Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > L513/S215/DF1 > S6365 > Z16361 > CTS750 > FGC13411 > FGC32363

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY3
596085
BigY2
596085
20602563-A-AGG 18440677-A-AGG P5_Dst A*
20659075-A-G 18497189-A-G P4_Prx A*
13450278-C-T 11294602-C-T A*
22282227-C-A 20120341-C-A DYZ19 A*
18326980-C-A 16215100-C-A P6_Prx A*
18482124-T-C 16370244-T-C P6_Dst A*
18482123-G-T 16370243-G-T P6_Dst A*
18326979-A-G 16215099-A-G P6_Prx A*
20602568-C-A 18440682-C-A P5_Dst A*
6181406-A-C 6313365-A-C IR3_Dst A*
20739967-T-C 18578081-T-C ZS1887 P4_Prx A*
18304634-G-C 16192754-G-C P6_Prx A*A*
20978081-T-TA 18816195-T-TA P4_Dst 10×AA*
56832399-G-C A*
20602580-T-G 18440694-T-G P5_Dst A*
20602563-A-T 18440677-A-T P5_Dst A*
20602570-G-T 18440684-G-T P5_Dst A*
20602575-G-C 18440689-G-C P5_Dst A*
26504671-G-A 24358524-G-A P1_Y1 A*
13687642-G-T 11531966-G-T A*
22466284-G-C 20304398-G-C BY52940 DYZ19 ++
22464900-C-A 20303014-C-A FT458460 DYZ19 **+
21827002-A-G 19665116-A-G BY135764 YY++
13711690-A-T 11556014-A-T BY89450 ++
13841340-G-A 11720634-G-A FT116248 +**
2743753-C-A 2875712-C-A BY56201 YY++
19305840-G-A 17193960-G-A FT118708 YY+***
18650024-C-T 16538144-C-T Y102320 YY++
14314723-C-T 12194017-C-T BY94756 YY++
6530664-G-A 6662623-G-A FT115070 +
15132465-C-T 13020552-C-T BY99848 YY++
18073819-T-C 15961939-T-C BY14998 YY++
4200448-C-T 4332407-C-T FT113457 +
5244674-T-G 5376633-T-G FT114258 +
8171311-A-G 8303270-A-G FT115735 YY+**
24000915-AGT-A 21854768-AGT-A ++
8319890-C-T 8451849-C-T BY71672 YY++
8783278-T-C 8915237-T-C BY75872 YY++
5320825-A-C 5452784-A-C FT114324 +
9902930-G-C 10065321-G-C BY81933 Y++
15418742-A-G 13306862-A-G BY101461 YY++
6455013-T-G 6586972-T-G FT115024 +
8247049-T-TG 8379008-T-TG +**
6146203-T-C 6278162-T-C BY59300 IR3_Dst ++
6947285-C-T 7079244-C-T Y29230 YY++
16005244-C-A 13893364-C-A FT117333 Y+
6090296-A-T 6222255-A-T FGC8025 Z7134 +
7388-A-C ***
10958311-CTCCAT-C *
22230374-G-A 20068488-G-A DYZ19 *
15363955-G-A 13252075-G-A **
15363933-G-C 13252053-G-C **
15363904-C-CAA 13252024-C-CAA **
15363888-G-A 13252008-G-A **
15363886-C-G 13252006-C-G **
15363874-A-C 13251994-A-C **
15363867-C-T 13251987-C-T **
15278959-C-A 13167058-C-A **
24611413-G-T 22465266-G-T P3_t2 **
15202395-G-A 13090481-G-A **
15193598-C-A 13081684-C-A **
15193527-C-T 13081613-C-T **
15127959-A-T 13016046-A-T **
15041928-C-A 12930018-C-A **
14933549-G-T 12821614-G-T **
14845319-G-T 12733385-G-T **
14832138-C-A 12720205-C-A **
14815458-A-C 12703529-A-C **
14700909-C-A 12588975-C-A **
15202402-A-G 13090488-A-G **
15442650-A-C 13330770-A-C **
14554374-C-A 12442575-C-A **
56763544-A-C **
16625456-G-T 14513576-G-T **
16603307-C-A 14491427-C-A **
16539806-T-C 14427926-T-C **
28766281-T-G 26620134-T-G **
4961783-CA-C 5093742-CA-C 11×A**
28814979-G-A 26668832-G-A **
16458337-C-A 14346457-C-A **
28819314-T-C 26673167-T-C **
16458133-C-A 14346253-C-A **
16399930-C-A 14288050-C-A **
16279409-T-G 14167529-T-G **
15490527-C-G 13378647-C-G **
16214337-C-A 14102457-C-A **
16092924-A-C 13981044-A-C **
16053511-C-A 13941631-C-A **
16021232-C-A 13909352-C-A **
56838791-G-T **
15940305-T-A 13828425-T-A **
15863041-C-A 13751161-C-A **
56858332-G-C **
15831596-C-A 13719716-C-A **
15635893-C-A 13524013-C-A **
14589278-C-A 12477478-C-A **
14513098-GT-G 12401303-GT-G **
14549807-C-A 12438008-C-A **
14738212-T-C 12626280-T-C **
13323818-A-G 11168142-A-G **
13480900-C-T 11325224-C-T **
13460169-C-A 11304493-C-A **
13322456-A-C 11166780-A-C **
13322399-T-G 11166723-T-G **
13319044-T-G 11163368-T-G **
13215414-G-A 11059738-G-A FT441002 **
11035396-CTACTT-C **
11024983-T-A **
11019630-G-T **
11007492-C-T **
13557863-G-GA 11402187-G-GA 9×A**
11007485-C-T **
11005541-T-G **
11005457-C-A **
11005445-T-G **
11005422-C-G **
11005418-C-A **
11005409-T-A **
11005394-G-A **
11005393-T-C **
10997112-C-T FT439701 **
9034466-G-T 9196857-G-T **
13588292-C-A 11432616-C-A **
16706898-C-A 14595018-C-A **
14273500-G-T 12152794-G-T **
14488311-C-T 12367580-C-T **
14474883-T-G 12354152-T-G FT149164 **
14463287-C-A 12342560-C-A **
14424114-G-T 12303389-G-T **
14423902-A-T 12303177-A-T **
14366506-A-C 12245801-A-C **
14358399-C-A 12237694-C-A **
14324611-C-A 12203905-C-A **
24602321-G-GTT 22456174-G-GTT P3_t2 **
14285977-T-C 12165271-T-C **
14195044-G-T 12074338-G-T **
25929684-T-C 23783537-T-C P1_Y1 **
14062049-C-A 11941343-C-A **
13880130-C-A 11759424-C-A **
13872691-C-A 11751985-C-A **
10961488-A-T **
13821322-C-A 11700616-C-A **
9620105-GA-G 9782496-GA-G IR3_Prx 11×A**
13821302-C-A 11700596-C-A **
11676891-G-T **
11676882-G-A **
11643731-ATG-A **
16635912-C-A 14524032-C-A **
28700499-C-A 26554352-C-A **
16739450-C-A 14627570-C-A **
26192786-A-T 24046639-A-T P1_Y1 **
22210602-CA-C 20048716-CA-C **
22167827-C-A 20005941-C-A **
22080877-T-G 19918991-T-G **
21954424-C-A 19792538-C-A **
21950468-T-C 19788582-T-C **
21912251-A-T 19750365-A-T **
21863777-C-A 19701891-C-A **
21862102-T-G 19700216-T-G **
26192765-G-T 24046618-G-T P1_Y1 **
26192775-A-T 24046628-A-T P1_Y1 **
21588193-G-T 19426307-G-T **
22223250-G-T 20061364-G-T DYZ19 **
21584133-C-A 19422247-C-A **
21394739-T-G 19232853-T-G **
21375771-A-C 19213885-A-C **
21324245-G-T 19162359-G-T **
21299398-A-C 19137512-A-C **
21068337-C-A 18906451-C-A **
20938728-T-A 18776842-T-A P4_Dst **
20938688-T-A 18776802-T-A P4_Dst **
20938674-T-A 18776788-T-A P4_Dst **
26192796-A-T 24046649-A-T P1_Y1 **
22223177-G-T 20061291-G-T DYZ19 **
22237678-G-GGACTCTA 20075792-G-GGACTCTA DYZ19 **
26383328-C-A 24237181-C-A P1_Y1 **
23261505-T-C 21099619-T-C **
24167273-C-A 22021126-C-A P3_b1 **
24611451-G-T 22465304-G-T P3_t2 **
23954120-C-A 21807973-C-A **
23825330-C-A 21663444-C-A **
23625366-C-A 21463480-C-A **
25863210-T-A 23717063-T-A P1_Y1 **
23529806-C-A 21367920-C-A **
23482918-A-G 21321032-A-G FGC29502 **
23386419-C-A 21224533-C-A **
23293628-A-C 21131742-A-C **
23256377-A-C 21094491-A-C **
22237687-A-C 20075801-A-C DYZ19 **
25863226-T-A 23717079-T-A P1_Y1 **
23037128-C-A 20875242-C-A **
22974721-C-A 20812835-C-A **
22809773-A-C 20647887-A-C **
22629839-C-A 20467953-C-A **
22522388-C-A 20360502-C-A **
25881240-T-A 23735093-T-A P1_Y1 **
25881275-G-T 23735128-G-T P1_Y1 **
22295295-C-A 20133409-C-A BY216592 DYZ19 **
25990634-GTTTTTT-G 23844487-GTTTTTT-G P1_Y1 23×T**
20938670-T-A 18776784-T-A P4_Dst **
20938669-T-A 18776783-T-A P4_Dst **
24485840-A-G 22339693-A-G **
28497091-C-A 26350944-C-A **
28091459-CACA-C 25945312-CACA-C P1_Y2 **
28468755-A-C 26322608-A-C **
18321276-T-TC 16209396-T-TC P6_Prx **
28483679-A-C 26337532-A-C **
18263932-C-A 16152052-C-A **
18212471-T-A 16100591-T-A **
18205009-G-A 16093129-G-A **
18191706-G-T 16079826-G-T **
18153743-C-A 16041863-C-A **
18146434-A-C 16034554-A-C **
18067173-C-A 15955293-C-A **
18378926-A-T 16267046-A-T P6_Prx **
17923505-G-T 15811625-G-T **
3384623-G-A 3516582-G-A **
17663145-C-A 15551265-C-A **
17544851-T-G 15432971-T-G **
17324147-G-A 15212267-G-A **
17323525-A-T 15211645-A-T **
17283281-C-A 15171401-C-A **
17183198-G-A 15071318-G-A **
17103359-G-T 14991479-G-T **
17056842-T-G 14944962-T-G **
18365608-T-A 16253728-T-A P6_Prx **
18422699-T-G 16310819-T-G P6_Gap **
20840332-T-G 18678446-T-G P4_Gap **
19248191-A-G 17136311-A-G **
20693706-T-G 18531820-T-G P4_Prx **
19678010-C-G 17566130-C-G P5_Prx **
26383340-C-A 24237193-C-A P1_Y1 16×T**
19678004-T-A 17566124-T-A P5_Prx **
19678002-G-A 17566122-G-A P5_Prx **
19610392-C-A 17498512-C-A P5_Prx **
19412504-C-A 17300624-C-A **
19375320-G-T 17263440-G-T **
19358633-C-A 17246753-C-A **
27603670-G-T 25457523-G-T P1_Y2 **
19183516-ATTTTTTT-A 17071636-ATTTTTTT-A 13×T**
18447621-G-GTTT 16335741-G-GTTT P6_Dst 18×T**
19122082-C-G 17010202-C-G **
18986999-G-A 16875119-G-A **
18966113-C-A 16854233-C-A **
18937270-C-A 16825390-C-A **
2897610-G-A 3029569-G-A **
18754825-C-A 16642945-C-A **
18701822-C-T 16589942-C-T **
27757467-C-A 25611320-C-A P1_Y2 **
18524431-C-A 16412551-C-A P6_Dst **
18480370-C-T 16368490-C-T P6_Dst **
10974816-GCCACT-G **
13821317-G-T 11700611-G-T **
10973545-T-G **
13489317-G-C 11333641-G-C BY26220 **
13705485-G-A 11549809-G-A **
23742276-C-A 21580390-C-A **
16896539-CAAAAA-C 14784659-CAAAAA-C 17×A**
10770523-C-A **
21984034-G-T 19822148-G-T **
10821930-T-C **
10746665-T-C **
10746658-A-C **
10746655-C-T **
10746654-A-T **
10746643-A-C **
8674107-C-A 8806066-C-A **
13489309-G-C 11333633-G-C BY26218 **
2770786-C-A 2902745-C-A **
10964633-T-A **
10986821-C-A **
10986810-A-ACTT **
13695471-G-A 11539795-G-A **
10807295-C-A **
21262718-C-A 19100832-C-A **
10986837-C-T FT439304 **
10986836-C-G **
10986828-A-G **
10986823-A-G **
10986818-A-G **
11003750-C-G **
2651915-T-A 2783874-T-A **
2860231-C-A 2992190-C-A **
21152066-C-A 18990180-C-A **
5212492-C-A 5344451-C-A **
6535164-T-G 6667123-T-G **
6492515-A-C 6624474-A-C **
6479689-G-T 6611648-G-T **
6330132-A-T 6462091-A-T IR3_Dst **
10964621-T-C **
6201744-T-A 6333703-T-A IR3_Dst **
6120286-C-A 6252245-C-A **
6090805-A-T 6222764-A-T **
5650878-A-G 5782837-A-G **
5614617-C-A 5746576-C-A **
18134911-TC-T 16023031-TC-T **
5393414-T-G 5525373-T-G **
5022120-C-A 5154079-C-A **
18324114-A-C 16212234-A-C P6_Prx **
4955587-T-A 5087546-T-A **
4630237-C-A 4762196-C-A **
4433137-T-C 4565096-T-C **
4389580-C-A 4521539-C-A **
4208839-C-A 4340798-C-A **
4131946-C-A 4263905-C-A **
3865950-A-G 3997909-A-G **
3593251-A-C 3725210-A-C **
3250798-C-A 3382757-C-A **
3164574-C-A 3296533-C-A **
3109429-G-T 3241388-G-T **
3109334-G-T 3241293-G-T **
11003749-A-G **
20774943-A-G 18613057-A-G P4_Prx **
6831938-C-A 6963897-C-A **
21766533-A-AATAT 19604647-A-AATAT 19×AT**
17567384-C-A 15455504-C-A **
10927233-C-CATTGA **
10761199-T-A **
10658596-T-A **
22353453-G-C 20191567-G-C DYZ19 **
28794222-G-T 26648075-G-T **
13489361-G-T 11333685-G-T **
15080781-C-A 12968871-C-A **
22767972-T-A 20606086-T-A **
5785693-ATCCTGC-A 5917652-ATCCTGC-A **
13489313-G-A 11333637-G-A BY26219 **
16181300-C-A 14069420-C-A **
59004260-C-T 56858113-C-T **
6992571-G-T 7124530-G-T **
22767974-G-T 20606088-G-T **
15363917-G-A 13252037-G-A **
14458397-C-A 12337670-C-A **
14428121-GGTA-G 12307396-GGTA-G 6×GTA**
22840506-G-T 20678620-G-T **
22223237-G-T 20061351-G-T DYZ19 **
23226144-T-C 21064258-T-C **
27967353-T-G 25821206-T-G P1_Y2 **
13489328-G-A 11333652-G-A BY26221 **
22240013-G-T 20078127-G-T DYZ19 **
13139411-C-A 10628897-C-A **
18378959-C-CT 16267079-C-CT P6_Prx 28×T**
10986874-T-G **
10663412-T-TTACTG **
16034276-C-A 13922396-C-A **
10673502-C-A **
10900046-T-C **
10900035-A-G **
10900034-A-T **
17718412-G-GTT 15606532-G-GTT 20×T**
11669602-TTGGAATTGAATGGAA-T **
11643719-G-C **
10892645-A-C **
21449007-CA-C 19287121-CA-C **
3991898-C-A 4123857-C-A **
10673507-GATTCC-G **
10673518-A-T **
10673507-G-T **
10673496-G-C **
15363923-A-G 13252043-A-G **
10673493-A-T **
10673466-C-G **
21631496-G-A 19469610-G-A **
19595595-T-G 17483715-T-G P5_Prx **
10759822-C-T **
10759812-T-C **
10759802-C-T **
10759797-T-A **
10825295-C-G **
10031281-C-A 10193672-C-A **
10986891-CCA-C **
19127627-CAAA-C 17015747-CAAA-C 17×A**
6755788-T-A 6887747-T-A **
6267656-A-C 6399615-A-C IR3_Dst **
10973575-T-G **
10794237-T-TCCCCA **
10825274-G-A **
10814905-A-C **
10807355-C-T **
17124471-T-C 15012591-T-C **
10805770-C-T **
10805536-G-T **
10801780-T-TA **
10801367-C-A **
10796679-T-G **
10796663-A-C **
10796654-T-A **
10792471-C-A **
10835511-C-G **
10792470-T-C **
10792437-C-T **
10792432-C-A **
10792210-C-A **
10781234-C-G **
10776409-C-A **
10770136-A-C **
10764578-T-TCGAGTAGAAC **
6858651-G-T 6990610-G-T **
10764548-T-C **
10763060-C-T **
10760017-T-G **
10826924-CACTCA-C **
10835529-T-C **
10755448-A-T **
10921940-G-A **
10964272-C-A **
10946779-CTCCAT-C **
10940388-T-A **
10935055-T-C **
10932969-C-T **
10932957-C-T **
10932956-A-C **
10932932-T-A **
10932105-G-T **
10925531-T-G **
10922210-T-A **
10895858-TT-C **
10835532-C-T **
10895846-C-T **
10895798-TTCCATTCCGTTCCTC-T **
15576848-C-T 13464968-C-T **
10893120-C-A **
10892827-C-T **
10892822-T-A **
10881368-G-T **
10881338-G-C **
10881334-C-T **
10879707-C-A **
10835548-A-C **
10835534-T-C **
10759821-A-T **
10764554-C-CGGGTT **
10747026-T-TCCCTC **
9531234-G-GCA 9693625-G-GCA IR3_Prx **
7305627-C-A 7437586-C-A **
7311686-C-A 7443645-C-A **
9655524-C-A 9817915-C-A IR3_Prx **
7390705-C-A 7522664-C-A **
9620038-A-C 9782429-A-C IR3_Prx **
18134788-G-A 16022908-G-A **
7418666-C-A 7550625-C-A **
9601492-GT-G 9763883-GT-G IR3_Prx **
10691472-C-A **
7656864-G-T 7788823-G-T **
7264907-C-A 7396866-C-A **
17519233-T-A 15407353-T-A **
7768502-C-A 7900461-C-A **
9023086-G-T 9185477-G-T **
8854210-C-A 8986169-C-A **
8807095-T-G 8939054-T-G **
8669897-C-A 8801856-C-A **
8333480-TTTCTTCTTCTTCTTCTTCTTC-T 8465439-TTTCTTCTTCTTCTTCTTCTTC-T 31×TTC**
8270021-G-A 8401980-G-A **
8117284-G-T 8249243-G-T **
8016944-T-G 8148903-T-G **
7824843-C-A 7956802-C-A **
9940092-C-A 10102483-C-A **
9940674-C-A 10103065-C-A **
9944779-A-G 10107170-A-G **
10691114-A-G **
6930600-C-A 7062559-C-A **
6930773-T-G 7062732-T-G **
7000473-C-A 7132432-C-A **
10661437-G-T **
10660071-G-T **
10658610-T-A **
10628908-C-A **
7107580-C-A 7239539-C-A **
10628888-C-A **
7209890-C-A 7341849-C-A **
10628883-C-A **
10628878-C-A **
10015974-A-G 10178365-A-G **
9997857-G-T 10160248-G-T **
9964195-C-A 10126586-C-A **
7242546-T-A 7374505-T-A **
9945559-G-T 10107950-G-T **
7242561-T-G 7374520-T-G **
9944936-C-A 10107327-C-A **
15388469-A-G 13276589-A-G ***
6008627-A-G 6140586-A-G ***
14926462-CAAAAAAAAAA-C 12814527-CAAAAAAAAAA-C 26×A***
13612940-G-T 11457264-G-T ***
2941940-A-T 3073899-A-T ***
8094951-C-T 8226910-C-T ***
14574709-T-C 12462909-T-C ***
6404388-A-G 6536347-A-G ***
18615932-CTTTTTTTTTTT-C 16504052-CTTTTTTTTTTT-C 27×T***
18607365-CATATAT-C 16495485-CATATAT-C 10×AT***
17230162-TAA-T,TA 15118282-TAA-T,TA 14×A***
18875149-A-G 16763269-A-G ***
2856782-CTT-C,CT 2988741-CTT-C,CT 24×T***
4517563-A-G 4649522-A-G ***
6404394-A-T 6536353-A-T ***
21476135-T-A 19314249-T-A ***
13463183-TAC-CGT,T 11307507-TAC-CGT,T ***
17626888-C-A 15515008-C-A ***
6404387-A-C,T 6536346-A-C,T ***
6671807-A-G 6803766-A-G ***
15497972-AT-A,A 13386092-AT-A,A 26×T***
16783599-G-A 14671719-G-A ***
7438038-A-G 7569997-A-G ***
5757308-CAAAA-C,CAA 5889267-CAAAA-C,CAA 18×A***
6521551-GTT-G,GT 6653510-GTT-G,GT 17×T***
5380518-CAAA-C 5512477-CAAA-C 16×A***
2941952-T-C 3073911-T-C ***
13485899-A-G 11330223-A-G ***
4583091-G-T 4715050-G-T ***
13469049-A-T 11313373-A-T ***
13463042-G-A 11307366-G-A ***
11017624-G-A,C ***
10937491-G-A ***
10915970-G-T ***
10893970-G-T ***
10807243-C-A ***
10807240-T-C ***
10672084-C-A ***
9498943-C-A 9661334-C-A ***
7975773-A-G 8107732-A-G ***
7400894-C-A 7532853-C-A ***
5446828-C-A 5578787-C-A ***
2862892-CAAAA-C,CAAAAA 2994851-CAAAA-C,CAAAAA 18×A***
28814862-T-A 26668715-T-A ***
13463066-A-G 11307390-A-G ***
13480386-G-C 11324710-G-C ***
10986848-A-T ***
21185196-T-G 19023310-T-G ***
11003741-T-C ***
13470444-T-TCTCC 11314768-T-TCTCC ***
10987830-A-AC ***
19183814-CTTTT-C 17071934-CTTTT-C 28×T***
13470427-G-A 11314751-G-A ***
58979060-C-A,G 56832913-C-A,G ***
18573614-TAC-T 16461734-TAC-T ***
14009684-G-A 11888978-G-A ***
18931179-GT-G 16819299-GT-G 12×T***
13301571-A-AT 11145895-A-AT 10×T***
13463052-G-T 11307376-G-T ***
13468241-A-T 11312565-A-T ***
3595159-G-GA 3727118-G-GA 10×A***
19408561-G-T 17296681-G-T ***
15184385-C-. 13072471-G-C ***
56828923-TCATTCCATTCCATTCCATTCCATTCCATGTCATTCCATTC-T,TCATTCCATTCCATTGTATTCCATTC 5×CATTC***
56833670-CT-C ***
28800591-G-A 26654444-G-A ***
28768370-C-A 26622223-C-A ***
24502877-C-A 22356730-C-A ***
23841193-G-T 21679307-G-T ***
23579177-C-A 21417291-C-A ***
23207974-TTC-T 21046088-TTC-T ***
22721757-GT-G 20559871-GT-G 10×T***
22590672-C-A 20428786-C-A ***
21748400-G-T 19586514-G-T ***
19415110-C-A 17303230-C-A ***
18933523-C-G 16821643-C-G ***
13869049-GGACTC-G 11748343-GGACTC-G ***
18868472-A-AT 16756592-A-AT 8×T***
18085155-AAAAAG-A 15973275-AAAAAG-A 4×AAAAG***
17874683-C-A 15762803-C-A ***
17054866-AATAT-A,AAT 14942986-AATAT-A,AAT 13×AT***
16475472-A-G 14363592-A-G ***
15993724-C-A 13881844-C-A ***
15971783-G-T 13859903-G-T ***
15859502-C-A 13747622-C-A ***
15669964-CAAAAAA-C 13558084-CAAAAAA-C 18×A***
15413345-C-A 13301465-C-A ***
15394188-G-C 13282308-G-C ***
15221634-C-A 13109720-C-A ***
14232642-C-A 12111936-C-A ***
13935353-C-A 11814647-C-A ***
28587144-T-C 26440997-T-C ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 596085932784376720657584198
Kit: 5960851500448593849178310975
Used in age calculations1500448593849178310975
Counts of SNPs1412
Variant counts last updated 2022-11-24 03:20:43.



Big Tree Main Page