Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > DF21/S192 > FGC3213 > ZZ1 > S3058 > S424 > S426 > S190 > FGC3215 > FGC3216 > Y67231 > FT106560

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFB38
318825-A
BigY3
318825
BigY2
318825
5507738-G-T 5639697-G-T A*
13695091-C-G 11539415-C-G A*
25537463-C-T 23391316-C-T P1_gr1 *A*
13442790-A-T 11287114-A-T A*
20416835-T-A 18254949-T-A P5_Dst ***A*
28805687-G-T 26659540-G-T A*
13451753-C-A 11296077-C-A A*
28817804-A-G 26671657-A-G A*A*
13650586-A-T 11494910-A-T A*
13650607-T-A 11494931-T-A A*
8405349-A-G 8537308-A-G BY72400 YY+++
24205482-ATGTG-A 22059335-ATGTG-A P3_b1 15×TG+
24104128-T-A 21957981-T-A P3_b1 *
56827754-CATTCCATTCCAGTCC-T *
27409678-G-T 25263531-G-T P1_g3 *
25098413-C-T 22952266-C-T g1 *
24918987-C-A 22772840-C-A g1 *
22237163-C-T 20075277-C-T DYZ19 *
22490572-TAA-AAA,AAT 20328686-TAA-AAA,AAT DYZ19 *
27230227-G-A 25084080-G-A P1_g3 *
20650558-ATT-A 18488672-ATT-A P4_Prx 17×T*
26224463-TA-T 24078316-TA-T P1_Y1 *
9340831-AAC-A 9503222-AAC-A 22×AC*
17277481-TCACACA-T,TCA 15165601-TCACACA-T,TCA 20×CA****
22438025-GT-CG 20276139-GT-CG DYZ19 *
22245453-C-T 20083567-C-T DYZ19 *
13479120-ATT-AAT,GTC 11323444-ATT-AAT,GTC *
22315344-T-G 20153458-T-G DYZ19 *
22315353-A-T 20153467-A-T DYZ19 *
22315410-CCTTAGT-GCTTTGC 20153524-CCTTAGT-GCTTTGC DYZ19 *
56837010-GCACTC-CCACTC,CCACTCCACTA *
22996027-AA-AT,T 20834141-AA-AT,T *
16531083-CAAA-C,CAA 14419203-CAAA-C,CAA 24×A*
13479142-ACT-CCC,CCT 11323466-ACT-CCC,CCT *
24224187-C-CA 22078040-C-CA P3_b1 15×A*
10849636-AACACT-A,TCCACT *
13449753-CAACCCCATTCTATTCCATTCT-AAACCCCATTCCATTGCATTCC 11294077-CAACCCCATTCTATTCCATTCT-AAACCCCATTCCATTGCATTCC *
13450590-GCTCCATTCCATTCCATTCCATTCCA-ACTCCATTCCATTCCATTCCATTCTT,ACTCCATTCCATTCCATTCTA 11294914-GCTCCATTCCATTCCATTCCATTCCA-ACTCCATTCCATTCCATTCCATTCTT,ACTCCATTCCATTCCATTCTA *
14078905-A-G 11958199-A-G **
13522910-C-A 11367234-C-A **
13887516-C-T 11766810-C-T **
13887524-A-G 11766818-A-G **
13593816-G-T 11438140-G-T **
13887541-G-A 11766835-G-A **
14274859-A-C 12154153-A-C **
14055029-A-G 11934323-A-G **
14016081-G-T 11895375-G-T **
13602438-G-T 11446762-G-T **
13888451-A-G 11767745-A-G **
11645572-G-T **
21004658-G-T 18842772-G-T P4_Dst **
13887506-T-C 11766800-T-C **
14038014-C-T 11917308-C-T **
14030293-C-A 11909587-C-A **
13818035-A-C 11697329-A-C **
14919328-T-C 12807393-T-C **
14509874-C-A 12398079-C-A **
14274914-T-G 12154208-T-G **
20891057-G-A 18729171-G-A P4_Dst **
15964806-T-G 13852926-T-G **
15803497-C-A 13691617-C-A **
15746542-C-A 13634662-C-A **
15710633-C-A 13598753-C-A **
15483310-T-A 13371430-T-A **
15361216-A-T 13249336-A-T **
15323659-AC-A 13211777-AC-A **
15057423-C-A 12945515-C-A **
14919330-T-C 12807395-T-C **
14886391-C-A 12774457-C-A **
14711434-C-A 12599501-C-A **
14274915-T-A 12154209-T-A **
14696411-G-A 12584477-G-A **
14661691-C-A 12549756-C-A **
14646279-C-A 12534343-C-A **
14627274-AC-A 12515342-AC-A **
14627273-G-T 12515341-G-T **
14563581-C-A 12451781-C-A **
14516362-A-G 12404563-A-G FT22876 **
14500292-A-C 12388497-A-C **
14452202-A-T 12331475-A-T **
14284639-G-A 12163933-G-A **
14274925-T-TC 12154219-T-TC **
13460967-G-C 11305291-G-C **
10952410-C-A **
13233517-C-T 11077841-C-T **
9967471-C-A 10129862-C-A **
10787194-A-T **
10784778-C-A **
10763359-CCACTA-C **
10751182-TC-T **
10751173-C-A **
10751165-A-T **
10748872-C-A **
10679596-A-G **
10674014-C-A **
10667596-C-A **
28021912-TA-T 25875765-TA-T P1_Y2 17×A**
9705508-T-G 9867899-T-G IR3_Prx **
10794480-G-T **
9559523-TGTGC-A 9721914-TGTGC-A IR3_Prx **
9520034-C-A 9682425-C-A **
9215628-A-C 9378019-A-C **
9215600-A-C 9377991-A-C **
9215585-A-C 9377976-A-C **
9126755-G-T **
8849670-C-A 8981629-C-A **
8811104-C-A 8943063-C-A **
8729101-C-A 8861060-C-A **
8699759-A-C 8831718-A-C **
8282313-C-A 8414272-C-A **
8137251-C-A 8269210-C-A **
10793514-C-A **
10796108-A-C **
11019348-C-A **
16016483-A-G 13904603-A-G **
11018764-TTCCACTCCTC-T **
11005064-C-A **
10989222-C-T **
10988982-C-A **
10969375-C-A **
10958464-G-T **
10956620-A-C **
10956606-T-G **
10956576-T-TGAG **
10956561-C-A **
10956553-G-A **
10948930-C-A **
22234924-C-T 20073038-C-T DYZ19 **
10942422-C-G **
10940980-C-G **
10888509-T-C **
10885770-C-A **
10883742-C-G **
10880792-C-G **
10880765-C-CCAA **
10880763-C-CAA **
10868045-ATTCCC-A **
10868016-A-G **
10867991-A-C **
10859964-T-C **
15985376-C-A 13873496-C-A **
17470795-C-A 15358915-C-A **
16071431-C-A 13959551-C-A **
20264152-T-A 18102266-T-A P5_Dst **
16996750-C-A 14884870-C-A **
13476527-TCTCTCA-GCTCTCC 11320851-TCTCTCA-GCTCTCC **
10942723-TTTCT-ATTTG **
18432444-A-G 16320564-A-G P6_Dst **
26907510-AT-A 24761363-AT-A P1_r3 22×T**
20413945-CA-C 18252059-CA-C P5_Dst 22×A**
20199881-CA-C 18037995-CA-C P5_Dst 28×A**
27509349-GA-G 25363202-GA-G P1_Y2 12×A**
56677991-A-T **
27492739-CT-C 25346592-CT-C P1_Y2 13×T**
20989908-CTT-C 18828022-CTT-C P4_Dst 11×T**
36775-A-T **
16996697-G-A 14884817-G-A **
36768-TA-T **
36757-C-G **
28479-T-G **
28766140-C-A 26619993-C-A **
28695700-G-T 26549553-G-T **
28099497-C-A 25953350-C-A P1_Y2 **
27644017-T-G 25497870-T-G P1_Y2 **
27570958-T-C 25424811-T-C P1_Y2 **
25173614-A-G 23027467-A-G g1 **
24392388-G-A 22246241-G-A **
23958576-G-T 21812429-G-T **
3204423-G-A 3336382-G-A **
5883233-A-G 6015192-A-G **
23591007-C-T 21429121-C-T **
13465875-AAAA-TAAC 11310199-AAAA-TAAC **
22488853-T-C 20326967-T-C FGC42207 DYZ19 **
20394410-CTT-C 18232524-CTT-C P5_Dst 26×T**
56828952-GTC-TGT **
23332535-C-T 21170649-C-T **
21968765-A-G 19806879-A-G **
13731611-C-A 11575935-C-A **
13724357-C-A 11568681-C-A **
13716282-G-T 11560606-G-T **
13709505-AGCTCC-GGCGCG 11553829-AGCTCC-GGCGCG **
13696948-T-C 11541272-T-C **
13465892-GGT-TGG 11310216-GGT-TGG **
10089292-G-T 10251683-G-T **
6339121-A-C 6471080-A-C IR3_Dst **
10088649-C-A 10251040-C-A **
6133319-T-G 6265278-T-G **
24252641-A-G 22106494-A-G P3_b1 **
23719054-G-T 21557168-G-T **
9671204-T-C 9833595-T-C IR3_Prx **
23051594-C-A 20889708-C-A *****
20692808-A-T 18530922-A-T P4_Prx **
15118452-TAAAA-T 13006539-TAAAA-T 25×A**
14120309-A-G 11999603-A-G ****
14080041-T-G 11959335-T-G ****
10003253-T-C 10165644-T-C *****
8826512-A-G 8958471-A-G ****
23718762-A-C 21556876-A-C **
23590987-TC-T 21429101-TC-T **
16275441-G-T 14163561-G-T **
8008263-G-A 8140222-G-A **
18425981-C-A 16314101-C-A P6_Gap **
18386559-C-A 16274679-C-A P6_Gap **
18112386-C-A 16000506-C-A FT79662 **
18003886-C-A 15892006-C-A P7_Gap **
17970498-C-A 15858618-C-A **
17779827-T-C 15667947-T-C **
17759206-G-A 15647326-G-A **
17723154-C-A 15611274-C-A **
17714632-C-A 15602752-C-A **
17611091-C-A 15499211-C-A **
17547823-G-A 15435943-G-A **
17355873-T-C 15243993-T-C **
18827971-C-T 16716091-C-T **
17128133-C-A 15016253-C-A **
17112778-C-A 15000898-C-A **
17100452-G-T 14988572-G-T **
16990888-TAA-T 14879008-TAA-T 11×A**
16853629-CT-C 14741749-CT-C 8×T**
16852928-A-G 14741048-A-G **
16793198-G-A 14681318-G-A **
16669269-C-A 14557389-C-A **
16535961-C-A 14424081-C-A **
16486645-C-A 14374765-C-A **
16432103-C-A 14320223-C-A **
18692799-C-A 16580919-C-A **
18859096-C-A 16747216-C-A **
23387577-C-A 21225691-C-A **
21473657-C-A 19311771-C-A **
20413738-C-T 18251852-C-T P5_Dst **
23142043-C-T 20980157-C-T **
23125917-C-A 20964031-C-A **
23092552-G-T 20930666-G-T **
23025228-GCA-G 20863342-GCA-G **
22829595-A-G 20667709-A-G **
22792996-T-A 20631110-T-A **
22734823-C-A 20572937-C-A **
22564113-T-G 20402227-T-G **
22055639-C-A 19893753-C-A **
21984277-C-A 19822391-C-A **
21440787-C-A 19278901-C-A **
18876259-G-T 16764379-G-T **
21177266-G-T 19015380-G-T **
20045233-AAAAAAG-A 17933353-AAAAAAG-A P5_Prx **
19876803-G-T 17764923-G-T P5_Prx **
19876799-G-T 17764919-G-T P5_Prx **
19678607-G-T 17566727-G-T P5_Prx **
19404544-C-A 17292664-C-A **
19260513-C-A 17148633-C-A **
19128324-C-A 17016444-C-A **
19069440-C-A 16957560-C-A **
18937228-G-A 16825348-G-A **
18900572-C-A 16788692-C-A **
18876317-A-G 16764437-A-G **
8077600-GAAC-G 8209559-GAAC-G **
10617739-C-T **
7933676-C-A 8065635-C-A **
3850029-C-A 3981988-C-A **
21084547-G-C 18922661-G-C **
15786090-C-A 13674210-C-A **
18200696-C-A 16088816-C-A **
10834406-C-T **
9117079-C-A 9279470-C-A **
56851408-G-C **
23591011-G-A 21429125-G-A **
7858356-C-A 7990315-C-A **
5625996-C-A 5757955-C-A **
10660994-T-C **
18831708-C-A 16719828-C-A **
7022133-C-A 7154092-C-A 6×TAT**
13311811-C-A 11156135-C-A **
10873312-C-G **
10873305-T-C **
10768105-C-T **
13722069-GGAATA-G 11566393-GGAATA-G **
10873338-C-A **
10873289-G-A **
13725179-C-A 11569503-C-A **
23257740-C-A 21095854-C-A **
11025265-T-C **
10989451-A-C **
11025251-TCC-T **
16037469-C-A 13925589-C-A **
10875816-C-A **
28700764-TACAC-T 26554617-TACAC-T 13×AC**
19104617-G-T 16992737-G-T **
10989160-T-A **
13460964-T-A 11305288-T-A **
22286933-G-A 20125047-G-A BY50913 DYZ19 **
10787153-T-A **
19345117-A-C 17233237-A-C **
10864650-A-T **
13483300-C-A 11327624-C-A **
15382803-TA-T 13270923-TA-T 8×A**
14425195-CAA-C 12304470-CAA-C 15×A****
16825072-C-A 14713192-C-A **
10880770-A-C **
10841951-T-C **
10841942-TCC-T **
22899821-C-A 20737935-C-A **
10830964-T-C **
7252377-C-CAA 7384336-C-CAA 14×A**
10830959-T-C **
9855909-C-A 10018300-C-A **
7177161-T-C 7309120-T-C F62 **
21856386-C-T 19694500-C-T FGC45508 **
58912875-T-C 56677996-A-G **
27316925-G-A 25170778-G-A P1_g3 **
27452587-T-C 25306440-T-C P1_Y2 **
13468197-A-T 11312521-A-T **
27593156-T-C 25447009-T-C P1_Y2 **
21127585-TTA-T 18965699-TTA-T **
13446694-CCATTT-C 11291018-CCATTT-C **
7438085-TC-T 7570044-TC-T **
15882074-C-CA 13770194-C-CA 25×A**
25698890-G-A 23552743-G-A P1_b3 **
27938474-C-CA 25792327-C-CA P1_Y2 **
28015940-A-G 25869793-A-G P1_Y2 **
28022973-A-G 25876826-A-G P1_Y2 **
16432104-C-T 14320224-C-T FT74123 **
22344161-C-A 20182275-C-A DYZ19 **
59000347-GCA-ACT 56854200-GCA-ACT **
21669123-T-A 19507237-T-A FGC1561 Y1908 **
28440440-C-T 26294293-C-T P1_gr2 **
13722009-G-A 11566333-G-A **
27048285-CAAA-C 24902138-CAAA-C P1_r4 37×A**
25698874-CTCAA-ATCAG 23552727-CTCAA-ATCAG P1_b3 **
10830958-A-C **
23590979-A-C 21429093-A-C **
10830953-G-T **
10830939-C-A **
10830929-CTAAAA-C **
10830862-A-G **
10880767-T-C **
10751191-T-C **
25408735-G-T 23262588-G-T P2_r2 **
19931638-AC-A 17819758-AC-A P5_Prx **
28658302-C-A 26512155-C-A **
25588411-T-A 23442264-T-A P1_gr1 **
15254829-T-TA 13142915-T-TA 8×A**
10889538-C-G **
21411718-CAAAAAAAAAA-C 19249832-CAAAAAAAAAA-C 31×A**
10660909-C-T **
10868033-C-T **
13466049-T-C 11310373-T-C **
23317720-CT-C 21155834-CT-C 10×T**
7100954-C-CTT 7232913-C-CTT 32×T**
5430808-CAA-C 5562767-CAA-C 25×A**
13809854-G-A 11689148-G-A **
11025255-TTCC-T **
21988756-C-A 19826870-C-A **
23447359-C-A 21285473-C-A **
23029062-T-C 20867176-T-C **
3951328-C-A 4083287-C-A **
2876772-C-A 3008731-C-A **
2873837-G-T 3005796-G-T **
10889508-T-A **
16524865-C-A 14412985-C-A **
21961575-C-A 19799689-C-A **
23822044-T-C 21660158-T-C **
22619722-G-A 20457836-G-A **
10868020-C-A **
4498707-G-A 4630666-G-A **
23061779-C-T 20899893-C-T BY40842 **
8692057-A-C 8824016-A-C **
23822046-A-G 21660160-A-G **
10989234-C-A **
10912831-G-A **
6401424-C-A 6533383-C-A **
10994382-C-A **
10989229-T-C **
4093942-C-A 4225901-C-A **
4640050-G-T 4772009-G-T **
10889524-C-A **
6972567-C-A 7104526-C-A **
7467974-T-G 7599933-T-G IR1_L **
7467967-T-G 7599926-T-G IR1_L **
7456769-TCCCAG-T 7588728-TCCCAG-T IR1_L **
7437344-AGG-A 7569303-AGG-A **
7391805-C-A 7523764-C-A **
7303992-C-A 7435951-C-A **
7105160-C-A 7237119-C-A **
7015401-C-T 7147360-C-T **
6868946-C-A 7000905-C-A **
4792149-C-T 4924108-C-T **
6861579-C-T 6993538-C-T **
6858618-G-TTT 6990577-G-TTT **
6757648-C-A 6889607-C-A **
10887215-C-A **
6351975-G-T 6483934-G-T **
6095453-C-A 6227412-C-A **
5738597-C-A 5870556-C-A **
5084277-ATT-A 5216236-ATT-A 10×T**
4935505-C-A 5067464-C-A 9×A**
16679099-ATTTTTTTTT-A 14567219-ATTTTTTTTT-A 25×T**
6751569-G-A 6883528-G-A **
8175668-G-T 8307627-G-T **
10954322-A-C **
13433519-C-A 11277843-C-A **
13887517-T-G 11766811-T-G **
23718761-A-C 21556875-A-C **
10806246-T-C **
16284189-C-A 14172309-C-A **
10814262-C-A **
15469293-C-A 13357413-C-A **
13748448-G-A 11592772-G-A **
7401993-C-A 7533952-C-A **
10954317-AC-A **
10889539-T-C **
24021135-GG-C 21874988-GG-C **
10662510-G-T **
13887528-T-C 11766822-T-C **
6401387-C-A 6533346-C-A **
22079825-C-A 19917939-C-A **
22078098-C-A 19916212-C-A **
22263604-A-T 20101718-A-T DYZ19 **
27737963-GT-G 25591816-GT-G P1_Y2 ***
9709854-C-A 9872245-C-A IR3_Prx ***
27868513-A-G 25722366-A-G P1_Y2 ***
22341504-CTG-TGA 20179618-CTG-TGA DYZ19 ***
9694159-A-G 9856550-A-G IR3_Prx ***
16146482-AGAAAG-AG,GAGAAAGA 14034602-AGAAAG-AG,GAGAAAGA P8_Dst ***
9679043-T-C 9841434-T-C IR3_Prx ***
22341486-G-T 20179600-G-T DYZ19 ***
27832713-GC-G 25686566-GC-G P1_Y2 ***
27684713-TACA-AAAA,TAC 25538566-TACA-AAAA,TAC P1_Y2 ***
27722703-A-G 25576556-A-G P1_Y2 ***
27478534-C-A 25332387-C-A P1_Y2 ***
18521767-T-C 16409887-T-C P6_Dst ***
22272460-A-G 20110574-A-G DYZ19 ***
18487640-CAA-C,CAAA 16375760-CAA-C,CAAA P6_Dst 16×A***
18463489-T-C 16351609-T-C P6_Dst ***
18458325-CTTG-TCCTA 16346445-CTTG-TCCTA P6_Dst ***
27475189-C-T 25329042-C-T P1_Y2 ***
22358859-CTTTAAGG-ATTAAAGT,CTTAAAGG 20196973-CTTTAAGG-ATTAAAGT,CTTAAAGG DYZ19 ***
27530198-C-T 25384051-C-T P1_Y2 ***
16155979-G-A 14044099-G-A P8_Dst ***
27530620-A-T 25384473-A-T P1_Y2 ***
27580500-C-CA 25434353-C-CA P1_Y2 ***
22341518-G-T 20179632-G-T DYZ19 ***
27628291-C-T 25482144-C-T P1_Y2 ***
27639665-A-G 25493518-A-G P1_Y2 ***
27639844-A-G 25493697-A-G P1_Y2 ***
16168405-C-G 14056525-C-G P8_Dst ***
16167752-A-T 14055872-A-T P8_Dst ***
22341461-G-T 20179575-G-T DYZ19 ***
27941075-T-G 25794928-T-G P1_Y2 ***
27901563-A-G 25755416-A-G P1_Y2 ***
28345690-TAC-T 26199543-TAC-T P1_gr2 19×AC***
9540865-T-TTG 9703256-T-TTG IR3_Prx ***
28450792-A-C 26304645-A-C P1_gr2 ***
9540873-CCA-C 9703264-CCA-C IR3_Prx ***
22315401-AGC-TGT 20153515-AGC-TGT DYZ19 ***
9553263-G-A 9715654-G-A IR3_Prx ***
9553609-T-C 9716000-T-C IR3_Prx ***
9598492-T-C 9760883-T-C IR3_Prx ***
9613331-T-G 9775722-T-G IR3_Prx ***
22301133-T-C 20139247-T-C DYZ19 ***
28383916-A-G 26237769-A-G P1_gr2 ***
28379762-AAAAAAAC-GAAAAAAAAAA 26233615-AAAAAAAC-GAAAAAAAAAA P1_gr2 ***
28351114-G-A 26204967-G-A P1_gr2 ***
9613991-T-C 9776382-T-C IR3_Prx ***
9621283-G-A 9783674-G-A IR3_Prx ***
28087487-T-C 25941340-T-C P1_Y2 ***
22341451-A-C 20179565-A-C DYZ19 ***
27953368-A-G 25807221-A-G P1_Y2 ***
27910641-A-G 25764494-A-G P1_Y2 ***
9670980-G-T 9833371-G-T IR3_Prx ***
27932014-A-G 25785867-A-G P1_Y2 ***
24528804-A-G 22382657-A-G P3_t2 ***
9634524-T-C 9796915-T-C IR3_Prx ***
27941959-A-G 25795812-A-G P1_Y2 ***
22341439-TTA-GTG 20179553-TTA-GTG DYZ19 ***
28034688-A-G 25888541-A-G P1_Y2 ***
20897313-A-G 18735427-A-G P4_Dst ***
9628440-C-T 9790831-C-T IR3_Prx ***
9626593-T-C 9788984-T-C IR3_Prx ***
22278499-T-A 20116613-T-A DYZ19 ***
9623939-AAAT-A 9786330-AAAT-A IR3_Prx 5×AAT***
28025181-T-A 25879034-T-A P1_Y2 ***
27377520-A-AT 25231373-A-AT P1_g3 ***
20605698-T-G 18443812-T-G P5_Dst ***
19967461-TTT-T,TTA 17855581-TTT-T,TTA P5_Prx ***
20575429-C-A 18413543-C-A P5_Dst ***
20856021-T-C 18694135-T-C P4_Dst ***
20979191-G-A 18817305-G-A P4_Dst ***
20580485-C-T 18418599-C-T P5_Dst ***
22503261-G-C 20341375-G-C DYZ19 ***
20862735-T-A 18700849-T-A P4_Dst ***
20575751-A-G 18413865-A-G P5_Dst ***
20569854-AGC-GGT 18407968-AGC-GGT P5_Dst ***
20985482-TC-T 18823596-TC-T P4_Dst ***
20567560-A-AAT 18405674-A-AAT P5_Dst 9×AT***
20513977-T-C 18352091-T-C P5_Dst ***
20466418-GA-G 18304532-GA-G P5_Dst 11×A***
20879180-A-G 18717294-A-G P4_Dst ***
25432611-CAA-C,CA 23286464-CAA-C,CA P2_r2 26×A***
22226862-A-G 20064976-A-G DYZ19 ***
22512552-G-T 20350666-G-T DYZ19 ***
20589217-C-A 18427331-C-A P5_Dst ***
24612840-ATT-A,AT 22466693-ATT-A,AT P3_t2 16×T***
21189549-GTAA-CCTGTAG 19027663-GTAA-CCTGTAG ***
21189539-GCACA-CT 19027653-GCACA-CT ***
20848154-A-G 18686268-A-G P4_Dst ***
24774556-A-T 22628409-A-T P3_b2 ***
24780478-C-T 22634331-C-T P3_b2 ***
21026018-G-A 18864132-G-A P4_Dst ***
24863942-GA-G 22717795-GA-G IR1_R 12×A***
20852759-G-A 18690873-G-A P4_Dst ***
22972660-GC-TG 20810774-GC-TG ***
21748728-CC-GA ***
21748709-T-C ***
21783197-A-G ***
23181453-CAAA-C,CA 21019567-CAAA-C,CA 34×A***
25224338-T-C 23078191-T-C P2_r1 ***
24635720-C-T 22489573-C-T P3_t2 ***
25445990-AT-A,ATT 23299843-AT-A,ATT P2_r2 17×T***
20429101-C-T 18267215-C-T P5_Dst ***
22239035-TAGG-AAGG,AAGGA 20077149-TAGG-AAGG,AAGGA DYZ19 ***
20249900-G-T 18088014-G-T P5_Dst ***
20323515-G-A 18161629-G-A P5_Dst ***
20312787-CT-C,CTT 18150901-CT-C,CTT P5_Dst 16×T***
26445383-G-A 24299236-G-A P1_Y1 ***
27042181-G-A 24896034-G-A P1_r4 ***
20255326-A-G 18093440-A-G P5_Dst ***
27121471-C-G 24975324-C-G P1_g3 ***
20241142-AT-A,ATT 18079256-AT-A,ATT P5_Dst 18×T***
26369121-T-C 24222974-T-C P1_Y1 ***
24701790-T-C 22555643-T-C P3_b2 ***
27232830-C-T 25086683-C-T P1_g3 ***
20230797-A-G 18068911-A-G P5_Dst ***
20962750-A-G 18800864-A-G P4_Dst ***
20132839-T-C 18020959-T-C P5_Dst ***
20105195-A-G 17993315-A-G P5_Dst ***
26383340-CTT-C,CT 24237193-CTT-C,CT P1_Y1 16×T***
24537661-CATATAT-C 22391514-CATATAT-C P3_t2 ***
25606422-CAA-C 23460275-CAA-C P1_gr1 17×A***
21785209-T-C ***
24600754-C-T 22454607-C-T P3_t2 ***
20413365-GA-G 18251479-GA-G P5_Dst ***
24574811-T-C 22428664-T-C P3_t2 ***
24570718-A-T 22424571-A-T P3_t2 ***
20405544-A-G 18243658-A-G P5_Dst ***
22502986-AGTGTCTT-AGTTTCTG,CGTTTCTT 20341100-AGTGTCTT-AGTTTCTG,CGTTTCTT DYZ19 ***
20393895-CA-AG 18232009-CA-AG P5_Dst ***
24548906-G-A 22402759-G-A P3_t2 ***
22488969-G-C 20327083-G-C DYZ19 ***
22484878-G-A 20322992-G-A DYZ19 ***
25625611-G-A 23479464-G-A P1_b3 ***
25627852-A-G 23481705-A-G P1_b3 ***
20369598-G-A 18207712-G-A P5_Dst ***
24560107-C-T 22413960-C-T P3_t2 ***
25668514-C-G 23522367-C-G P1_b3 ***
27130936-G-T 24984789-G-T P1_g3 ***
22300841-G-A 20138955-G-A DYZ19 ***
27452551-A-G 25306404-A-G P1_Y2 ***
13478411-C-A 11322735-C-A ***
16507619-C-A 14395739-C-A ***
8088173-CAAA-C 8220132-CAAA-C 16×A***
16835693-C-CT 14723813-C-CT 10×T***
22893365-CTTTCT-C,CT 20731479-CTTTCT-C,CT ***
27474262-AT-A 25328115-AT-A P1_Y2 15×T***
23590764-C-CAA 21428878-C-CAA 15×A***
56876445-GA-G 13×A***
10670998-C-T ***
21189531-A-G 19027645-A-G ***
10746965-TTCAAC-T,TTCCAC ***
25200987-GAAGA-G,GAAGG 23054840-GAAGA-G,GAAGG g1 14×AAGA***
13857920-G-A 11737214-G-A ***
22269065-A-C 20107179-A-C DYZ19 ***
28027982-AT-A,ATT 25881835-AT-A,ATT P1_Y2 17×T***
28784667-A-G 26638520-A-G ***
22819279-C-A 20657393-C-A ***
22366847-G-T 20204961-G-T DYZ19 ***
10785244-A-C ***
14918089-TA-T 12806156-TA-T 9×A***
22486541-GCC-CCT 20324655-GCC-CCT DYZ19 ***
8649769-C-A 8781728-C-A ***
16908451-TAA-T,TAAA 14796571-TAA-T,TAAA 21×A***
23997765-C-A 21851618-C-A ***
9531253-AGT-A 9693644-AGT-A IR3_Prx ***
15308468-C-A 13196570-C-A ***
14552150-GA-G,GAA 12440351-GA-G,GAA 11×A***
13227709-C-A 11072033-C-A ***
13453404-C-T 11297728-C-T ***
13453394-C-G 11297718-C-G ***
13465937-G-T 11310261-G-T ***
7210235-CA-C 7342194-CA-C 10×A******
11014032-C-A ***
22341477-T-C 20179591-T-C DYZ19 ***
10685818-A-C ***
10685768-A-C ***
10663236-C-A ***
5022140-C-A 5154099-C-A ***
15040953-T-C 12929043-T-C ***
10929348-G-T ***
19845917-ATT-A 17734037-ATT-A P5_Prx 23×T***
22358805-G-A 20196919-G-A DYZ19 ***
6693292-C-A 6825251-C-A ***
21287545-G-GA 19125659-G-GA 10×A***
22366801-T-G 20204915-T-G DYZ19 ***
16165136-GGA-G 14053256-GGA-G P8_Dst 13×GA***
27561736-G-A 25415589-G-A P1_Y2 ***
22269114-T-C 20107228-T-C DYZ19 ***
3800075-CCA-C 3932034-CCA-C 8×CA***
22344247-G-A 20182361-G-A DYZ19 ***
22344237-A-T 20182351-A-T DYZ19 ***
22443384-G-A 20281498-G-A DYZ19 ***
27233151-G-A 25087004-G-A P1_g3 ***
22255993-T-G 20094107-T-G DYZ19 ***
27994688-TA-T 25848541-TA-T P1_Y2 13×A***
24739651-CT-C 22593504-CT-C P3_b2 13×T***
18012134-AT-A 15900254-AT-A P7_Dst 11×T***
25491429-CA-C 23345282-CA-C P2_r2 19×A***
24773510-GGT-G 22627363-GGT-G P3_b2 8×GT***
22484962-A-T 20323076-A-T DYZ19 ***
18612791-G-A 16500911-G-A Z18090Z18102 GG682 ******
28142885-A-AT 25996738-A-AT P1_b4 11×T***
22239096-G-A 20077210-G-A DYZ19 ***
22479464-T-G 20317578-T-G DYZ19 ***
7411637-GTATA-G 7543596-GTATA-G 9×TA***
6468926-TAAAA-T 6600885-TAAAA-T 28×A***
22260221-C-A 20098335-C-A DYZ19 ***
13474407-T-C 11318731-T-C ***
22489615-G-A 20327729-G-A DYZ19 ***
17426011-CCTTTTCTTTT-C,CCTTTT 15314131-CCTTTTCTTTT-C,CCTTTT 11×CTTTT***
18098741-C-CT 15986861-C-CT 10×T***
22341549-C-A 20179663-C-A DYZ19 ***
13857896-T-A 11737190-T-A ***
28357150-CT-C 26211003-CT-C P1_gr2 15×T***
27004222-CT-C 24858075-CT-C P1_r4 25×T***
22510199-C-G 20348313-C-G BY30214 DYZ19 ***
24597813-CTT-C 22451666-CTT-C P3_t2 22×T***
26556114-C-CA 24409967-C-CA P1_g2 10×A***
22481294-GAC-TAT 20319408-GAC-TAT DYZ19 ***
22481301-C-T 20319415-C-T DYZ19 ***
27155235-CA-C 25009088-CA-C P1_g3 9×A***
6226279-CT-C 6358238-CT-C IR3_Dst 14×T***
21003227-GT-G 18841341-GT-G P4_Dst 14×T***
22260238-T-C 20098352-T-C DYZ19 ***
2707975-GTTTT-G,GTTT 2839934-GTTTT-G,GTTT 18×T***
6731498-C-A 6863457-C-A ***
24033864-C-T 21887717-C-T ***
16169286-T-G 14057406-T-G ***
6944943-CAAA-C,CA 7076902-CAAA-C,CA 28×A***
22506632-G-C 20344746-G-C DYZ19 ***
21134925-ATTT-A,ATT 18973039-ATTT-A,ATT 22×T***
26429820-C-CA 24283673-C-CA P1_Y1 27×A***
10914375-A-G ******
26262595-C-CGT 24116448-C-CGT P1_Y1 ***
24548661-A-C 22402514-A-C P3_t2 ***
5267536-AT-A,ATT 5399495-AT-A,ATT 22×T***
4366473-CT-C 4498432-CT-C ***
9716807-C-CA 9879198-C-CA IR3_Prx 12×A***
24607229-A-AGT 22461082-A-AGT P3_t2 10×GT***
22723386-CAAA-C,CAA 20561500-CAAA-C,CAA 17×A******
21261826-TAAA-T,TAA 19099940-TAAA-T,TAA 26×A***
15940306-CAAA-C,CAA 13828426-CAAA-C,CAA 24×A***
9349520-C-G 9511911-C-G ***
28529913-C-A 26383766-C-A ***
23965777-T-C 21819630-T-C ***
13466925-GTGA-CTGC 11311249-GTGA-CTGC ***
9674757-AT-A 9837148-AT-A IR3_Prx ***
23436749-A-T 21274863-A-T ***
13488779-CGTG-GGTA 11333103-CGTG-GGTA ***
26470765-TAA-T 24324618-TAA-T P1_Y1 25×A***
22508600-TC-AG 20346714-TC-AG DYZ19 ***
22269999-AG-CT 20108113-AG-CT DYZ19 ***
27473926-A-G 25327779-A-G P1_Y2 ***
20573828-CCCCT-C 18411942-CCCCT-C P5_Dst ***
16883255-AA-TT 14771375-AA-TT ***
15733879-CAA-C,CA 13621999-CAA-C,CA 25×A***
13697008-TGGA-AGGG 11541332-TGGA-AGGG ***
13487743-TCCCCACCCCACAACCCCC-ACCCCACCCCACCACCCCA 11332067-TCCCCACCCCACAACCCCC-ACCCCACCCCACCACCCCA ***
9674765-A-G 9837156-A-G IR3_Prx ***
13199164-CA-C,CAA 11043488-CA-C,CAA 18×A***
9968338-TGTT-GT,TG 10130729-TGTT-GT,TG ***
23105663-GC-G 20943777-GC-G ******
22193279-C-A 20031393-C-A ******
22154979-G-T 19993093-G-T ******
16912502-T-C 14800622-T-C ***
15184038-A-G 13072124-A-G ******
13453380-A-T 11297704-A-T ***
23642807-C-A 21480921-C-A ***
23382482-C-A 21220596-C-A ***
6780870-CAAAAA-C 6912829-CAAAAA-C 26×A***
7535597-C-A 7667556-C-A ***
11014075-C-A ***
10867252-C-A ***
10816434-C-A ***
9980763-G-A 10143154-G-A ***
9907246-G-A 10069637-G-A ***
8387925-C-A 8519884-C-A ***
8162255-ATATC-A 8294214-ATATC-A ***
7568765-G-T 7700724-G-T ***
7438075-A-T 7570034-A-T BY65241 10×T***
13567357-GA-G 11411681-GA-G ***
7382576-G-T 7514535-G-T ***
7241633-T-C 7373592-T-C ***
7241629-G-A 7373588-G-A ***
7241627-C-T 7373586-C-T ***
7241622-T-C 7373581-T-C ***
7241621-A-G 7373580-A-G ***
7241620-C-G 7373579-C-G ***
6813021-C-A 6944980-C-A ***
13471906-G-A 11316230-G-A ***
13809541-A-G 11688835-A-G ***
23200532-A-G 21038646-A-G ***
17477247-C-G 15365367-C-G ***
22146215-C-A 19984329-C-A ***
22098383-C-A 19936497-C-A ***
22069039-C-A 19907153-C-A ***
21700074-C-T 19538188-C-T ***
21650287-C-A 19488401-C-A ***
21471870-C-A 19309984-C-A ***
20833370-GA-G,GAA 18671484-GA-G,GAA P4_Gap 12×A***
19152345-A-G 17040465-A-G ***
17192425-C-A 15080545-C-A ***
13809554-G-A 11688848-G-A ***
17050114-TG-G,T 14938234-TG-G,T ***
16528852-C-A 14416972-C-A ***
16260564-C-A 14148684-C-A ***
15842024-C-A 13730144-C-A ***
14747342-C-A 12635411-C-A ***
14530912-GTGTGTGTACATATATGTATGTATTATATATTTATATA-G 12419113-GTGTGTGTACATATATGTATGTATTATATATTTATATA-G ***
14079550-C-A 11958844-C-A ***
13809558-G-GTTATC 11688852-G-GTTATC ***
28456498-T-C 26310351-T-C P1_gr2 ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Haplotype Progression

The data below reveals the progression of changes in the haplotype. The bottom row is the haplotype for this man and above him are the inferred ancestral haplotypes for various upstream blocks. These inferred haplotypes are very much a work in progress, and any suggested modifications are appreciated. I think we can use our vast collection of haplotype data to refine these haplotypes. Mutations made from each upstream block are shown in sequence. The cell color is determined by the block in which the mutation took place.

DYS393
DYS390
DYS19
DYS391
DYS385
DYS426
DYS388
DYS439
DYS389i
DYS392
DYS389ii
DYS458
DYS459
DYS455
DYS454
DYS447
DYS437
DYS448
DYS449
DYS464
DYS460
Y-GATA-H4
YCAII
DYS456
DYS607
DYS576
DYS570
CDY
DYS442
DYS438
DYS531
DYS578
DYF395S1
DYS590
DYS537
DYS641
DYS472
DYF406S1
DYS511
DYS425
DYS413
DYS557
DYS594
DYS436
DYS490
DYS534
DYS450
DYS444
DYS481
DYS520
DYS446
DYS617
DYS568
DYS487
DYS572
DYS640
DYS492
DYS565
DYS710
DYS485
DYS632
DYS495
DYS540
DYS714
DYS716
DYS717
DYS505
DYS556
DYS549
DYS589
DYS522
DYS494
DYS533
DYS636
DYS575
DYS638
DYS462
DYS452
DYS445
Y-GATA-A10
DYS463
DYS441
Y-GGAAT-1B07
DYS525
DYS712
DYS593
DYS650
DYS532
DYS715
DYS504
DYS513
DYS561
DYS552
DYS726
DYS635
DYS587
DYS643
DYS497
DYS510
DYS434
DYS461
DYS435
P312/S1161324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123315916122626191211131210912121011113012132413101020151913241712152412231810141791211
L21/S1451324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
DF21/S1921324141111-14121212131329179-1011112515192915-15-17-17111119-231615181836-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
S30581324141011-14121212131329179-1011112515192915-15-17-17111119-231615181836-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211121211912121011113012132413101020151913241712152412231810141791211
S4261324141011-14121212131329179-1011112515193015-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526191311121211912121011113012132413101020151913231712152412231810141791211
S1901324141011-14121212131329179-1011112515193013-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526201311121211912121011113012132413101020151913231712152412231810141791211
FGC32151324141011-14121212131329189-1011112515193013-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526201311121211912121011113012132413101020151913231712152412231810141791211
Bullen1324141012-14121212131329209-101182515193015-17-17-17111019-231515181838-39131211915-1691010810111222-231710121214811222014121113111112123015915122527201311121211912121011113012132413101019151913231712142412231810141791211

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 318825866348970752377027788
Kit: 3188251500116293871588319104
Kit: 318825-A*16000000100000008300000
Used in age calculations1500116293871588319104
Counts of SNPs22
Variant counts last updated 2020-06-05 03:14:43.

* BED data not available. Using default values.


Big Tree Main Page