Tree Position

R-P312/S116 > Z40481 > ZZ11 > U152/S28 > Z193 > Z192 > BY10448 > PF6652 > Y136259

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY2
B8234
20039843-G-A 17927963-G-A P5_Prx A*
26129170-T-G 23983023-T-G P1_Y1 A*
19911227-C-A 17799347-C-A P5_Prx A*
13687861-G-A 11532185-G-A A*
28818605-G-C 26672458-G-C A*
22276702-T-G 20114816-T-G DYZ19 A*
26159571-A-G 24013424-A-G P1_Y1 A*
23052718-G-A 20890832-G-A Y58644 Y8×A+
7190353-G-A 7322312-G-A Y83550 YY+
5212299-C-T 5344258-C-T BY58581 +
20064766-T-C 17952886-T-C BY212088 P5_Gap +
23566183-A-T 21404297-A-T BY146336 YY+
17750268-G-T 15638388-G-T BY117122 YY+
18074612-C-A 15962732-C-A BY119721 YY+
18145246-G-A 16033366-G-A BY120387 YY+
22298217-C-A 20136331-C-A BY184387 DYZ19 +
14898688-A-G 12786755-A-G BY98348 YY+
22445722-C-T 20283836-C-T DYZ19 +
22445719-A-C 20283833-A-C BY185970 DYZ19 +
14337712-G-T 12217007-G-T YY+
21917705-A-G 19755819-A-G BY136441 YY+
5675262-C-T 5807221-C-T BY58791 +
21641069-T-C 19479183-T-C BY134381 YY+
13853268-A-G 11732562-A-G BY91492 +
21530996-G-A 19369110-G-A BY133628 YY+
8879870-C-T 9011829-C-T BY76578 Y+
7334529-A-G 7466488-A-G BY64632 YY+
16333815-C-T 14221935-C-T BY107007 YY+
17387956-C-G 15276076-C-G BY114347 YY+
8461352-G-A 8593311-G-A BY72989 YY+
16870180-C-G 14758300-C-G BY110736 YY+
8216898-C-A 8348857-C-A BY70836 YY+
16970763-C-T 14858883-C-T BY111518 YY+
8281565-G-T 8413524-G-T BY71378 YY+
9009562-A-C 9171953-A-C BY77294 Y+
7864050-G-A 7996009-G-A BY68299 YY+
28789245-T-C 26643098-T-C BY151341 +
16811926-G-T 14700046-G-T BY110343 YY+
15704862-G-C 13592982-G-C BY103416 YY+
16365712-A-T 14253832-A-T BY107257 YY+
8798225-T-C 8930184-T-C BY75977 YY+
14361787-C-A 12241082-C-A **
14792984-C-T 12681055-C-T **
13960635-G-T 11839929-G-T **
14698334-C-T 12586400-C-T **
14557261-A-T 12445462-A-T **
14509972-C-A 12398177-C-A **
14457581-A-T 12336854-A-T **
14397618-A-T 12276914-A-T **
16060645-C-A 13948765-C-A **
14073882-C-A 11953176-C-A **
14000515-T-G 11879809-T-G **
14326596-G-A 12205890-G-A **
16176998-C-G 14065118-C-G 9×A**
16093125-C-A 13981245-C-A **
16055243-C-A 13943363-C-A **
14175578-C-A 12054872-C-A **
14120111-G-T 11999405-G-T **
14033959-C-A 11913253-C-A **
15999893-G-T 13888013-G-T **
14815448-T-G 12703519-T-G **
15684390-A-C 13572510-A-C **
15536246-A-T 13424366-A-T **
15684363-A-T 13572483-A-T **
15698800-A-T 13586920-A-T **
15776006-G-T 13664126-G-T **
15655108-G-T 13543228-G-T **
15647777-C-A 13535897-C-A **
15599877-G-T 13487997-G-T **
15558111-T-G 13446231-T-G **
15788071-CA-C 13676191-CA-C **
15536252-C-T 13424372-C-T **
15788208-C-A 13676328-C-A **
15297049-C-A 13185148-C-A **
15971526-C-A 13859646-C-A **
15794461-G-A 13682581-G-A **
15922701-G-T 13810821-G-T **
15084180-T-C 12972270-T-C **
15936767-G-A 13824887-G-A **
15082206-G-T 12970296-G-T **
15073127-C-A 12961217-C-A **
14988893-T-A 12876959-T-A **
14988832-G-T 12876898-G-T **
14963916-T-A 12851991-T-A **
14908343-A-C 12796410-A-C **
15283935-G-T 13172034-G-T **
25804899-T-C 23658752-T-C P1_b3 **
13954252-G-T 11833546-G-T **
10798758-A-G **
10925683-C-A **
10893257-C-A **
10889780-C-CGTACA **
10882899-C-A **
10861200-C-T **
10861195-T-C **
10860051-C-A **
10851455-C-A **
10842687-A-T **
10842671-A-T **
10842662-T-C **
10842645-CA-C **
10821754-C-A **
10774097-T-A **
10928857-T-A **
10692235-G-T **
10685031-T-G **
10684958-A-G **
10678979-C-A **
10663031-A-ATTCCG **
10659994-C-A **
10659993-C-A **
10645923-C-A **
5784590-GAAA-G 5916549-GAAA-G 13×A**
10039971-G-T 10202362-G-T **
9937128-A-G 10099519-A-G **
9909696-G-C 10072087-G-C **
9888681-G-A 10051072-G-A **
9429480-TAAAAAAA-T 9591871-TAAAAAAA-T 18×A**
10926336-C-A **
10935858-A-C **
13939675-A-G 11818969-A-G **
13421638-C-A 11265962-C-A **
13935936-C-A 11815230-C-A **
13928339-G-A 11807633-G-A **
13904907-G-T 11784201-G-T **
13900407-G-T 11779701-G-T **
13858245-G-A 11737539-G-A **
11664296-G-T **
16227987-G-A 14116107-G-A **
13586091-C-A 11430415-C-A **
13578685-C-A 11423009-C-A **
13524077-A-G 11368401-A-G **
13514376-A-G 11358700-A-G **
13500423-C-A 11344747-C-A **
13480861-G-A 11325185-G-A **
13331454-A-T 11175778-A-T **
10944404-C-A **
13331449-A-G 11175773-A-G **
13317151-G-T 11161475-G-T **
13295046-T-A 11139370-T-A **
13290316-T-C 11134640-T-C **
13236191-A-G 11080515-A-G **
13197901-G-A 11042225-G-A **
13193970-C-A 11038294-C-A **
11037779-A-G **
11031283-C-A **
11023321-A-G **
11021396-C-A **
11013394-C-A **
11000978-C-T **
10991142-C-A **
11658328-G-C **
17089086-C-A 14977206-C-A **
16246211-A-G 14134331-A-G **
22811881-T-A 20649995-T-A **
24403773-T-A 22257626-T-A **
24387882-CTA-C 22241735-CTA-C **
23961224-C-A 21815077-C-A **
21755464-C-T **
23802315-G-T 21640429-G-T **
23786386-C-A 21624500-C-A **
23442636-C-A 21280750-C-A **
23372993-A-G 21211107-A-G **
23277197-C-A 21115311-C-A **
23200167-C-T 21038281-C-T **
22880706-A-G 20718820-A-G **
22811890-A-G 20650004-A-G **
22780809-T-C 20618923-T-C **
24432814-GC-G 22286667-GC-G **
22624415-C-A 20462529-C-A **
22592932-A-C 20431046-A-C **
22544705-A-C 20382819-A-C **
22459883-T-C 20297997-T-C DYZ19 **
22276952-T-C 20115066-T-C DYZ19 **
22172038-G-T 20010152-G-T **
22170316-C-A 20008430-C-A **
22155610-A-G 19993724-A-G **
22135582-C-A 19973696-C-A **
22132712-C-CA 19970826-C-CA **
22048569-C-A 19886683-C-A **
22040781-G-A 19878895-G-A **
22001851-A-T 19839965-A-T **
24408261-C-A 22262114-C-A **
24877609-G-T 22731462-G-T g1 **
21830178-G-A 19668292-G-A 8×A**
28611730-C-A 26465583-C-A **
15099-CTT-C **
56879395-C-G **
56879389-T-A **
56870843-G-A **
56845643-C-A **
56845641-A-C **
56830407-T-A **
56830405-C-G **
56830398-C-CATTCA **
28792464-A-T 26646317-A-T **
28777822-C-A 26631675-C-A **
28722646-G-A 26576499-G-A **
28722634-G-C 26576487-G-C **
28610227-T-C 26464080-T-C **
25984863-C-A 23838716-C-A P1_Y1 **
28608406-A-C 26462259-A-C **
28605361-A-C 26459214-A-C **
28598122-G-A 26451975-G-A **
28596780-C-A 26450633-C-A **
28570614-A-G 26424467-A-G **
28561811-AT-A 26415664-AT-A **
28534558-T-A 26388411-T-A **
28483475-G-T 26337328-G-T **
27616451-G-T 25470304-G-T P1_Y2 **
27515950-G-T 25369803-G-T P1_Y2 **
26538802-A-T 24392655-A-T P1_g2 **
26436989-T-C 24290842-T-C P1_Y1 **
26146836-C-A 24000689-C-A P1_Y1 **
21853634-G-A 19691748-G-A **
21747810-G-T 19585924-G-T **
16320484-G-T 14208604-G-T **
17429583-C-A 15317703-C-A **
18285973-C-A 16174093-C-A P6_Prx **
18186357-C-A 16074477-C-A **
17855931-G-T 15744051-G-T **
17732213-A-T 15620333-A-T **
17732157-C-G 15620277-C-G **
17732149-T-A 15620269-T-A **
17544875-C-A 15432995-C-A **
17542682-T-A 15430802-T-A **
17542667-G-T 15430787-G-T **
17542644-A-T 15430764-A-T **
17536658-C-A 15424778-C-A **
17503968-CCT-C 15392088-CCT-C **
17430459-G-T 15318579-G-T **
17377866-G-T 15265986-G-T **
18524308-G-T 16412428-G-T P6_Dst **
17377510-T-G 15265630-T-G **
17324120-A-G 15212240-A-G **
17313362-T-A 15201482-T-A **
17255063-A-G 15143183-A-G **
17200106-A-G 15088226-A-G **
17200070-G-A 15088190-G-A **
17065745-G-T 14953865-G-T **
16932987-A-G 14821107-A-G **
16612429-G-C 14500549-G-C **
16572850-A-C 14460970-A-C **
16526712-G-A 14414832-G-A **
16437489-G-T 14325609-G-T **
16429645-C-T 14317765-C-T **
18402755-G-T 16290875-G-T P6_Gap **
18539654-G-T 16427774-G-T **
21746943-G-A 19585057-G-A **
19427215-T-C 17315335-T-C **
21742597-G-T 19580711-G-T **
21597093-C-A 19435207-C-A **
21580869-G-T 19418983-G-T **
21323067-C-A 19161181-C-A **
21320667-C-T 19158781-C-T **
21280626-T-C 19118740-T-C **
21087190-T-A 18925304-T-A **
20936388-G-A 18774502-G-A P4_Dst **
20809437-G-C 18647551-G-C P4_Gap **
20693252-T-A 18531366-T-A P4_Prx **
20025732-A-T 17913852-A-T P5_Prx **
19856205-C-A 17744325-C-A P5_Prx **
19427290-CA-C 17315410-CA-C **
19377110-G-A 17265230-G-A **
18565862-C-A 16453982-C-A **
19303933-G-C 17192053-G-C **
19301464-G-A 17189584-G-A **
19286410-A-G 17174530-A-G **
19258901-C-A 17147021-C-A **
19235458-G-T 17123578-G-T **
19043083-C-A 16931203-C-A **
18930463-C-A 16818583-C-A **
18874862-G-T 16762982-G-T **
18845253-T-C 16733373-T-C **
18845233-A-C 16733353-A-C **
18652870-A-G 16540990-A-G **
18611703-G-A 16499823-G-A **
18611697-C-A 16499817-C-A **
9377539-C-A 9539930-C-A **
10051459-G-A 10213850-G-A **
9110206-G-T **
2979755-G-T 3111714-G-T **
3164629-T-A 3296588-T-A **
3153878-A-G 3285837-A-G **
3151839-C-G 3283798-C-G **
3151768-G-A 3283727-G-A **
3138989-T-C 3270948-T-C **
3103457-C-A 3235416-C-A **
3100560-C-A 3232519-C-A **
3079517-C-G 3211476-C-G **
3063364-G-T 3195323-G-T **
3014751-C-A 3146710-C-A **
3013865-C-A 3145824-C-A **
3006591-C-A 3138550-C-A **
2999659-C-A 3131618-C-A **
2980326-C-A 3112285-C-A **
2856522-T-C 2988481-T-C **
3250735-G-A 3382694-G-A **
2774968-T-A 2906927-T-A **
2708571-A-G 2840530-A-G **
8824254-C-T 8956213-C-T **
8824248-T-C 8956207-T-C **
10979549-A-G **
10861197-G-A **
10984849-G-A **
23460453-C-A 21298567-C-A FT71278 **
17317356-C-A 15205476-C-A **
10758095-C-A **
3882382-G-T 4014341-G-T **
23311333-C-A 21149447-C-A **
8379486-AC-A 8511445-AC-A **
17187534-C-A 15075654-C-A **
3249420-A-G 3381379-A-G **
3251991-T-C 3383950-T-C **
14805984-C-A 12694055-C-A **
3877697-G-T 4009656-G-T **
4195607-T-C 4327566-T-C **
4169521-C-T 4301480-C-T **
4156421-G-T 4288380-G-T **
4104551-G-C 4236510-G-C **
4094144-C-A 4226103-C-A **
4080987-T-A 4212946-T-A **
4074720-T-C 4206679-T-C **
4035368-G-T 4167327-G-T **
3998364-C-A 4130323-C-A **
8849958-C-A 8981917-C-A **
3950491-G-T 4082450-G-T **
3914428-G-T 4046387-G-T **
3883537-G-T 4015496-G-T **
3882191-A-G 4014150-A-G **
3877660-C-A 4009619-C-A **
3273079-G-T 3405038-G-T **
3461193-CT-C 3593152-CT-C **
3301393-C-A 3433352-C-A **
3304576-A-G 3436535-A-G **
3343214-A-G 3475173-A-G **
3347017-A-G 3478976-A-G **
3396379-G-T 3528338-G-T **
3443594-G-T 3575553-G-T **
3497775-A-G 3629734-A-G **
3846792-C-A 3978751-C-A **
3524252-T-G 3656211-T-G **
3554521-A-G 3686480-A-G **
3585131-A-C 3717090-A-C **
3635166-C-A 3767125-C-A **
3798314-G-T 3930273-G-T **
3839268-C-A 3971227-C-A **
19899623-AGGAAG-A 17787743-AGGAAG-A P5_Prx **
5689959-C-A 5821918-C-A **
4355997-T-A 4487956-T-A **
23807455-C-A 21645569-C-A **
10842620-T-G **
10678501-G-T **
18847692-C-A 16735812-C-A **
4473028-C-A 4604987-C-A **
14343924-C-A 12223219-C-A **
21163133-CA-C 19001247-CA-C **
21189662-C-T 19027776-C-T **
6096861-C-A 6228820-C-A **
19866987-A-G 17755107-A-G P5_Prx **
18184802-G-T 16072922-G-T **
28633643-C-A 26487496-C-A **
4908685-C-A 5040644-C-A **
18274948-GTATA-G 16163068-GTATA-G P6_Prx 8×TA**
7028739-C-A 7160698-C-A **
24875370-C-A 22729223-C-A g1 **
10842629-CCGTTT-C **
10659938-C-A **
21456052-C-A 19294166-C-A **
7208189-C-A 7340148-C-A **
4213056-C-A 4345015-C-A **
15115634-C-A 13003721-C-A **
16177219-C-A 14065339-C-A **
10842664-G-A **
23512435-A-C 21350549-A-C **
21830205-C-A 19668319-C-A 25×A**
23512432-A-T 21350546-A-T **
15186425-G-A 13074511-G-A **
9221714-T-C 9384105-T-C **
21830190-T-A 19668304-T-A 12×A**
17265604-T-G 15153724-T-G **
10842621-A-G **
14366766-C-A 12246061-C-A **
10037931-C-A 10200322-C-A **
13858995-C-A 11738289-C-A **
16522355-C-A 14410475-C-A **
23252697-G-T 21090811-G-T **
14021381-C-A 11900675-C-A **
23440444-C-A 21278558-C-A **
10676931-C-A **
16271831-A-C 14159951-A-C **
19609580-G-T 17497700-G-T P5_Prx **
10750313-C-A **
18931868-C-A 16819988-C-A **
4521442-C-A 4653401-C-A **
24432792-C-T 22286645-C-T **
10032344-GTT-G 10194735-GTT-G 12×T**
13200460-C-A 11044784-C-A **
13895796-C-A 11775090-C-A **
9431488-G-A 9593879-G-A **
23981880-C-A 21835733-C-A **
5816968-C-A 5948927-C-A **
14204886-C-A 12084180-C-A **
14553236-C-A 12441437-C-A **
10667679-G-T **
13902195-C-A 11781489-C-A **
4124041-C-A 4256000-C-A **
14789428-C-A 12677499-C-A **
16515862-C-A 14403982-C-A **
7182147-C-A 7314106-C-A **
14844391-C-A 12732457-C-A **
11663860-C-A **
7664672-C-A 7796631-C-A **
6648675-C-A 6780634-C-A **
21700354-G-C 19538468-G-C **
56830254-A-T **
4272644-C-A 4404603-C-A **
3953396-A-G 4085355-A-G **
4388646-A-T 4520605-A-T **
6485458-C-A 6617417-C-A **
7029728-G-A 7161687-G-A **
6954854-C-T 7086813-C-T **
6874534-A-G 7006493-A-G **
6832911-C-T 6964870-C-T **
6791141-G-T 6923100-G-T **
6772919-C-A 6904878-C-A **
6772908-C-A 6904867-C-A **
6654788-C-G 6786747-C-G **
6621533-C-T 6753492-C-T **
6593303-C-T 6725262-C-T **
6580517-C-A 6712476-C-A **
6488880-C-A 6620839-C-A **
6474645-CCAG-C 6606604-CCAG-C **
7042790-C-A 7174749-C-A **
4404579-C-A 4536538-C-A **
6474444-G-T 6606403-G-T **
6442401-G-T 6574360-G-T **
6368087-C-A 6500046-C-A **
6267206-C-A 6399165-C-A IR3_Dst **
6229711-C-A 6361670-C-A IR3_Dst **
6089829-A-T 6221788-A-T **
6073930-G-T 6205889-G-T **
6047681-C-A 6179640-C-A **
6041094-T-C 6173053-T-C **
6028266-T-G 6160225-T-G **
6017252-C-A 6149211-C-A **
5997697-C-A 6129656-C-A **
7040489-G-T 7172448-G-T **
7043507-A-G 7175466-A-G **
5966229-G-T 6098188-G-T **
7829651-C-A 7961610-C-A **
8824596-C-G 8956555-C-G **
8816283-G-A 8948242-G-A **
8692235-C-A 8824194-C-A **
8671483-T-C 8803442-T-C FT57611 **
8660971-C-A 8792930-C-A **
8344544-A-T 8476503-A-T **
8138117-C-A 8270076-C-A **
8094378-C-T 8226337-C-T **
8052000-G-A 8183959-G-A **
8051961-A-G 8183920-A-G **
8051947-A-G 8183906-A-G **
7990529-C-G 8122488-C-G **
7774972-C-A 7906931-C-A **
7061231-C-G 7193190-C-G **
7753824-C-T 7885783-C-T **
7717856-TG-T 7849815-TG-T **
7708979-C-A 7840938-C-A **
7664353-G-T 7796312-G-T **
7363356-A-C 7495315-A-C **
7362380-T-TA 7494339-T-TA **
7338650-T-C 7470609-T-C **
7306754-C-A 7438713-C-A **
7254061-T-C 7386020-T-C **
7243185-T-C 7375144-T-C **
7214231-C-A 7346190-C-A **
7166472-A-G 7298431-A-G **
7081337-C-T 7213296-C-T **
5995285-C-A 6127244-C-A **
30803-A-G **
5966161-A-G 6098120-A-G **
5236679-C-A 5368638-C-A **
4632483-C-A 4764442-C-A **
5409952-A-G 5541911-A-G **
4755347-C-A 4887306-C-A **
5399566-G-T 5531525-G-T **
4823944-G-T 4955903-G-T **
5393401-G-A 5525360-G-A **
4936543-T-G 5068502-T-G **
5393390-GGAA-G 5525349-GGAA-G **
5343710-C-A 5475669-C-A **
5331545-A-C 5463504-A-C **
5312159-G-T 5444118-G-T **
4968953-A-C 5100912-A-C **
5235400-C-A 5367359-C-A **
4529764-G-T 4661723-G-T **
4968969-T-C 5100928-T-C **
5214582-G-C 5346541-G-C **
4968978-T-C 5100937-T-C **
4968991-T-C 5100950-T-C **
5211947-A-G 5343906-A-G **
5207235-T-C 5339194-T-C **
5207162-T-C 5339121-T-C **
4969010-G-C 5100969-G-C **
4979159-T-G 5111118-T-G **
5151885-C-A 5283844-C-A **
5052127-C-A 5184086-C-A **
4979369-C-A 5111328-C-A **
5447087-AT-A 5579046-AT-A **
5417936-T-C 5549895-T-C **
5461559-C-T 5593518-C-T **
5674770-C-A 5806729-C-A **
5937103-C-A 6069062-C-A **
4418019-A-G 4549978-A-G **
5933865-C-A 6065824-C-A **
5885529-C-T 6017488-C-T **
5878936-G-T 6010895-G-T **
4480215-A-G 4612174-A-G **
5823342-G-T 5955301-G-T **
5758096-C-T 5890055-C-T **
5756426-C-A 5888385-C-A **
4487816-GAAA-G 4619775-GAAA-G 19×A**
5746169-C-A 5878128-C-A **
5741566-G-T 5873525-G-T **
5689937-AG-A 5821896-AG-A **
4979271-AG-A 5111230-AG-A **
5555233-G-T 5687192-G-T **
5658758-G-T 5790717-G-T **
5647841-G-T 5779800-G-T **
5587435-G-T 5719394-G-T **
5462944-C-T 5594903-C-T **
4490988-G-T 4622947-G-T **
5669991-C-A 5801950-C-A **
4513640-G-C 4645599-G-C **
5531816-AT-A 5663775-AT-A 8×T**
10668403-C-A ***
10842025-G-T ***
9173191-A-T 9335582-A-T ***
10799628-T-A ***
9094630-C-A 9257021-C-A ***
10744572-T-A ***
56832020-CTCCATCCCATTCCATTCCGT-C,CTCCATCCCATTCCATTCCGC ***
28784514-T-C 26638367-T-C ***
56855815-C-A ***
10654049-C-A ***
8333572-TCTCCTCCTC-T,TCTTCTCCTCCTC 8465531-TCTCCTCCTC-T,TCTTCTCCTCCTC ***
10670895-C-A ***
10893970-G-A ***
10814531-T-C ***
10824106-C-A ***
21042966-C-A 18881080-C-A ***
4223228-C-A 4355187-C-A ***
13579693-A-C 11424017-A-C ***
14046669-TA-T 11925963-TA-T ***
10880778-C-A ***
4841712-G-T 4973671-G-T ***
22134039-G-T 19972153-G-T ***
18812256-C-A 16700376-C-A ***
22238366-C-T 20076480-C-T DYZ19 ***
6971886-CAAA-C 7103845-CAAA-C 14×A***
22286942-C-A 20125056-C-A DYZ19 ***
5858525-C-A 5990484-C-A ***
14988735-G-T 12876801-G-T ***
7717749-T-A 7849708-T-A ***
19253110-G-T 17141230-G-T ***
10939651-C-A ***
22965075-C-T 20803189-C-T ***
23255116-C-A 21093230-C-A Y111106 ***
10916252-C-T ***
5957196-A-G 6089155-A-G ***
10884786-CCATTT-C,CCTTTC ***
10861278-C-T ***
10861255-C-T ***
10861273-G-T ***
25592902-A-ATCTC 23446755-A-ATCTC P1_gr1 ***
10859488-T-TC ***
5202001-T-C 5333960-T-C ***
21953288-T-C 19791402-T-C ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: B8234994937580415377898484
Used in age calculations994937580415377898484
Counts of SNPs2425
Variant counts last updated 2019-08-26 21:18:34.



Big Tree Main Page