757-T-C **
10660765-C-CACTGG **
9953295-G-A 10115686-G-A **
10014773-T-G 10177164-T-G **
5486069-G-A 5618028-G-A **
6687966-C-A 6819925-C-A **
6424798-C-A 6556757-C-A **
6414938-T-A 6546897-T-A **
6384456-A-C 6516415-A-C **
6346208-G-T 6478167-G-T **
6280374-G-T 6412333-G-T IR3_Dst **
6148728-A-AAG 6280687-A-AAG IR3_Dst **
6078133-C-A 6210092-C-A **
5279509-T-C 5411468-T-C **
6773881-C-T 6905840-C-T FGC37659 **
5073623-G-C 5205582-G-C **
5059032-G-T 5190991-G-T **
4968341-C-A 5100300-C-A **
56828614-C-T **
4470716-C-A 4602675-C-A **
4378620-C-G 4510579-C-G **
4353889-C-A 4485848-C-A **
4326512-C-A 4458471-C-A **
4114954-C-A 4246913-C-A **
6773865-G-A 6905824-G-A **
28812230-G-C 26666083-G-C **
22129649-A-G 19967763-A-G **
22510605-T-G 20348719-T-G DYZ19 **
10013823-C-A 10176214-C-A **
9965351-G-T 10127742-G-T **
9571870-G-GTT 9734261-G-GTT IR3_Prx **
9515043-T-G 9677434-T-G **
9498563-C-A 9660954-C-A **
9440455-C-A 9602846-C-A **
9094477-CA-C 9256868-CA-C **
22510576-G-A 20348690-G-A DYZ19 **
8740062-C-A 8872021-C-A **
7045628-C-A 7177587-C-A **
8269945-G-T 8401904-G-T **
25201078-A-G 23054931-A-G g1 **
7758360-T-G 7890319-T-G **
28526177-T-C 26380030-T-C **
7724201-G-T 7856160-G-T **
7384717-T-G 7516676-T-G **
7199342-C-CTTT 7331301-C-CTTT 24×T**
7127802-C-A 7259761-C-A **
7086736-C-A 7218695-C-A **
14700772-CT-C 12588838-CT-C **
15281656-C-A 13169755-C-A **
14715043-G-T 12603110-G-T **
22690050-C-A 20528164-C-A **
24378526-C-A 22232379-C-A **
23953321-G-T 21807174-G-T **
23723685-A-G 21561799-A-G **
23008008-G-T 20846122-G-T **
22965825-C-A 20803939-C-A **
3057361-T-C 3189320-T-C **
22884319-G-C 20722433-G-C **
22854882-G-T 20692996-G-T **
22644606-G-T 20482720-G-T **
24604505-C-G 22458358-C-G P3_t2 **
22623058-C-A 20461172-C-A **
3136013-A-G 3267972-A-G **
22614016-T-C 20452130-T-C **
22341334-T-C 20179448-T-C DYZ19 **
22341309-TGAGTGTTACAGCACTTAAAGG-T 20179423-TGAGTGTTACAGCACTTAAAGG-T DYZ19 **
22090079-C-A 19928193-C-A **
21672046-T-A 19510160-T-A **
21368400-C-T 19206514-C-T **
21208671-G-T 19046785-G-T **
2707058-A-G 2839017-A-G **
25955371-C-G 23809224-C-G P1_Y1 **
21153759-C-A 18991873-C-A **
28043498-A-C 25897351-A-C P1_Y2 **
56876133-A-C **
56850292-C-A **
56846913-C-A **
56747840-T-A **
28761545-G-T 26615398-G-T **
28684866-C-A 26538719-C-A **
28593145-T-G 26446998-T-G **
25557519-C-CTT 23411372-C-CTT P1_gr1 10×T**
27801226-A-AC 25655079-A-AC P1_Y2 **
25955390-C-A 23809243-C-A P1_Y1 **
26465420-G-T 24319273-G-T P1_Y1 **
25955440-C-G 23809293-C-G P1_Y1 **
25955439-G-T 23809292-G-T P1_Y1 **
25955416-T-TCA 23809269-T-TCA P1_Y1 **
25955416-T-C 23809269-T-C P1_Y1 **
25955411-G-T 23809264-G-T P1_Y1 **
25955409-C-A 23809262-C-A P1_Y1 **
25955404-C-G 23809257-C-G P1_Y1 **
25955399-A-C 23809252-A-C P1_Y1 **
4291474-C-T 4423433-C-T **
20979251-G-GTA 18817365-G-GTA P4_Dst **
15081092-G-T 12969182-G-T **
16277652-C-A 14165772-C-A **
10092982-A-G 10255373-A-G **
16636779-C-A 14524899-C-A **
16616895-C-A 14505015-C-A **
16605435-C-A 14493555-C-A **
13457732-A-AGT 11302056-A-AGT **
16500212-G-T 14388332-G-T **
16320966-A-C 14209086-A-C **
13457733-T-TGAA 11302057-T-TGAA **
16102090-A-C 13990210-A-C P8_Prx **
17527394-ATGT-A 15415514-ATGT-A **
16102041-TTG-T 13990161-TTG-T P8_Prx **
16027760-G-T 13915880-G-T **
13487252-G-T 11331576-G-T **
16017740-TC-T 13905860-TC-T **
14658438-G-C 12546503-G-C **
15789747-C-G 13677867-C-G **
14815453-C-T 12703524-C-T **
14919386-C-T 12807451-C-T **
15116576-G-T 13004663-G-T **
17231514-C-A 15119634-C-A **
17622760-A-T 15510880-A-T **
20701214-CTTT-C 18539328-CTTT-C P4_Prx 13×T**
19355704-C-A 17243824-C-A **
20690188-T-G 18528302-T-G P4_Prx **
20521660-G-T 18359774-G-T P5_Dst **
20495599-A-G 18333713-A-G P5_Dst **
20391949-A-AC 18230063-A-AC P5_Dst **
20350453-A-T 18188567-A-T P5_Dst **
20313743-G-T 18151857-G-T P5_Dst **
20311787-A-AGGGGGGG 18149901-A-AGGGGGGG P5_Dst **
19658515-A-AT 17546635-A-AT P5_Prx **
19460386-G-A 17348506-G-A **
19351762-C-A 17239882-C-A **
10069247-T-A 10231638-T-A **
19303965-C-A 17192085-C-A FT51109 **
19303920-C-A 17192040-C-A **
5862545-T-C 5994504-T-C **
19064627-TAA-T 16952747-TAA-T 12×A**
3875868-C-A 4007827-C-A **
18577879-G-T 16465999-G-T **
18429197-A-AAG 16317317-A-AAG P6_Dst **
17991407-T-G 15879527-T-G P7_Prx **
9047498-G-A 9209889-G-A **
4114897-A-C 4246856-A-C **
4608806-G-T 4740765-G-T **
3847367-A-T 3979326-A-T **
10801686-C-A **
21774785-G-GA **
17479032-C-A 15367152-C-A **
14992820-C-A 12880905-C-A **
10803941-C-A **
10801676-C-A **
7201602-A-G 7333561-A-G **
11654376-C-A **
7160894-CTTTT-C 7292853-CTTTT-C 16×T**
10660797-T-A **
11022073-C-A **
15497972-ATTTTT-A 13386092-ATTTTT-A 26×T**
28808632-A-G 26662485-A-G **
56836683-T-A **
10792186-C-A **
6310856-CA-C 6442815-CA-C IR3_Dst **
56848205-C-T **
56848188-G-A **
10824143-A-G **
10660813-C-T **
10660802-T-C **
17991412-A-AC 15879532-A-AC P7_Prx **
28808603-T-A 26662456-T-A **
10677566-C-T **
10803970-C-A **
5219209-C-A 5351168-C-A **
10803943-T-C **
7042709-C-A 7174668-C-A **
10929072-C-A **
10660762-T-C **
18454765-CTT-C 16342885-CTT-C P6_Dst **
5756127-T-G 5888086-T-G **
22816365-TCAAAA-T 20654479-TCAAAA-T **
13810916-A-G 11690210-A-G **
10824173-A-T **
10803971-C-A **
10803967-A-C **
10925676-T-C **
10660761-A-T **
19749310-T-TG 17637430-T-TG P5_Prx **
17090839-ATTTT-A 14978959-ATTTT-A 29×T**
10958333-C-CTGTT **
10986901-C-G **
5977072-G-GTA 6109031-G-GTA 8×TA**
13466128-C-A 11310452-C-A **
13624249-C-A 11468573-C-A **
14074129-C-A 11953423-C-A **
3847364-A-T 3979323-A-T **
19732406-TCAC-T 17620526-TCAC-T P5_Prx **
16007075-C-A 13895195-C-A **
19817539-A-AG 17705659-A-AG P5_Prx **
10783762-A-ACCATTCCATTCCATT **
59023288-A-C 56877141-A-C **
13468209-T-A 11312533-T-A **
22468487-G-T 20306601-G-T DYZ19 **
13486683-T-G 11331007-T-G **
13375826-AT-A 11220150-AT-A 12×T**
14300053-AT-A 12179347-AT-A 10×T**
4389597-CTTT-C 4521556-CTTT-C 15×T**
16987200-C-A 14875320-C-A 11×A**
58862703-C-T 56728168-G-A **
58862697-T-C 56728174-A-G **
20280146-TC-T 18118260-TC-T P5_Dst **
59019861-C-T 56873714-C-T **
19187499-G-A 17075619-G-A **
19325965-C-T 17214085-C-T Z23377 **
9416730-TG-T 9579121-TG-T **
7287808-C-CAT 7419767-C-CAT **
6013034-G-A 6144993-G-A **
22995398-G-T 20833512-G-T **
15430073-G-GTAA 13318193-G-GTAA 10×TAA**
13447119-T-C 11291443-T-C **
13447136-C-G 11291460-C-G **
28791244-G-A 26645097-G-A **
22341305-C-T 20179419-C-T DYZ19 **
25955381-A-G 23809234-A-G P1_Y1 **
10668295-A-C **
16679404-ATTTT-A 14567524-ATTTT-A 18×T**
10677558-A-T **
10693430-C-A **
10958348-C-CCACTG **
20711549-T-TG 18549663-T-TG P4_Prx **
22962008-GTTT-G 20800122-GTTT-G 27×T**
22797585-C-A 20635699-C-A **
13466371-T-C 11310695-T-C **
10986918-A-T **
10986911-C-T **
10677548-A-C **
10880293-A-AATCGT **
10993042-T-C **
10668299-T-C **
10993039-C-G **
10993031-A-ATCCATTTTAT **
10993019-C-A **
10993016-C-T **
10992988-C-CCACAG **
10992980-A-G **
10880304-T-A **
10889291-T-G **
13468253-G-C 11312577-G-C **
13488933-T-C 11333257-T-C **
10924755-C-A **
13565471-G-A 11409795-G-A **
10977127-C-A **
10660822-T-C **
28499324-C-A 26353177-C-A **
13321462-C-A 11165786-C-A **
14312259-C-A 12191553-C-A **
15106706-C-A 12994794-C-A **
7534643-CAAAAAA-C 7666602-CAAAAAA-C 17×A**
15792963-C-A 13681083-C-A **
13457717-A-ATTTCTTTCT 11302041-A-ATTTCTTTCT **
10801666-C-T **
18961429-C-A 16849549-C-A **
16990223-CAAAAAA-C 14878343-CAAAAAA-C 24×A**
5674680-C-A 5806639-C-A **
10824200-T-C **
28742485-C-A 26596338-C-A **
6773883-T-C 6905842-T-C **
6773877-T-C 6905836-T-C **
56848231-C-T **
56848221-A-G **
56848198-A-T **
56848194-T-C **
56848186-C-A **
56848185-C-T **
18434861-GA-G 16322981-GA-G P6_Dst **
25885655-A-C 23739508-A-C P1_Y1 **
10666915-A-T **
56747851-G-T **
3285224-G-T 3417183-G-T **
3847363-C-G 3979322-C-G **
3773245-T-C 3905204-T-C **
3727361-G-T 3859320-G-T **
3697528-C-A 3829487-C-A **
3687930-G-T 3819889-G-T **
3655644-C-A 3787603-C-A **
3639982-C-A 3771941-C-A **
3437268-G-T 3569227-G-T **
3408629-C-A 3540588-C-A **
3293206-G-T 3425165-G-T **
3278669-C-A 3410628-C-A **
10769424-C-A **
2977617-C-A 3109576-C-A **
21371571-C-A 19209685-C-A **
28791229-A-G 26645082-A-G **
17153444-C-A 15041564-C-A **
13953271-C-A 11832565-C-A **
16319944-C-A 14208064-C-A **
22659572-C-A 20497686-C-A **
10868034-C-A **
15733675-C-A 13621795-C-A **
10971000-C-A **
18779268-C-A 16667388-C-A **
9639151-G-T 9801542-G-T IR3_Prx **
56747812-C-A **
13946980-C-A 11826274-C-A **
10658707-C-A **
28808634-G-A 26662487-G-A **
26167734-A-G 24021587-A-G P1_Y1 **
14470565-C-A 12349834-C-A **
20557752-C-A 18395866-C-A P5_Dst **
20107300-A-AT 17995420-A-AT P5_Dst **
11022088-C-A **
5309416-C-A 5441375-C-A **
20432866-AC-A 18270980-AC-A P5_Dst **
11022068-TCTC-A **
10662400-C-A **
10958334-C-CT **
16704451-G-T 14592571-G-T **
16430145-C-A 14318265-C-A **
56747839-A-C **
56747826-A-C **
10940396-C-T **
17380056-C-A 15268176-C-A **
13457731-C-A 11302055-C-A **
13486645-C-A 11330969-C-A **
27499337-AAAAG-A 25353190-AAAAG-A P1_Y2 **
13466366-C-A 11310690-C-A **
10880340-T-C **
10880319-A-ATTCGT **
17859891-C-A 15748011-C-A **
10880318-A-G **
7140796-C-A 7272755-C-A **
28101344-GT-G 25955197-GT-G P1_Y2 **
10988517-T-C **
20107274-G-T 17995394-G-T P5_Dst **
10977222-C-A **
3968645-T-TA 4100604-T-TA 13×A***
13377217-A-G 11221541-A-G ***
6076867-A-C 6208826-A-C ***
13363375-TTC-T 11207699-TTC-T ***
13363356-A-G 11207680-A-G ***
13363362-T-C 11207686-T-C ***
6518926-A-G 6650885-A-G ***
10776104-CCACTCCATTT-C,CCATTCCATTC ***
3949406-C-CA 4081365-C-CA 20×A***
2738763-CTT-C,CTTT 2870722-CTT-C,CTTT 17×T***
16561399-A-T 14449519-A-T ***
13476647-C-T 11320971-C-T ***
22853709-G-T 20691823-G-T ***
56830553-TGCATTC-T ***
10763101-CAATCCATT-C,CAATCCAAT ***
8109742-A-ATAC 8241701-A-ATAC 12×TAC******
56843217-C-T ***
18054002-GT-G 15942122-GT-G 13×T***
23855846-A-G 21693960-A-G ***
28661351-GATCC-G 26515204-GATCC-G 10×ATCC***
13481316-G-A 11325640-G-A ***
3467348-C-A 3599307-C-A ***
14780876-AT-A,ATT 12668946-AT-A,ATT 12×T***
18817052-T-C 16705172-T-C ***
4583115-CTTT-C 4715074-CTTT-C 22×T***
13469250-A-G 11313574-A-G Y24953FGC71426 ***
14565877-G-A 12454077-G-A ***
22231007-A-T 20069121-A-T DYZ19 ***
6046294-GAACTTCTAGAATTAAAAAAAAAATTACTGAAGA-G 6178253-GAACTTCTAGAATTAAAAAAAAAATTACTGAAGA-G ***
13468249-CA-T 11312573-CA-T ***
2774663-CTTTT-C,CTTT 2906622-CTTTT-C,CTTT 18×T***
14195214-C-CA 12074508-C-CA 17×A***
28792467-G-T 26646320-G-T ***
16091048-A-G 13979168-A-G ***
2651883-C-CTT 2783842-C-CTT 19×T***
10657375-C-T ***
16990888-T-TA 14879008-T-TA 11×A***
13489435-C-A 11333759-C-A ***
10974010-T-A ***
13453703-C-A 11298027-C-A ***
3148420-CTT-C,CT 3280379-CTT-C,CT 18×T***
6368767-G-T 6500726-G-T ***
13453454-TATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCC-T,TATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCC 11297778-TATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCC-T,TATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCC 11×ATTCC***
10677540-C-A ***
56848234-C-T ***
10682569-T-TTATCC ***
56830309-A-AAC,T ***
11017702-G-A ***
22468533-G-A 20306647-G-A DYZ19 ***
13489421-GG-C 11333745-GG-C ***
13489428-T-G 11333752-T-G ***
56831601-C-A ***
11036145-AC-A ***
14852784-CT-C 12740850-CT-C 10×T***
23439865-C-A 21277979-C-A ***
3700165-T-C 3832124-T-C ***
3662605-CTATATATA-C 3794564-CTATATATA-C 8×TA***
10978864-AT-A ***
18951697-A-G 16839817-A-G ***
6099384-CAAAA-C 6231343-CAAAA-C 17×A***
13489431-G-A 11333755-G-A ***
16702971-C-A 14591091-C-A ***
13363363-G-A 11207687-G-A ***
7222880-C-A 7354839-C-A ***
3763674-T-TA 3895633-T-TA 10×A***
19346414-C-T 17234534-C-T ***
11013198-T-TATTCC ***
16050938-CTTTCTTTC-C,CTTTCTT 13939058-CTTTCTTTC-C,CTTTCTT ***
17584130-ATT-A,ATTT 15472250-ATT-A,ATTT 26×T***
10978873-A-C ***
4026253-ATT-A 4158212-ATT-A 18×T***
13476467-G-T 11320791-G-T ***
10978887-G-A ***
15919459-G-GT 13807579-G-GT 9×T***
58977557-G-A 56831410-G-A ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 3379391011928282081258062771
Kit: 3379391480391192664028251873
Used in age calculations1480391192664028251873
Counts of SNPs1918
Variant counts last updated 2019-08-26 23:03:45.



Big Tree Main Page