Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > Z39589 > DF49/S474 > Z2980 > Z2976 > DF23 > Z2961 > Z2956 > M222 > Z46375 > DF106 > DF104 > DF105 > A223 > BY3339 > A225 > A224 > A1774 > FGC32899 > 10664773-C-T

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY2
148501
6303685-C-T 6435644-C-T BY46918 IR3_Dst A*
16171033-G-C 14059153-G-C BY105715 Y+
21707133-G-T 19545247-G-T BY134863 YY+
6944600-T-A 7076559-T-A BY62443 YY+
16548055-G-A 14436175-G-A BY108532 YY+
22933179-G-A 20771293-G-A BY141849 YY+
20824603-A-C 18662717-A-C Z17999FGC3101 P4_Gap +
8862982-T-C 8994941-T-C BY76410 YY+
10980479-C-T **
10978851-C-G **
13197782-C-A 11042106-C-A **
11030854-T-G **
10979992-T-G **
11029718-C-A **
11029713-C-A **
11029673-C-A **
11027033-C-A **
10980444-CT-C **
11020656-C-T **
11006862-A-T **
13255666-C-T 11099990-C-T **
10980451-T-C **
11001012-C-A **
10980481-CAGTTT-C **
11005156-C-A **
13329156-C-T 11173480-C-T **
13255673-C-T 11099997-C-T **
14123994-T-C 12003288-T-C **
15287618-C-T 13175717-C-T **
14742038-C-T 12630106-C-T **
14727321-T-TG 12615389-T-TG **
14677780-C-A 12565846-C-A **
14639050-G-T 12527119-G-T **
14280893-G-T 12160187-G-T **
14180735-G-A 12060029-G-A **
13944709-C-A 11824003-C-A **
13308763-C-A 11153087-C-A **
13940898-GGAGAGAGGGAGGGAGAGAGGGAGAGAGGGAGA-G 11820192-GGAGAGAGGGAGGGAGAGAGGGAGAGAGGGAGA-G **
13935838-A-C 11815132-A-C **
13909925-T-G 11789219-T-G **
13908429-T-A 11787723-T-A **
13896325-C-A 11775619-C-A **
11654353-G-T **
13522904-C-A 11367228-C-A **
13360925-G-T 11205249-G-T **
10975506-C-T **
10959428-C-A **
10975498-T-C **
10753891-G-C **
10788900-T-C **
10781553-C-T **
10774462-C-A **
10774037-T-G **
10765190-A-C **
7107011-C-CTATA 7238970-C-CTATA 20×TA**
10753900-T-A **
10753887-G-C **
10819075-C-T **
10749069-T-C **
10749067-C-T **
10749037-A-ATTAC **
10749035-T-TA **
10744263-A-ACTCTT **
10744245-T-TTA **
10744240-T-TA **
10691554-T-A **
10804935-A-T **
10831970-TCATTC-T **
10959652-C-A **
10905958-G-T **
15725910-C-A 13614030-C-A **
10958802-A-T **
10947517-C-A **
10943345-C-G **
10909150-T-G **
10909130-T-C **
10909125-A-T **
10906115-A-C **
10894103-T-G **
10832443-C-T **
10888152-C-A **
10873312-C-T **
10869495-C-A **
10866670-A-T **
10849022-A-T **
10835167-G-T **
10833893-C-A **
10833428-T-A **
15595020-C-A 13483140-C-A **
15912080-A-T 13800200-A-T **
15755261-C-T 13643381-C-T **
23272252-G-T 21110366-G-T **
24046092-C-A 21899945-C-A **
21751271-G-T **
23876165-G-T 21714279-G-T **
23838524-C-A 21676638-C-A **
23825206-G-T 21663320-G-T **
23426952-G-T 21265066-G-T **
23426945-G-A 21265059-G-A **
23188938-G-T 21027052-G-T **
24280749-G-T 22134602-G-T P3_t1 **
23184878-A-G 21022992-A-G **
23184784-C-A 21022898-C-A **
23096624-C-A 20934738-C-A **
22972976-T-C 20811090-T-C **
22658972-C-A 20497086-C-A **
22114764-C-A 19952878-C-A **
22108604-C-A 19946718-C-A **
22099816-C-A 19937930-C-A **
24278287-A-T 22132140-A-T P3_b1 **
24379130-C-A 22232983-C-A **
22048507-G-T 19886621-G-T **
28802650-G-A 26656503-G-A **
56873893-C-A **
56851217-T-G **
56842285-A-T **
56842276-G-A **
56841301-C-A **
56838700-T-C **
56827370-G-T **
28818214-A-C 26672067-A-C **
28679049-G-T 26532902-G-T **
24408263-C-A 22262116-C-A **
28558902-C-A 26412755-C-A **
28500897-C-T 26354750-C-T **
27966708-CA-C 25820561-CA-C P1_Y2 **
27861565-G-T 25715418-G-T P1_Y2 **
26355572-G-T 24209425-G-T P1_Y1 **
26206185-G-T 24060038-G-T P1_Y1 **
24509349-C-A 22363202-C-A **
24408325-C-A 22262178-C-A **
22048509-C-A 19886623-C-A **
22008569-C-A 19846683-C-A **
15815336-CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-C 13703456-CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-C 57×A**
16439919-C-A 14328039-C-A **
17876263-C-A 15764383-C-A **
17716816-C-A 15604936-C-A **
17061142-G-T 14949262-G-T **
16971462-C-A 14859582-C-A **
16943452-G-T 14831572-G-T **
16689831-C-A 14577951-C-A **
16539733-G-T 14427853-G-T **
16475264-G-A 14363384-G-A **
16354911-T-A 14243031-T-A **
18434861-GAGA-G 16322981-GAGA-G P6_Dst **
16354907-A-T 14243027-A-T **
16277933-G-T 14166053-G-T **
16089678-T-G 13977798-T-G **
16035284-T-G 13923404-T-G **
16035247-T-G 13923367-T-G **
16005350-C-A 13893470-C-A **
15971708-T-G 13859828-T-G **
10691374-T-TTACTC **
18343602-C-CTT 16231722-C-CTT P6_Prx 25×T**
18434869-G-C 16322989-G-C P6_Dst **
21839940-T-TG 19678054-T-TG **
20295528-T-G 18133642-T-G P5_Dst **
21771477-C-A 19609591-C-A **
21394714-C-A 19232828-C-A **
21185145-G-T 19023259-G-T **
21073261-C-T 18911375-C-T **
21056193-A-C 18894307-A-C **
20809611-A-G 18647725-A-G P4_Gap **
20579222-C-A 18417336-C-A P5_Dst **
20579121-T-TAC 18417235-T-TAC P5_Dst **
19892760-T-TG 17780880-T-TG P5_Prx **
18434875-A-C 16322995-A-C P6_Dst **
19649548-T-G 17537668-T-G P5_Prx **
19649494-T-G 17537614-T-G P5_Prx **
19551819-T-G 17439939-T-G **
19505524-G-T 17393644-G-T Y75483 **
19378236-C-A 17266356-C-A **
19268216-T-G 17156336-T-G **
18933576-T-G 16821696-T-G **
18434878-A-G 16322998-A-G P6_Dst **
10691547-T-C **
10758575-A-T **
10679506-C-T **
27862580-C-G 25716433-C-G P1_Y2 **
19007803-C-A 16895923-C-A **
22130313-T-A 19968427-T-A **
10942751-C-G **
11027049-C-T **
10748997-T-C **
10959196-CACTTT-C **
14376675-C-A 12255971-C-A **
15080683-C-A 12968773-C-A **
13485625-G-A 11329949-G-A **
6090578-C-A 6222537-C-A **
10906130-C-A **
10771973-C-CTGCAA **
16765492-C-A 14653612-C-A **
3836883-C-A 3968842-C-A **
14042713-G-T 11922007-G-T **
13485656-G-A 11329980-G-A **
10997029-C-T **
15870578-C-A 13758698-C-A **
10753506-C-A **
10996987-T-C **
11018282-C-G **
10771844-A-C **
10959182-T-A **
10959177-T-A **
4788559-C-A 4920518-C-A **
10925321-T-C **
10889580-C-A **
11018292-C-T **
11022410-C-T **
10822568-G-T **
10998768-G-T **
10654487-C-A **
17474772-G-GTT 15362892-G-GTT 11×T**
10942731-C-G **
10942726-CT-C **
10942723-T-AC **
10942705-T-A **
10658405-T-G **
10996989-C-A **
10996986-A-T **
10781569-C-T **
10658398-C-A **
20326037-G-TT 18164151-G-TT P5_Dst **
11027029-C-T **
13461216-A-T 11305540-A-T **
13461199-T-G 11305523-T-G **
13461198-G-T 11305522-G-T **
9198785-G-A 9361176-G-A **
16766391-CTT-C 14654511-CTT-C 11×T**
3990553-C-A 4122512-C-A **
15264743-G-T 13152832-G-T **
15786385-C-A 13674505-C-A **
7155515-C-A 7287474-C-A **
10812204-C-T BY29349 **
10691310-C-A **
10959190-G-C **
11022398-A-T **
7646774-C-A 7778733-C-A **
13255665-C-T 11099989-C-T **
11006888-G-C **
11660207-CAATGG-C **
23505154-G-T 21343268-G-T **
10821947-CTTTCT-C **
9444689-C-CAA 9607080-C-CAA 14×A**
10942734-T-A **
10953036-C-A **
10974324-T-G **
27633645-C-A 25487498-C-A P1_Y2 **
5785696-C-A 5917655-C-A **
10690935-C-A **
10866669-C-T **
10996933-T-C **
10906019-T-C **
10658148-A-ATTT **
10744281-C-T **
10906166-T-C **
11022405-A-T **
10865552-G-C **
10996950-GT-G **
10996947-G-C **
10906057-G-A **
7868069-A-C 8000028-A-C **
10781579-A-T **
5560622-T-G 5692581-T-G **
5990509-C-A 6122468-C-A **
5962587-G-T 6094546-G-T **
5925031-G-T 6056990-G-T **
5901170-C-A 6033129-C-A **
5867085-A-C 5999044-A-C **
5847037-C-A 5978996-C-A **
5746138-G-T 5878097-G-T **
5586797-G-T 5718756-G-T **
5524570-C-A 5656529-C-A **
6063459-C-A 6195418-C-A **
5220406-G-A 5352365-G-A **
5180393-T-C 5312352-T-C **
4746690-A-G 4878649-A-G **
4726400-G-T 4858359-G-T **
4639210-C-A 4771169-C-A **
4310693-C-A 4442652-C-A **
3872883-C-A 4004842-C-A **
3657706-C-A 3789665-C-A **
3626338-C-A 3758297-C-A **
6040151-T-G 6172110-T-G **
6105978-G-A 6237937-G-A **
3464646-C-A 3596605-C-A **
8061755-G-T 8193714-G-T **
9965375-C-A 10127766-C-A **
9941427-C-A 10103818-C-A **
9562315-GT-G 9724706-GT-G IR3_Prx **
9442152-A-G 9604543-A-G **
8679405-C-A 8811364-C-A **
8556304-GCTGGGCAAGTTTTTTTTTTTTTTTTTGAGACGGAGT-G 8688263-GCTGGGCAAGTTTTTTTTTTTTTTTTTGAGACGGAGT-G **
8216383-A-G 8348342-A-G **
8078879-G-A 8210838-G-A **
7966059-A-G 8098018-A-G **
6131647-G-A 6263606-G-A **
7536389-A-T 7668348-A-T **
7436618-C-A 7568577-C-A **
7385678-G-T 7517637-G-T **
7174408-C-A 7306367-C-A **
7123558-G-T 7255517-G-T **
7012683-C-A 7144642-C-A **
6930763-T-G 7062722-T-G **
6580425-C-A 6712384-C-A **
6516425-C-A 6648384-C-A **
3507890-C-CA 3639849-C-CA 8×A**
3961406-A-G 4093365-A-G **
56880137-C-T **
2778579-C-A 2910538-C-A **
10906138-A-G **
10906131-A-C **
19531341-C-A 17419461-C-A **
3463538-C-A 3595497-C-A **
56747839-A-C **
4630889-G-T 4762848-G-T **
15733583-C-A 13621703-C-A **
10936814-T-G **
2855460-C-A 2987419-C-A **
56747835-T-A **
56747826-A-C **
10781586-T-C **
10925648-C-T **
10781585-T-C **
10691100-C-A **
10765200-C-A **
22659432-C-A 20497546-C-A **
16047929-T-C 13936049-T-C ***
14026028-AAGAAAGAA-A,AAGAAAGAG 11905322-AAGAAAGAA-A,AAGAAAGAG ***
13421290-C-A 11265614-C-A ***
16085344-C-A 13973464-C-A ***
10799605-C-G ***
13456059-C-T 11300383-C-T ***
13475454-CA-C 11319778-CA-C ***
56833502-CCACTA-T ***
13475538-T-A 11319862-T-A ***
7367313-C-T 7499272-C-T ***
13585531-C-A 11429855-C-A ***
23393149-C-A 21231263-C-A ***
10829173-C-A ***
15156571-C-A 13044658-C-A Y93157 ***
15126490-C-A 13014577-C-A ***
15018939-GTT-G,GTTT 12907028-GTT-G,GTTT 15×T***
56832950-ATTGCATTCCC-A,ATTACATTCCACTCCA ***
13468161-G-A 11312485-G-A ***
13468177-A-C,T 11312501-A-C,T ***
10972972-C-A ***
21992963-TAAAAAA-T 19831077-TAAAAAA-T 23×A***
3271586-C-A 3403545-C-A ***
13474681-GT-G 11319005-GT-G ***
21473546-CT-C 19311660-CT-C 8×T***
19129053-CTTTT-C,CT 17017173-CTTTT-C,CT 16×T***
10989062-A-C,T ***
10984486-C-A,T ***
3271601-CT-C,CTTT 3403560-CT-C,CTTT 14×T***
18780109-C-A 16668229-C-A ***
19575857-C-A 17463977-C-A P5_Prx ***
18723198-CTTTGGGGA-C 16611318-CTTTGGGGA-C ***
17118395-CTTT-C,CTT 15006515-CTTT-C,CTT 16×T***
11007707-C-A ***
14250235-A-G 12129529-A-G ***
4285502-G-T 4417461-G-T ***
21141632-C-A 18979746-C-A ***
28784421-G-GAGTGT 26638274-G-GAGTGT ***
2860314-C-A 2992273-C-A ***
10693289-A-G ***
8648172-GATATAT-G 8780131-GATATAT-G 14×AT***
21946509-C-A 19784623-C-A ***
16964104-A-C 14852224-A-C ***
13453193-CCACTCGGGTT-C 11297517-CCACTCGGGTT-C ***
16913422-CAAAAAAA-C,CAAAAAA 14801542-CAAAAAAA-C,CAAAAAA 21×A***
24872697-GT-G 22726550-GT-G P3_b2 11×T***
23484565-C-A 21322679-C-A ***
8479399-CTT-C,CTTT 8611358-CTT-C,CTTT 18×T***
13194797-TTCCAGTCCACTCCAC-T 11039121-TTCCAGTCCACTCCAC-T ***
22703655-G-T 20541769-G-T ***
22902108-CAAA-C,CAA 20740222-CAAA-C,CAA 17×A***
18780069-CT-C,CTT 16668189-CT-C,CTT 13×T***
7866832-C-A 7998791-C-A ***
19022287-C-A 16910407-C-A ***
13450406-CTCCACTCCATTCCATTCCATTCTATTCCATTCCAT-C,CTCCACTGCATTCCATTCAATTCTATTCCATTCCAT 11294730-CTCCACTCCATTCCATTCCATTCTATTCCATTCCAT-C,CTCCACTGCATTCCATTCAATTCTATTCCATTCCAT ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 148501958334178246377718849
Used in age calculations958334178246377718849
Counts of SNPs65
Variant counts last updated 2019-05-11 10:42:22.



Big Tree Main Page