Tree Position

R-P312/S116 > Z40481 > ZZ11 > U152/S28 > L2/S139 > Z41150 > DF90 > FGC14641 > S18462 > A11708 > A12311 > BY4244

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY2
259217
6196217-G-A 6328176-G-A IR3_Dst A*
18358468-C-T 16246588-C-T P6_Prx A*
19749841-G-T 17637961-G-T P5_Prx A*
22304424-G-A 20142538-G-A DYZ19 A*
24275110-G-T 22128963-G-T P3_b1 A*
25885129-T-C 23738982-T-C P1_Y1 A*
7532278-A-G 7664237-A-G Y38704BY42715 YY+
16223362-A-T 14111482-A-T L19PF2359 CTS5359 M5181 YY+
4703365-A-G 4835324-A-G BY58283 +
7226126-A-G 7358085-A-G BY64020 YY+
7583719-T-G 7715678-T-G BY66045 YY+
7892401-C-T 8024360-C-T BY68545 YY+
8355482-TG-T 8487441-TG-T +
9025704-C-T 9188095-C-T BY156055 Y+
9446650-A-C 9609041-A-C BY79449 YY+
14705558-C-T 12593624-C-T Y28378 YY+
15719966-A-G 13608086-A-G BY156517 YY+
15984567-C-A 13872687-C-A BY105321 YY+
16316150-C-T 14204270-C-T BY106900 YY+
16801395-G-T 14689515-G-T BY110254 YY+
17368290-C-T 15256410-C-T BY114244 YY+
17602561-A-G 15490681-A-G Y99685 YY+
18046044-G-A 15934164-G-A BY119436 YY+
18090600-C-T 15978720-C-T BY119897 YY+
18109012-T-A 15997132-T-A FTB43177BY120100 YY+
18130175-G-A 16018295-G-A BY120338 YY+
18646571-T-C 16534691-T-C BY122833 YY+
18654300-A-G 16542420-A-G BY122864 YY+
20801614-CTTT-C 18639728-CTTT-C P4_Prx +
21186677-G-C 19024791-G-C BY130961 YY+
21309520-G-A 19147634-G-A S22866 YY+
21426332-G-A 19264446-G-A BY132832 YY+
22446585-A-C 20284699-A-C BY219860 DYZ19 +
23299098-C-T 21137212-C-T BY144426 YY+
23547132-C-A 21385246-C-A BY146142 YY+
23831563-G-C 21669677-G-C BY148141 Y+
17399932-A-ATTAT 15288052-A-ATTAT 8×TTAT*
28799895-C-A 26653748-C-A BY3095 Y34450 5×TGGAA*
18841875-G-GAT 16729995-G-GAT *
28799895-C-CTGGAA 26653748-C-CTGGAA 5×TGGAA*
10026098-C-A 10188489-C-A **
17466983-A-T 15355103-A-T PR2499 **
22457392-G-T 20295506-G-T DYZ19 **
9937747-T-C 10100138-T-C **
19798296-C-A 17686416-C-A P5_Prx **
4389597-CTTTT-C 4521556-CTTTT-C 15×T**
17385445-T-G 15273565-T-G **
7310419-C-A 7442378-C-A **
20332046-T-A 18170160-T-A P5_Dst **
19609552-G-GA 17497672-G-GA P5_Prx 9×A**
19286360-C-A 17174480-C-A **
19206732-C-T 17094852-C-T **
23802082-CA-C 21640196-CA-C 24×A**
22237689-C-A 20075803-C-A DYZ19 **
13724673-G-C 11568997-G-C **
22309919-A-G 20148033-A-G DYZ19 **
15358568-C-A 13246687-C-A **
11020884-C-A **
17735555-C-A 15623675-C-A **
15128121-CTTTT-C 13016208-CTTTT-C 18×T**
22048523-CAA-C 19886637-CAA-C 13×A**
13487744-C-T 11332068-C-T **
14093596-C-A 11972890-C-A **
16648146-A-T 14536266-A-T **
17386774-TAA-T 15274894-TAA-T 15×A**
15816591-A-G 13704711-A-G **
22914672-A-C 20752786-A-C Y78880 **
14485206-G-T 12364475-G-T **
17569071-C-A 15457191-C-A **
14626958-C-A 12515026-C-A **
10807045-T-C **
14539588-C-A 12427789-C-A **
14539591-A-G 12427792-A-G **
14539592-A-G 12427793-A-G **
24671171-T-C 22525024-T-C P3_b2 **
14077848-C-A 11957142-C-A **
10873187-G-C **
11003780-C-A **
8058619-T-A 8190578-T-A **
16531069-G-A 14419189-G-A **
2719088-T-G 2851047-T-G A9943 **
11030243-C-T **
11030251-A-C **
16422525-C-A 14310645-C-A FT122051 **
14458547-G-A 12337820-G-A **
28743095-C-A 26596948-C-A **
17802165-GT-G 15690285-GT-G **
7228899-C-A 7360858-C-A **
22165195-T-C 20003309-T-C **
7436108-T-A 7568067-T-A **
21525140-G-T 19363254-G-T **
10987434-T-C **
10987443-C-A **
10971350-C-A **
10971360-G-C **
14427067-C-A 12306342-C-A **
22936332-A-T 20774446-A-T **
23824896-G-T 21663010-G-T **
21473724-C-A 19311838-C-A **
13472255-G-A 11316579-G-A **
13724712-C-A 11569036-C-A **
14311910-T-A 12191204-T-A **
10896362-C-A **
10896373-C-G **
7264897-C-T 7396856-C-T **
19358084-C-A 17246204-C-A **
10992252-AC-A **
10992255-CCACT-C **
19107403-TAA-T 16995523-TAA-T 14×A**
10760418-T-G **
18984036-AT-A 16872156-AT-A 9×T**
13463774-G-T 11308098-G-T **
16345076-TTCC-T 14233196-TTCC-T 5×TCC**
9671340-T-TC 9833731-T-TC IR3_Prx **
10939001-C-T **
10939006-C-T **
11672679-C-A **
17782766-C-A 15670886-C-A **
2888866-G-C 3020825-G-C **
22654983-C-A 20493097-C-A **
56831282-T-A **
11030204-A-T **
17300734-G-C 15188854-G-C **
22210487-C-A 20048601-C-A **
22268537-T-A 20106651-T-A DYZ19 **
10788499-G-T **
16703815-C-A 14591935-C-A **
56841463-G-T **
10760409-C-G **
10760452-T-C **
10760458-T-C **
11017476-C-A **
5242956-C-A 5374915-C-A **
15410612-C-G 13298732-C-G **
14311921-T-G 12191215-T-G **
22936330-C-T 20774444-C-T **
2817706-C-T 2949665-C-T **
6268767-CAA-C 6400726-CAA-C IR3_Dst 16×A**
5550320-G-T 5682279-G-T **
14776898-T-A 12664967-T-A **
22816363-TC-T 20654477-TC-T **
17385437-T-A 15273557-T-A **
14609823-A-AT 12498025-A-AT **
28484251-C-A 26338104-C-A **
8058609-C-A 8190568-C-A **
22309918-T-G 20148032-T-G DYZ19 **
6644747-A-C 6776706-A-C **
23058582-C-A 20896696-C-A **
14029363-C-A 11908657-C-A **
13937956-C-A 11817250-C-A **
15918485-C-A 13806605-C-A **
18738134-A-T 16626254-A-T **
6402592-C-A 6534551-C-A **
14714776-C-A 12602843-C-A **
13803492-A-G 11682786-A-G **
14776888-G-A 12664957-G-A **
16148183-CTTTT-C 14036303-CTTTT-C P8_Dst 27×T**
13463776-G-AT 11308100-G-AT **
14311928-T-C 12191222-T-C **
18738137-C-T 16626257-C-T **
14901400-C-A 12789467-C-A **
7090682-C-A 7222641-C-A **
17589151-T-C 15477271-T-C **
4937085-C-A 5069044-C-A **
13238299-C-A 11082623-C-A **
56848803-G-C **
14032642-CAAAA-C 11911936-CAAAA-C 14×A**
10852123-T-C **
23052574-T-G 20890688-T-G **
22587928-C-A 20426042-C-A **
24264552-C-A 22118405-C-A P3_b1 **
20535134-T-C 18373248-T-C P5_Dst **
5061090-G-T 5193049-G-T BY58527 **
11030258-C-T **
28812205-G-A 26666058-G-A **
28812214-G-T 26666067-G-T **
28812217-G-A 26666070-G-A **
4316282-G-T 4448241-G-T **
13227840-G-A 11072164-G-A **
6509421-C-A 6641380-C-A **
19839640-A-C 17727760-A-C P5_Prx 5×AAG**
5675533-G-T 5807492-G-T **
10788495-A-C **
17300724-G-A 15188844-G-A **
10948217-G-T **
14097917-C-A 11977211-C-A **
17300735-G-A 15188855-G-A **
17300737-G-T 15188857-G-T **
6603347-CCTTT-C 6735306-CCTTT-C 5×CTTT**
18340587-G-T 16228707-G-T P6_Prx **
7519035-C-A 7650994-C-A **
23339278-G-T 21177392-G-T **
17567340-C-A 15455460-C-A **
26224235-T-A 24078088-T-A P1_Y1 **
21984016-C-A 19822130-C-A **
7916920-C-A 8048879-C-A **
10671146-C-A **
28812271-A-G 26666124-A-G **
7240870-C-A 7372829-C-A **
56848817-T-C **
7101992-A-G 7233951-A-G **
56839273-G-T **
9140168-T-G 9302559-T-G **
3660303-G-T 3792262-G-T **
56879682-G-T **
21583957-C-A 19422071-C-A **
10018026-C-A 10180417-C-A **
10669223-C-A **
28535485-A-G 26389338-A-G **
28535500-A-G 26389353-A-G **
13809373-G-T 11688667-G-T **
22767499-T-A 20605613-T-A **
14047708-C-A 11927002-C-A **
7109308-C-A 7241267-C-A **
18484043-T-TC 16372163-T-TC P6_Dst **
7456740-T-A 7588699-T-A IR1_L **
23256379-C-A 21094493-C-A **
23262553-C-A 21100667-C-A **
18911005-C-A 16799125-C-A **
16487986-C-A 14376106-C-A **
28812330-G-T 26666183-G-T **
4078683-G-T 4210642-G-T **
10898944-C-TGACTT **
10692145-C-A **
10785239-A-G **
5220376-C-G 5352335-C-G **
5220380-A-G 5352339-A-G **
3681424-G-T 3813383-G-T **
5688422-C-A 5820381-C-A **
28535607-C-A 26389460-C-A **
23623278-C-A 21461392-C-A **
23848822-G-T 21686936-G-T **
14053572-C-A 11932866-C-A **
10852128-C-A **
56724862-T-C **
2839984-C-A 2971943-C-A **
10693612-C-A **
18035979-C-A 15924099-C-A **
56848879-C-A **
13255859-C-A 11100183-C-A **
10790231-C-A **
21589697-C-A 19427811-C-A **
2758824-C-A 2890783-C-A **
9927336-C-A 10089727-C-A **
10763113-T-TTCCAC **
10763126-C-CACTTG **
8854121-C-A 8986080-C-A **
14614558-C-A 12502756-C-A **
2836402-A-G 2968361-A-G **
11018285-T-C **
14316315-C-A 12195609-C-A **
21959206-C-A 19797320-C-A FT199611 **
15995149-C-A 13883269-C-A **
14485276-G-T 12364545-G-T **
19791366-C-A 17679486-C-A P5_Prx **
21162432-G-T 19000546-G-T **
16056072-A-G 13944192-A-G FT81976 **
18682816-C-A 16570936-C-A **
28812304-T-A 26666157-T-A **
2671633-C-T 2803592-C-T **
2671641-C-T 2803600-C-T **
2701156-G-A 2833115-G-A **
2701166-T-C 2833125-T-C **
2708470-G-A 2840429-G-A **
2740466-A-C 2872425-A-C **
2793107-C-A 2925066-C-A **
2793112-T-C 2925071-T-C **
2884196-G-T 3016155-G-T **
2900795-TTTG-T 3032754-TTTG-T **
3016814-G-C 3148773-G-C **
3120270-GA-G 3252229-GA-G **
3250531-A-T 3382490-A-T **
3267763-C-A 3399722-C-A **
3343331-T-C 3475290-T-C **
3366571-G-A 3498530-G-A **
3435847-C-G 3567806-C-G **
3500555-C-A 3632514-C-A **
3649102-C-A 3781061-C-A **
3688555-C-A 3820514-C-A **
3766132-G-T 3898091-G-T **
3805254-T-G 3937213-T-G **
3805264-T-A 3937223-T-A **
3987760-C-A 4119719-C-A **
4261731-T-G 4393690-T-G **
4302607-A-G 4434566-A-G **
4592108-G-T 4724067-G-T **
4604425-G-T 4736384-G-T **
4615227-C-A 4747186-C-A **
4646074-G-T 4778033-G-T **
4679737-A-G 4811696-A-G **
4891253-G-T 5023212-G-T **
4898463-A-G 5030422-A-G **
4900907-G-T 5032866-G-T **
4969208-A-T 5101167-A-T **
5000475-T-A 5132434-T-A **
5000570-G-T 5132529-G-T **
5018244-T-G 5150203-T-G **
5084306-T-A 5216265-T-A **
5084316-T-G 5216275-T-G **
5188396-A-G 5320355-A-G **
5200651-G-C 5332610-G-C **
5200661-A-C 5332620-A-C **
5204539-C-G 5336498-C-G **
5219801-C-A 5351760-C-A **
5219886-T-G 5351845-T-G **
5351340-AGTGTAG-A 5483299-AGTGTAG-A **
5444103-A-G 5576062-A-G **
5449281-A-T 5581240-A-T **
5506199-C-T 5638158-C-T **
5520484-TA-T 5652443-TA-T **
5576785-T-A 5708744-T-A **
5609647-T-G 5741606-T-G **
5635297-G-T 5767256-G-T **
5679241-C-A 5811200-C-A **
5774970-A-T 5906929-A-T **
5774980-A-T 5906939-A-T **
5784294-G-T 5916253-G-T **
5815142-G-T 5947101-G-T **
5844359-C-A 5976318-C-A **
5990684-G-T 6122643-G-T **
6109331-T-C 6241290-T-C **
6136544-G-C 6268503-G-C **
6150034-T-G 6281993-T-G IR3_Dst **
6150044-T-A 6282003-T-A IR3_Dst **
6182602-G-T 6314561-G-T IR3_Dst **
6182619-T-G 6314578-T-G IR3_Dst **
6182624-G-T 6314583-G-T IR3_Dst **
6296342-C-A 6428301-C-A IR3_Dst **
6296360-C-A 6428319-C-A IR3_Dst **
6296373-C-A 6428332-C-A IR3_Dst **
6316016-T-A 6447975-T-A IR3_Dst **
6355914-G-T 6487873-G-T **
6359146-T-A 6491105-T-A **
6369017-G-T 6500976-G-T **
6401598-T-C 6533557-T-C **
6444969-C-T 6576928-C-T **
6516898-T-A 6648857-T-A **
6642276-T-G 6774235-T-G **
6642286-C-G 6774245-C-G **
6826927-T-A 6958886-T-A **
6882030-TG-T 7013989-TG-T **
6922678-C-A 7054637-C-A **
6925589-T-C 7057548-T-C **
6926687-T-A 7058646-T-A **
6929591-T-A 7061550-T-A **
6948553-T-G 7080512-T-G **
7019159-C-A 7151118-C-A **
7021787-C-A 7153746-C-A **
7033635-C-A 7165594-C-A **
7042850-C-T 7174809-C-T **
7099342-T-C 7231301-T-C **
7123653-C-A 7255612-C-A **
7142452-C-A 7274411-C-A **
7166480-C-A 7298439-C-A **
7172576-G-T 7304535-G-T **
7196527-T-C 7328486-T-C **
7222295-A-G 7354254-A-G **
7242618-A-G 7374577-A-G **
7243271-C-A 7375230-C-A **
7256167-G-T 7388126-G-T **
7286756-C-A 7418715-C-A **
7315762-T-C 7447721-T-C **
7338395-T-G 7470354-T-G **
7363199-C-G 7495158-C-G **
7383830-C-A 7515789-C-A FT226242 **
7396391-A-C 7528350-A-C **
7418621-G-T 7550580-G-T **
7422249-G-C 7554208-G-C **
7422259-C-A 7554218-C-A **
7433541-C-T 7565500-C-T **
7445229-C-A 7577188-C-A **
7820907-A-C 7952866-A-C **
7820916-G-C 7952875-G-C **
7820921-T-A 7952880-T-A **
7820925-A-T 7952884-A-T **
7820938-C-T 7952897-C-T **
7820947-T-C 7952906-T-C **
7820966-A-T 7952925-A-T **
7820975-C-T 7952934-C-T **
7820978-T-C 7952937-T-C **
7821008-T-A 7952967-T-A **
7832363-T-C 7964322-T-C **
7832364-A-G 7964323-A-G **
7832368-T-C 7964327-T-C **
7832369-G-T 7964328-G-T **
8058597-A-C 8190556-A-C **
8058602-A-T 8190561-A-T **
8109945-C-A 8241904-C-A **
8119095-C-A 8251054-C-A **
8153987-C-A 8285946-C-A **
8230265-C-A 8362224-C-A **
8677964-C-A 8809923-C-A **
8712089-G-A 8844048-G-A **
8897221-C-A 9029180-C-A **
9113701-G-T **
8987275-A-G 9149666-A-G **
9140088-C-G 9302479-C-G **
9430009-A-C 9592400-A-C **
9440266-C-T 9602657-C-T FT20401 **
9440276-G-C 9602667-G-C **
9456688-C-G 9619079-C-G **
9508395-C-A 9670786-C-A BY80042 **
9576285-T-G 9738676-T-G IR3_Prx **
9576299-A-G 9738690-A-G IR3_Prx **
9576307-C-T 9738698-C-T IR3_Prx **
9576314-G-T 9738705-G-T IR3_Prx **
9576335-T-G 9738726-T-G IR3_Prx **
9697255-G-A 9859646-G-A IR3_Prx **
9822653-C-T 9985044-C-T **
9912905-A-C 10075296-A-C **
9927301-G-A 10089692-G-A **
9944721-G-A 10107112-G-A **
9965007-A-C 10127398-A-C **
9980470-T-A 10142861-T-A **
9983167-G-C 10145558-G-C **
10018372-TAGG-T 10180763-TAGG-T **
10019822-C-T 10182213-C-T FT376348 **
10060793-A-T 10223184-A-T **
10657033-T-C **
10657162-T-G **
10666501-TC-T **
10751124-C-A **
10756374-T-C **
10756375-C-T **
10757238-C-A **
10759827-CT-C **
10759830-C-CGGATTT **
10764445-G-T **
10772595-C-A **
10773951-A-G **
10774041-A-T FT393148 **
10782336-T-G **
10782359-C-G **
10785238-C-A **
10788486-T-A **
10788489-T-C **
10788509-T-TCCA **
10790325-A-C **
10798948-A-T **
10799043-G-T **
10812982-G-A **
10820756-T-A **
10820780-A-G **
10820806-G-A FT432654 **
10825285-C-GG **
10825289-CC-A **
10825327-A-T **
10835582-C-A **
10841969-C-CATTCG **
10857580-A-C **
10870556-C-A **
10925502-TC-T **
10960809-C-A **
10965272-T-C **
10973277-C-T **
10973719-C-G **
10990894-C-A **
10997671-C-A **
11009868-C-T **
11012272-C-G **
11012277-C-T **
11012308-C-CGGAAG **
11012322-C-G **
11018269-A-T **
11018274-A-G **
13195856-C-A 11040180-C-A **
13213952-G-A 11058276-G-A **
13218663-A-C 11062987-A-C **
13233478-G-T 11077802-G-T **
13252591-T-A 11096915-T-A **
13302336-A-T 11146660-A-T **
13302491-C-A 11146815-C-A **
13302501-G-A 11146825-G-A **
13313583-T-G 11157907-T-G **
13325416-A-G 11169740-A-G **
13331320-T-C 11175644-T-C **
13472061-T-C 11316385-T-C **
13474401-C-A 11318725-C-A **
13480133-A-C 11324457-A-C **
13550756-T-A 11395080-T-A **
13584809-T-C 11429133-T-C **
13644152-C-A 11488476-C-A **
13707382-G-C 11551706-G-C **
13724680-G-A 11569004-G-A **
13724682-G-A 11569006-G-A **
13724709-T-G 11569033-T-G **
13724711-T-G 11569035-T-G **
11643294-G-T **
11650506-G-A **
11668319-G-T **
11668654-A-G **
11669231-G-A **
13800623-C-A 11679917-C-A **
13858227-A-T 11737521-A-T **
13871317-T-A 11750611-T-A **
13884115-C-G 11763409-C-G **
13891037-A-G 11770331-A-G **
13898474-G-A 11777768-G-A **
13934366-G-T 11813660-G-T **
13961351-T-C 11840645-T-C **
13973928-C-A 11853222-C-A **
13988969-A-G 11868263-A-G **
13997569-T-G 11876863-T-G **
14011281-A-T 11890575-A-T **
14047725-G-A 11927019-G-A **
14077883-C-A 11957177-C-A **
14098794-C-G 11978088-C-G **
14194805-ACTATC-A 12074099-ACTATC-A **
14297371-T-A 12176665-T-A **
14311914-C-T 12191208-C-T **
14352097-A-C 12231392-A-C **
14511928-A-G 12400133-A-G **
14513405-A-G 12401610-A-G **
14519559-C-T 12407760-C-T **
14711398-T-C 12599465-T-C **
14743875-A-G 12631944-A-G **
14901410-C-CAA 12789477-C-CAA **
14933470-A-G 12821535-A-G **
15111436-C-A 12999523-C-A **
15122337-C-A 13010424-C-A **
15179226-T-C 13067312-T-C **
15198630-A-G 13086716-A-G **
15230571-C-A 13118657-C-A **
15276346-C-A 13164435-C-A **
15323505-T-C 13211623-T-C **
15324160-A-G 13212278-A-G **
15332274-T-C 13220392-T-C **
15397843-G-T 13285963-G-T **
15475308-C-A 13363428-C-A **
15575080-C-A 13463200-C-A **
15605460-A-C 13493580-A-C **
15605470-G-A 13493590-G-A **
15657941-G-T 13546061-G-T **
15707068-T-G 13595188-T-G **
15745719-G-T 13633839-G-T **
15778595-G-A 13666715-G-A **
15791358-C-A 13679478-C-A **
15792786-C-A 13680906-C-A **
15823580-G-T 13711700-G-T **
15860091-G-A 13748211-G-A FT234225 **
15860093-A-G 13748213-A-G **
15860102-T-C 13748222-T-C **
15898811-C-A 13786931-C-A **
15919445-C-A 13807565-C-A **
15939151-C-A 13827271-C-A **
16016298-T-G 13904418-T-G **
16058946-C-T 13947066-C-T **
16122853-G-T 14010973-G-T P8_Prx **
16122866-G-T 14010986-G-T P8_Prx **
16122884-G-T 14011004-G-T P8_Prx **
16122892-G-T 14011012-G-T P8_Prx **
16122917-G-T 14011037-G-T P8_Prx **
16145212-A-AT 14033332-A-AT P8_Dst **
16243165-C-A 14131285-C-A **
16270392-C-A 14158512-C-A **
16277302-G-T 14165422-G-T **
16412354-C-A 14300474-C-A **
16412501-GA-G 14300621-GA-G **
16437326-C-A 14325446-C-A **
16457270-C-A 14345390-C-A **
16619374-T-G 14507494-T-G **
16619547-G-T 14507667-G-T **
16653049-A-T 14541169-A-T **
16689983-A-G 14578103-A-G **
16868530-A-T 14756650-A-T **
17013215-C-A 14901335-C-A **
17038583-AGTAG-A 14926703-AGTAG-A **
17066070-G-T 14954190-G-T **
17098916-T-C 14987036-T-C **
17103890-G-T 14992010-G-T **
17165486-C-A 15053606-C-A **
17277447-G-T 15165567-G-T **
17300731-A-T 15188851-A-T **
17302109-C-A 15190229-C-A **
17338528-G-T 15226648-G-T FTB32455 **
17367946-C-A 15256066-C-A **
17372032-G-C 15260152-G-C **
17379927-C-G 15268047-C-G **
17426254-A-G 15314374-A-G **
17427004-C-A 15315124-C-A **
17444792-C-A 15332912-C-A **
17464785-A-G 15352905-A-G **
17467014-T-C 15355134-T-C **
17486404-C-A 15374524-C-A **
17515430-A-C 15403550-A-C **
17518566-C-A 15406686-C-A **
17575207-C-A 15463327-C-A **
17576190-G-T 15464310-G-T **
17580773-T-C 15468893-T-C **
17644405-C-A 15532525-C-A **
17826378-T-A 15714498-T-A **
17903037-A-C 15791157-A-C **
17920975-A-AT 15809095-A-AT **
18089008-A-G 15977128-A-G **
18156231-C-G 16044351-C-G **
18157061-G-T 16045181-G-T **
18159208-A-C 16047328-A-C **
18189584-C-A 16077704-C-A **
18195258-C-A 16083378-C-A **
18226424-A-C 16114544-A-C **
18226434-C-A 16114554-C-A **
18255866-G-T 16143986-G-T **
18338356-G-T 16226476-G-T P6_Prx **
18365555-GTGT-G 16253675-GTGT-G P6_Prx **
18382103-T-C 16270223-T-C P6_Gap **
18401080-T-C 16289200-T-C P6_Gap **
18480393-G-T 16368513-G-T P6_Dst **
18621645-C-A 16509765-C-A **
18628170-A-G 16516290-A-G **
18630645-G-C 16518765-G-C **
18731003-C-A 16619123-C-A **
18738274-C-A 16626394-C-A **
18748759-C-A 16636879-C-A **
18780266-G-A 16668386-G-A **
18872909-C-A 16761029-C-A **
18902397-G-T 16790517-G-T **
18925010-CA-C 16813130-CA-C **
18964066-G-A 16852186-G-A **
19043189-C-G 16931309-C-G **
19055504-G-T 16943624-G-T **
19056251-A-G 16944371-A-G **
19058101-C-A 16946221-C-A **
19126270-C-A 17014390-C-A **
19127691-C-A 17015811-C-A **
19145573-AT-A 17033693-AT-A **
19172946-C-A 17061066-C-A **
19184565-C-A 17072685-C-A **
19255425-A-T 17143545-A-T **
19256281-C-A 17144401-C-A **
19312847-T-C 17200967-T-C F23564 **
19351392-C-G 17239512-C-G **
19379600-A-G 17267720-A-G **
19437956-A-C 17326076-A-C **
19501565-C-A 17389685-C-A **
19504074-C-T 17392194-C-T **
19507221-C-A 17395341-C-A **
19535646-T-C 17423766-T-C **
19645806-A-C 17533926-A-C P5_Prx **
19709279-A-C 17597399-A-C P5_Prx **
19709281-A-C 17597401-A-C P5_Prx **
19709282-G-A 17597402-G-A P5_Prx **
19709310-G-T 17597430-G-T P5_Prx **
19709318-G-T 17597438-G-T P5_Prx **
19709328-G-T 17597448-G-T P5_Prx **
19753224-G-A 17641344-G-A P5_Prx **
19775744-A-G 17663864-A-G P5_Prx **
19798340-C-A 17686460-C-A P5_Prx **
19798355-C-A 17686475-C-A P5_Prx **
19798356-C-A 17686476-C-A P5_Prx **
19832465-A-C 17720585-A-C P5_Prx **
19832466-A-C 17720586-A-C P5_Prx **
19832467-T-A 17720587-T-A P5_Prx **
19832470-A-G 17720590-A-G P5_Prx **
19832532-T-G 17720652-T-G P5_Prx **
19845893-G-T 17734013-G-T P5_Prx **
19854331-C-A 17742451-C-A P5_Prx **
19854343-C-A 17742463-C-A P5_Prx **
19854358-C-A 17742478-C-A P5_Prx **
19854380-C-A 17742500-C-A P5_Prx **
19854381-C-A 17742501-C-A P5_Prx **
19854382-C-T 17742502-C-T P5_Prx **
19854391-C-A 17742511-C-A P5_Prx **
19904353-T-C 17792473-T-C P5_Prx **
19904364-G-C 17792484-G-C P5_Prx **
19904376-G-C 17792496-G-C P5_Prx **
20242479-TGGG-T 18080593-TGGG-T P5_Dst 12×G**
20306031-T-C 18144145-T-C P5_Dst **
20497361-C-A 18335475-C-A P5_Dst **
20533378-TA-T 18371492-TA-T P5_Dst **
20615161-A-G 18453275-A-G P4_Prx **
20657774-A-C 18495888-A-C P4_Prx **
20660782-C-A 18498896-C-A P4_Prx **
20660799-C-A 18498913-C-A P4_Prx **
20660811-C-A 18498925-C-A P4_Prx **
20660829-G-T 18498943-G-T P4_Prx **
20660843-C-A 18498957-C-A P4_Prx **
20668761-G-C 18506875-G-C P4_Prx **
20700740-C-A 18538854-C-A P4_Prx **
20734566-C-T 18572680-C-T P4_Prx **
21002439-C-G 18840553-C-G P4_Dst **
21002452-A-G 18840566-A-G P4_Dst **
21002472-G-A 18840586-G-A P4_Dst **
21002512-C-G 18840626-C-G P4_Dst **
21002522-C-T 18840636-C-T P4_Dst **
21002526-C-A 18840640-C-A P4_Dst **
21002540-T-G 18840654-T-G P4_Dst **
21037308-T-G 18875422-T-G **
21037318-C-T 18875432-C-T **
21121236-C-T 18959350-C-T **
21162429-G-T 19000543-G-T **
21167344-C-A 19005458-C-A **
21211364-C-T 19049478-C-T FT48233 **
21211393-C-A 19049507-C-A **
21240720-G-T 19078834-G-T FT2148 **
21240730-A-G 19078844-A-G **
21262795-T-G 19100909-T-G **
21296907-G-T 19135021-G-T **
21297886-C-T 19136000-C-T **
21302453-C-G 19140567-C-G **
21325798-C-A 19163912-C-A **
21382490-G-C 19220604-G-C **
21383445-A-G 19221559-A-G **
21386391-C-A 19224505-C-A **
21393940-A-G 19232054-A-G **
21393949-G-A 19232063-G-A **
21407903-G-T 19246017-G-T **
21410169-C-A 19248283-C-A **
21455485-G-C 19293599-G-C **
21554079-G-T 19392193-G-T **
21614686-C-A 19452800-C-A **
21627110-T-C 19465224-T-C **
21747616-T-C 19585730-T-C **
21772509-C-A 19610623-C-A **
21819062-A-G 19657176-A-G **
21819083-C-T 19657197-C-T **
21819729-C-A 19657843-C-A **
21823455-G-T 19661569-G-T **
21823456-A-T 19661570-A-T **
21823465-T-G 19661579-T-G **
21823468-G-T 19661582-G-T **
21823482-G-T 19661596-G-T **
21853611-G-A 19691725-G-A **
21949037-T-G 19787151-T-G **
21955462-G-T 19793576-G-T **
21983968-A-C 19822082-A-C **
22055383-T-G 19893497-T-G **
22081049-A-G 19919163-A-G **
22090078-T-A 19928192-T-A **
22199418-G-T 20037532-G-T **
22202462-C-T 20040576-C-T **
22204935-G-T 20043049-G-T **
22205582-C-A 20043696-C-A **
22209317-A-C 20047431-A-C **
22209327-T-C 20047441-T-C **
22268543-G-GT 20106657-G-GT DYZ19 **
22292085-G-T 20130199-G-T DYZ19 **
22485259-T-C 20323373-T-C DYZ19 **
22545410-C-A 20383524-C-A **
22564519-C-A 20402633-C-A **
22564527-CT-C 20402641-CT-C **
22590815-T-C 20428929-T-C **
22611292-G-C 20449406-G-C **
22768198-C-A 20606312-C-A **
22874399-G-A 20712513-G-A **
22882205-A-G 20720319-A-G **
22882215-T-G 20720329-T-G **
22919412-T-C 20757526-T-C **
22951856-C-A 20789970-C-A **
22963505-C-A 20801619-C-A **
22965437-A-C 20803551-A-C **
22965447-A-T 20803561-A-T **
22993546-G-A 20831660-G-A **
23079237-C-A 20917351-C-A **
23104190-A-C 20942304-A-C **
23196234-G-T 21034348-G-T **
23204896-C-T 21043010-C-T **
23332198-C-A 21170312-C-A **
23339465-G-T 21177579-G-T **
23377301-C-A 21215415-C-A **
23792378-A-G 21630492-A-G **
23802075-T-C 21640189-T-C **
23802131-T-G 21640245-T-G **
23883220-C-A 21721334-C-A **
23883236-C-A 21721350-C-A **
23883237-C-A 21721351-C-A **
23883251-C-A 21721365-C-A **
23883279-A-C 21721393-A-C **
23883291-A-C 21721405-A-C **
23965775-G-C 21819628-G-C **
24069921-C-A 21923774-C-A P3_b1 **
24205550-A-G 22059403-A-G P3_b1 **
24269586-C-T 22123439-C-T P3_b1 **
24269606-A-T 22123459-A-T P3_b1 **
24296471-G-C 22150324-G-C P3_t1 **
24296490-A-G 22150343-A-G P3_t1 **
24296508-C-A 22150361-C-A P3_t1 **
24350035-C-A 22203888-C-A P3_t1 **
24350048-C-G 22203901-C-G P3_t1 **
24350065-T-G 22203918-T-G P3_t1 **
24350077-T-G 22203930-T-G P3_t1 **
24350088-A-G 22203941-A-G P3_t1 **
24350097-T-G 22203950-T-G P3_t1 **
24350108-A-G 22203961-A-G P3_t1 **
24415718-TTA-T 22269571-TTA-T 31×TA**
24416798-G-T 22270651-G-T **
24421849-C-A 22275702-C-A **
24961181-CTG-C 22815034-CTG-C g1 **
25866660-A-T 23720513-A-T P1_Y1 **
25866670-T-C 23720523-T-C P1_Y1 **
25874366-A-C 23728219-A-C P1_Y1 **
25894262-G-A 23748115-G-A P1_Y1 **
26015665-C-A 23869518-C-A P1_Y1 **
26015666-C-A 23869519-C-A P1_Y1 **
26015669-C-A 23869522-C-A P1_Y1 **
26015678-C-A 23869531-C-A P1_Y1 **
26015684-C-A 23869537-C-A P1_Y1 **
26015688-C-A 23869541-C-A P1_Y1 **
26015702-C-A 23869555-C-A P1_Y1 **
26015704-C-A 23869557-C-A P1_Y1 **
26015711-C-A 23869564-C-A P1_Y1 **
26015733-C-A 23869586-C-A P1_Y1 **
26015744-C-A 23869597-C-A P1_Y1 **
26125188-AC-A 23979041-AC-A P1_Y1 **
26132949-A-C 23986802-A-C P1_Y1 **
26144547-G-T 23998400-G-T P1_Y1 **
26144566-G-T 23998419-G-T P1_Y1 **
26144583-G-T 23998436-G-T P1_Y1 **
26144594-G-T 23998447-G-T P1_Y1 **
26144611-G-T 23998464-G-T P1_Y1 **
26144616-G-T 23998469-G-T P1_Y1 **
26340676-C-A 24194529-C-A P1_Y1 **
26340682-C-A 24194535-C-A P1_Y1 **
26340720-C-A 24194573-C-A P1_Y1 **
28229200-C-A 26083053-C-A P1_b4 **
28441813-C-G 26295666-C-G P1_gr2 **
28482978-T-G 26336831-T-G **
28555656-C-A 26409509-C-A **
28642551-T-C 26496404-T-C **
28696607-G-T 26550460-G-T **
28709203-C-A 26563056-C-A **
28712957-C-A 26566810-C-A **
28712970-C-A 26566823-C-A **
28743181-C-A 26597034-C-A **
28796623-A-T 26650476-A-T **
28812292-A-G 26666145-A-G **
28812293-G-A 26666146-G-A **
28812303-C-G 26666156-C-G **
28812305-G-T 26666158-G-T **
28812317-A-C 26666170-A-C **
28812322-A-C 26666175-A-C **
56848796-C-T F26842 **
56848797-C-A **
56848809-A-T **
56848869-G-A **
56848870-G-A **
56849546-T-C **
56868910-C-A **
7307498-G-T 7439457-G-T CTS1278CTS1278 ***
17141942-CTG-C 15030062-CTG-C 8×TG***
9533796-ATG-A 9696187-ATG-A IR3_Prx 8×TG***
13450104-CTCCACTCCACCCCATCCCATCCCATTCTATTCCAT-C,CTCCATTCCATTTCATTCCAT 11294428-CTCCACTCCACCCCATCCCATCCCATTCTATTCCAT-C,CTCCATTCCATTTCATTCCAT ***
18923983-GAAA-G 16812103-GAAA-G 22×A***
10992308-T-C ***
10986864-C-A ***
10669462-TC-T ***
56842433-C-T ***
10987884-C-T BY84096 ***
10809591-T-A ***
56831653-C-CTCCATCCCAT,CTCCATTCCGC ***
5011417-C-A 5143376-C-A ***
13472166-G-C 11316490-G-C ***
16621530-G-T 14509650-G-T ***
15623176-A-T 13511296-A-T BY102966 11×T***
10809597-T-C ***
13461816-C-T 11306140-C-T ***
56830143-C-A ***
10992858-A-G ***
15557033-CAAAAAAA-C 13445153-CAAAAAAA-C 18×A***
13474670-C-G 11318994-C-G ***
13474683-C-T 11319007-C-T ***
13474685-C-G 11319009-C-G ***
22013231-G-T 19851345-G-T ***
11643727-T-C ***
3491747-C-A 3623706-C-A ***
28591049-C-A 26444902-C-A ***
14300504-C-A 12179798-C-A ***
13588193-C-A 11432517-C-A ***
23732232-CAAAAA-C 21570346-CAAAAA-C 17×A***
3829212-C-A 3961171-C-A ***
7255004-G-T 7386963-G-T ***
6134326-C-A 6266285-C-A ***
18929842-C-A 16817962-C-A ***
17211223-C-A 15099343-C-A FTA45941 ***
6475362-C-A 6607321-C-A ***
2948582-C-A 3080541-C-A ***
4701215-A-C 4833174-A-C ***
7719573-G-T 7851532-G-T ***
7964514-G-T 8096473-G-T ***
8432358-G-T 8564317-G-T ***
8703020-TACAC-T,TAC 8834979-TACAC-T,TAC 11×AC***
10690822-C-T ***
10770535-T-A ***
10795108-ACTGTG-A ***
10870822-C-A ***
10911843-AGATGT-A ***
10992310-CATTAA-C,CATCTC ***
13317858-T-A 11162182-T-A ***
13451990-CTGCTCTCCAA-C,CTCCAGTCCAT 11296314-CTGCTCTCCAA-C,CTCCAGTCCAT ***
13482303-C-T 11326627-C-T ***
14180810-T-A 12060104-T-A ***
14575178-G-T 12463378-G-T ***
14575219-C-A 12463419-C-A ***
15001529-C-A 12889614-C-A ***
15851039-C-T 13739159-C-T ***
15951962-G-A 13840082-G-A ***
16004208-A-T 13892328-A-T ***
16038717-C-A 13926837-C-A ***
16320221-C-A 14208341-C-A ***
16642097-CACTTGAACA-C 14530217-CACTTGAACA-C ***
16868597-C-G 14756717-C-G FT96733 ***
17126340-T-C 15014460-T-C ***
17313273-CTGTATTG-C 15201393-CTGTATTG-C 11×TGTAT***
18244695-C-A 16132815-C-A ***
18261920-C-A 16150040-C-A ***
18753629-C-A 16641749-C-A ***
18793597-A-G 16681717-A-G ***
19332210-G-T 17220330-G-T ***
19359869-C-A 17247989-C-A ***
22527274-C-A 20365388-C-A Y43809 ***
22690833-ACTGACACTTCACATGGCTGGGTACCCCTCTGAGAGGAAG-A 20528947-ACTGACACTTCACATGGCTGGGTACCCCTCTGAGAGGAAG-A ***
22829644-CAAAAA-C,CAAAA 20667758-CAAAAA-C,CAAAA 18×A***
23091435-G-A 20929549-G-A ***
31649-T-A ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.