Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > DF21/S192 > FGC3213 > ZZ1 > S3058 > S424 > S426 > S190 > FGC3215 > FGC3216 > FGC3197 > FGC3198

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFB38
709663-A
BigY2
709663
Manual
Edits
20030050-G-T 17918170-G-T P5_Prx *A*
25933641-C-G 23787494-C-G P1_Y1 *A*
23074212-C-A 20912326-C-A BY142807 YY++
22473384-C-G 20311498-C-G BY21254 DYZ19 +
22473385-T-G 20311499-T-G DYZ19 +
22473381-A-G 20311495-A-G BY222905 DYZ19 +
22293785-G-A 20131899-G-A BY155255 DYZ19 ++
21142444-G-C 18980558-G-C BY130660 YY++
56832303-C-T,TCCATT *
56832495-CGCACTC-TG,TGCACTC *
56833944-CCT-ACT,CCA *
56836440-GT-AC,AT *
56837147-TC-GA,GC *
6402333-CGTATT-TTTATA 6534292-CGTATT-TTTATA *
8747696-T-TGA,TGAGA 8879655-T-TGA,TGAGA 18×GA*
19949035-ATT-GTC 17837155-ATT-GTC P5_Prx *
7053358-A-AAAAG,AAAAGAAAG 7185317-A-AAAAG,AAAAGAAAG 17×AAAG*
22473460-T-G 20311574-T-G DYZ19 *
56831874-ATTGCATTCCA-ATTACATCCT,TTTACATCCA *
20931853-A-ATGTG 18769967-A-ATGTG P4_Dst 18×TG*
13866450-GAACTGAAT-AAACGGAAC 11745744-GAACTGAAT-AAACGGAAC *
13452145-CCCCC-ACCCA 11296469-CCCCC-ACCCA *
13449095-TTCCACTCCACTCCAC-CTCCACTCCACTCCTT 11293419-TTCCACTCCACTCCAC-CTCCACTCCACTCCTT *
22360398-CGTCCAGCG-TCTAGCA,TGTCCAGCG 20198512-CGTCCAGCG-TCTAGCA,TGTCCAGCG DYZ19 *
22367547-GCAT-AGAG,GCAG 20205661-GCAT-AGAG,GCAG DYZ19 *
22421241-T-C 20259355-T-C DYZ19 *
22421267-GC-AG 20259381-GC-AG DYZ19 *
56831988-CTCTG-CTCTC,GTCTC *
56827687-TGATT-CGATT,TGATC *
56831758-ATCATG-ATCACT,GTCACT *
13489619-ACCCCCACCACCACCCA-TCACTCCACACACAAACC 11333943-ACCCCCACCACCACCCA-TCACTCCACACACAAACC *
13449811-TCGAT-CCGAC,TCGAC 11294135-TCGAT-CCGAC,TCGAC *
13450413-CCATTCCATTCCATTCTATTCCATTCCATTCCATTC-G 11294737-CCATTCCATTCCATTCTATTCCATTCCATTCCATTC-G *
13450521-CTTCACTCCACTCCATCC-ATCCATCCCATTCCATCA,CTCCATCC 11294845-CTTCACTCCACTCCATCC-ATCCATCCCATTCCATCA,CTCCATCC *
13450590-GCTCCATTCCATTCCATTCCATTCC-ACTCCATTCCATTCCATTCT,GCTCCATTCCATTCCATTCC 11294914-GCTCCATTCCATTCCATTCCATTCC-ACTCCATTCCATTCCATTCT,GCTCCATTCCATTCCATTCC *
13450721-TATTCCG-AATTGCA 11295045-TATTCCG-AATTGCA *
13451185-CTCCTTT-CTCCATTC,TTC 11295509-CTCCTTT-CTCCATTC,TTC *
13451485-ATTCTG-ATTCCA,GTTCCA 11295809-ATTCTG-ATTCCA,GTTCCA *
13489557-TTG-GTT 11333881-TTG-GTT *
13448613-TTGCTCCA-GTGTTCCG 11292937-TTGCTCCA-GTGTTCCG *
56831681-G-C,CATTCC *
13869648-TGGAG-CGGAT 11748942-TGGAG-CGGAT *
13869679-TGA-CAT,TAT 11748973-TGA-CAT,TAT *
15305890-G-AT,ATAG 13193992-G-AT,ATAG *
21971660-G-GA,GAA 19809774-G-GA,GAA 11×A*
27699959-TAT-CAC,CACATAT 25553812-TAT-CAC,CACATAT P1_Y2 *
56826418-TATTCC-CATTCCATTCG,TATTCCATTCA *
56826706-CAATTC-ATATTC,CTATTA *
22473342-GATTG-TATTT 20311456-GATTG-TATTT DYZ19 *
56829589-TCCAT-CACAC,TACAC *
22504503-C-A 20342617-C-A DYZ19 *
13449514-C-T,TTCCAT 11293838-C-T,TTCCAT *
22473381-ACACT-ACAGT,GCAGG 20311495-ACACT-ACAGT,GCAGG DYZ19 *
25273788-ATT-A,AT 23127641-ATT-A,AT P2_r1 21×T*
22473468-TTTCTTCCTTC-ATTGTTGCTTT 20311582-TTTCTTCCTTC-ATTGTTGCTTT DYZ19 *
22473415-G-C 20311529-G-C DYZ19 ***
7190277-A-G 7322236-A-G FGC1579 F922 YY**
22473453-TTG-CTA 20311567-TTG-CTA DYZ19 *
22421299-A-G 20259413-A-G DYZ19 *
20778781-TTG-T,TTGTGTG 18616895-TTG-T,TTGTGTG P4_Prx 18×TG*
7203486-CTG-C 7335445-CTG-C **
7177189-A-G 7309148-A-G YY**
7220727-G-A 7352686-G-A YY**
7073423-A-G 7205382-A-G YY**
22473443-G-A 20311557-G-A DYZ19 *
24165234-A-T 22019087-A-T P3_b1 *
10911722-ATGT-CTGA **
10851011-ATTGCAC-TTTCCAA **
10911684-CATC-AATA **
10895807-GTTCCTC-ATTCTAT **
10877829-AA-TC **
17713850-C-A 15601970-C-A 23×T**
56839768-T-A **
10911770-CGAGA-AGAGG **
56849702-A-G **
10987289-AGCT-GGCA **
10565-G-T **
11010767-TCATTCCGTTC-CCACTCCATTG **
56844547-C-A **
11030257-GCTGTTGT-CCTGGACG **
11031514-A-T **
13281897-C-A 11126221-C-A **
13336653-G-T 11180977-G-T **
56838379-G-T ****
28798603-C-A 26652456-C-A *****
28684349-G-T 26538202-G-T **
28550504-G-T 26404357-G-T **
23569476-C-A 21407590-C-A ****
23338938-C-A 21177052-C-A ****
23123148-C-A 20961262-C-A *****
13716577-G-A 11560901-G-A **
27894880-GTA-G 25748733-GTA-G P1_Y2 **
20107274-G-T 17995394-G-T P5_Dst **
6114544-G-T 6246503-G-T **
26376230-C-A 24230083-C-A P1_Y1 **
25868973-G-T 23722826-G-T P1_Y1 **
24631297-G-T 22485150-G-T P3_t2 **
20855621-T-A 18693735-T-A P4_Dst **
27853937-C-T 25707790-C-T P1_Y2 **
28096523-G-T 25950376-G-T P1_Y2 **
20859789-GA-G 18697903-GA-G P4_Dst 13×A**
20748768-T-A 18586882-T-A P4_Prx **
19209891-A-G 17098011-A-G **
20529001-G-T 18367115-G-T P5_Dst **
20474703-G-T 18312817-G-T P5_Dst **
6114527-A-T 6246486-A-T **
20387667-G-T 18225781-G-T P5_Dst **
7536050-AAAAAAAAAAAAAAAAAAAAAGC-TTAAAATTAAAT 7668009-AAAAAAAAAAAAAAAAAAAAAGC-TTAAAATTAAAT **
13698751-G-T 11543075-G-T **
9056857-AGAT-GGAC **
9056873-CTG-TCTCTC **
10663871-CCA-TCC **
10678039-CTCCAC-TTCAAT **
20220698-C-A 18058812-C-A P5_Dst **
19680083-G-T 17568203-G-T P5_Prx **
10747110-CACG-GACA **
19631269-A-T 17519389-A-T P5_Prx **
10770733-C-T **
10799447-CCA-TCG **
18515844-G-T 16403964-G-T P6_Dst **
13745515-A-T 11589839-A-T **
10678605-CC-TT **
10678595-ATCCAC-TTCTAT **
10884837-CTTTCCATTCC-T **
28261883-TCAAA-T 26115736-TCAAA-T P1_b4 5×CAAA**
13708216-G-T 11552540-G-T **
25422190-CTT-C 23276043-CTT-C P2_r2 16×T**
22504551-CTTTAGTGTTAA-GGTGTGTGATAC 20342665-CTTTAGTGTTAA-GGTGTGTGATAC DYZ19 **
21777804-GA-G **
24132046-G-A 21985899-G-A P3_b1 **
24144837-A-T 21998690-A-T P3_b1 **
24558958-ACCCCTT-A 22412811-ACCCCTT-A P3_t2 **
24638498-C-A 22492351-C-A P3_t2 **
24639494-T-A 22493347-T-A P3_t2 **
24658501-C-A 22512354-C-A P3_b2 **
24670251-A-G 22524104-A-G P3_b2 **
24716385-G-T 22570238-G-T P3_b2 **
24864145-G-T 22717998-G-T IR1_R **
25004871-G-T 22858724-G-T g1 **
25224804-C-A 23078657-C-A P2_r1 **
25230840-A-G 23084693-A-G P2_r1 **
25631770-A-T 23485623-A-T P1_b3 **
22501690-C-G 20339804-C-G DYZ19 **
27377330-G-T 25231183-G-T P1_g3 **
28010971-GC-G 25864824-GC-G P1_Y2 **
27940913-GA-G 25794766-GA-G P1_Y2 **
27809502-TCCC-ATCT 25663355-TCCC-ATCT P1_Y2 **
27761289-G-T 25615142-G-T P1_Y2 **
27563934-C-A 25417787-C-A P1_Y2 **
27428779-A-T 25282632-A-T P1_g3 **
27348740-G-T 25202593-G-T P1_g3 **
25655310-G-T 23509163-G-T P1_b3 **
27304482-G-T 25158335-G-T P1_g3 **
26994345-A-G 24848198-A-G P1_r4 **
26730201-A-T 24584054-A-T P1_g2 18×AAAG**
25878440-T-A 23732293-T-A P1_Y1 **
25658918-C-A 23512771-C-A P1_b3 **
25658880-G-T 23512733-G-T P1_b3 **
22504544-CCA-ACT 20342658-CCA-ACT DYZ19 **
22501662-C-T 20339776-C-T DYZ19 **
13708757-C-A 11553081-C-A **
28582762-G-T 26436615-G-T **
9552316-C-A 9714707-C-A IR3_Prx **
9221706-TATATATAT-C 9384097-TATATATAT-C **
6403154-GTA-AT 6535113-GTA-AT **
56702723-A-T **
23062626-A-G 20900740-A-G *****
56676572-A-T **
23747234-TAGTC-ATTA 21585348-TAGTC-ATTA **
18283210-C-A 16171330-C-A P6_Prx **
23110567-G-T 20948681-G-T **
17520774-G-T 15408894-G-T **
14718864-T-C 12606932-T-C **
11647708-NN-AT **
13727560-G-T 11571884-G-T **
13708805-A-T 11553129-A-T **
18013022-TTTTC-T 15901142-TTTTC-T P7_Dst **
18335262-C-A 16223382-C-A P6_Prx **
22501611-G-T 20339725-G-T DYZ19 **
22322286-A-G 20160400-A-G DYZ19 **
22501610-T-A 20339724-T-A DYZ19 **
22481956-TTGTG-ATGTC 20320070-TTGTG-ATGTC DYZ19 **
22481198-A-T 20319312-A-T DYZ19 **
22481196-T-C 20319310-T-C DYZ19 **
22352486-AGAGTTTTTTCCTTT-TGAGTTTTTTTCCTTC 20190600-AGAGTTTTTTCCTTT-TGAGTTTTTTTCCTTC DYZ19 **
22322961-A-T 20161075-A-T DYZ19 **
20432033-C-A 18270147-C-A P5_Dst **
19209881-T-C 17098001-T-C **
20364426-C-A 18202540-C-A P5_Dst **
20251651-TCCAGGGTTAC-T 18089765-TCCAGGGTTAC-T P5_Dst **
20233143-A-T 18071257-A-T P5_Dst **
20084667-C-A 17972787-C-A P5_Dst **
19704231-TGG-T 17592351-TGG-T P5_Prx 13×G**
19209886-T-A 17098006-T-A **
56680537-T-A **
21771569-G-T **
22473429-T-C 20311543-T-C DYZ19 **
10818736-T-A **
10838148-C-A ****
10827305-C-A ****
10827084-C-A **
10827080-A-T **
10818760-C-T **
10818747-T-A **
10801504-C-A **
10883599-T-C **
25537117-G-GT 23390970-G-GT P1_gr1 10×T**
10801503-A-C **
10786163-C-A *****
10781340-A-T **
10759320-C-G **
10756591-TTC-T ****
10883597-A-C **
10912210-A-G **
24387347-CAT-C 22241200-CAT-C ****
10977132-C-A ****
11020884-C-A ****
11010770-T-C **
11010759-A-T ****
11004062-C-A *****
10983095-C-A ****
10982389-T-C *****
10922342-T-G **
10919878-C-A ****
10922333-T-C **
25456551-GATAT-G 23310404-GATAT-G P2_r2 20×AT**
22329951-T-G 20168065-T-G DYZ19 **
10922325-C-A **
10922290-C-CTATA **
10922286-T-A **
58914170-C-T 56676701-G-A **
13461283-G-C 11305607-G-C **
13505011-C-A 11349335-C-A *****
2977208-C-A 3109167-C-A ****
4896649-CAAA-C 5028608-CAAA-C 16×A**
27809490-CAGAC-TAGAT 25663343-CAGAC-TAGAT P1_Y2 **
4722399-G-T 4854358-G-T **
4463073-G-A 4595032-G-A **
3478880-C-A 3610839-C-A ****
3294459-C-A 3426418-C-A ****
59026236-TACC-CACT 56880089-TACC-CACT **
5572338-C-A 5704297-C-A ****
22434855-CA-AC 20272969-CA-AC DYZ19 **
23121025-G-A 20959139-G-A **
27072034-CAA-C 24925887-CAA-C P1_r4 14×A**
6204749-A-G 6336708-A-G IR3_Dst **
58910388-C-G 56680483-G-C **
58981637-TCC-CCCCTCCA 56835490-TCC-CCCCTCCA **
5135386-A-T 5267345-A-T ****
5739052-G-T 5871011-G-T **
10749881-C-A ****
10667021-T-C **
10746680-T-A **
10746670-T-C **
10693079-C-A **
10686921-T-C **
10669682-T-A **
10667581-C-A ****
10666988-C-G **
27881475-C-CT 25735328-C-CT P1_Y2 12×T**
10003551-G-T 10165942-G-T *****
9442189-G-T 9604580-G-T ****
9125485-C-A ****
28160822-CT-C 26014675-CT-C P1_b4 22×T**
27809442-T-C 25663295-T-C P1_Y2 **
7081303-C-A 7213262-C-A *****
22473427-A-T 20311541-A-T DYZ19 **
11031569-ACCATTCCATTCCATTCCATTCCATTCCATTCCATT-A **
22329960-A-T 20168074-A-T DYZ19 **
13507803-C-A 11352127-C-A **
27773675-C-CT 25627528-C-CT P1_Y2 9×T**
21107861-C-A 18945975-C-A ****
14267130-T-C 12146424-T-C *****
22499133-T-A 20337247-T-A DYZ19 **
14695404-C-A 12583470-C-A ****
14720132-G-T 12608200-G-T **
15160621-C-A 13048707-C-A *****
19809869-T-G 17697989-T-G BY49474 P5_Prx **
15185948-G-T 13074034-G-T ****
15641582-A-T 13529702-A-T ****
25452458-G-GT 23306311-G-GT P2_r2 13×T**
27809437-C-A 25663290-C-A P1_Y2 **
22492913-C-G 20331027-C-G DYZ19 **
16055924-C-A 13944044-C-A ****
16424921-C-A 14313041-C-A *****
16426448-C-T 14314568-C-T ****
19544401-A-C 17432521-A-C **
22492917-C-A 20331031-C-A DYZ19 **
13744039-A-G 11588363-A-G **
19412924-C-A 17301044-C-A *****
16574577-G-T 14462697-G-T ****
20230710-T-G 18068824-T-G P5_Dst **
17378333-G-T 15266453-G-T ****
18902576-C-A 16790696-C-A ****
14075394-C-A 11954688-C-A ****
14674881-T-C 12562947-T-C **
27809465-T-C 25663318-T-C P1_Y2 **
22481930-G-T 20320044-G-T DYZ19 **
22504570-C-A 20342684-C-A DYZ19 **
58916150-CTCC-TTCA 56674718-GGAG-TGAA **
22308503-C-A 20146617-C-A DYZ19 **
13912925-G-T 11792219-G-T ****
11650755-C-A *****
19025638-T-G 16913758-T-G FGC77954 **
13943605-G-T 11822899-G-T ****
22309326-G-A 20147440-G-A DYZ19 **
21581623-C-A 19419737-C-A **
13952337-G-T 11831631-G-T ****
22491804-T-G 20329918-T-G DYZ19 **
27541275-G-T 25395128-G-T P1_Y2 ***
22473391-G-T 20311505-G-T DYZ19 ***
25717179-C-CA 23571032-C-CA P1_b3 15×A***
20346436-GTGTAGTAAAAGT-G 18184550-GTGTAGTAAAAGT-G P5_Dst ***
20883133-C-A 18721247-C-A P4_Dst ***
13481425-GGTGATC-CGAGATA 11325749-GGTGATC-CGAGATA ***
22352624-G-T 20190738-G-T DYZ19 ***
21023249-GT-G,GTT 18861363-GT-G,GTT P4_Dst 14×T***
27793173-G-C 25647026-G-C P1_Y2 ***
25247640-C-CA 23101493-C-CA P2_r1 15×A***
20211455-T-C 18049569-T-C P5_Dst ***
22352717-G-C 20190831-G-C DYZ19 ***
28245703-C-A 26099556-C-A P1_b4 ***
22311536-A-G 20149650-A-G DYZ19 ***
27936764-CA-C,CAA 25790617-CA-C,CAA P1_Y2 15×A***
25142318-G-T 22996171-G-T g1 19×T***
20506047-GCACT-TCACC 18344161-GCACT-TCACC P5_Dst ***
20884980-G-T 18723094-G-T P4_Dst ***
20897829-C-A 18735943-C-A P4_Dst ***
20909697-AT-A 18747811-AT-A P4_Dst ***
27805876-C-A 25659729-C-A P1_Y2 ***
22296006-G-A 20134120-G-A DYZ19 ***
20858382-AT-A 18696496-AT-A P4_Dst ***
22311521-CCTC-ACTG 20149635-CCTC-ACTG DYZ19 ***
27579077-C-CA 25432930-C-CA P1_Y2 16×A***
22360196-CT-AG 20198310-CT-AG DYZ19 ***
27859756-C-A 25713609-C-A P1_Y2 ***
9370162-C-T 9532553-C-T ***
27792631-A-T 25646484-A-T P1_Y2 ***
27709182-G-T 25563035-G-T P1_Y2 ***
22360090-ACC-ACT,CCT 20198204-ACC-ACT,CCT DYZ19 ***
22501988-G-C 20340102-G-C DYZ19 ***
22500317-C-A 20338431-C-A DYZ19 ***
20207102-C-CA 18045216-C-CA P5_Dst 10×A***
20771714-GAA-G 18609828-GAA-G P4_Prx 25×A***
58914204-A-T 56676667-T-A ***
24018449-C-A 21872302-C-A ***
25280367-CTTT-C,CT 23134220-CTTT-C,CT P2_r1 26×T***
24035213-CTCAAACATA-ACTCAAACATA,CTCAAACAT 21889066-CTCAAACATA-ACTCAAACATA,CTCAAACAT ***
20108290-C-A 17996410-C-A P5_Dst ***
24548125-C-A 22401978-C-A P3_t2 ***
25185199-G-T 23039052-G-T g1 ***
25124690-C-A 22978543-C-A g1 ***
58914261-G-T 56676610-C-A ***
18439255-G-GT 16327375-G-GT P6_Dst 25×T***
24586008-G-T 22439861-G-T P3_t2 ***
24616369-G-T 22470222-G-T P3_t2 ***
24757525-G-T 22611378-G-T P3_b2 ***
24713450-T-A 22567303-T-A P3_b2 ***
24631744-GGGGT-G 22485597-GGGGT-G P3_t2 ***
22335808-C-T 20173922-C-T DYZ19 ***
24632278-G-T 22486131-G-T P3_t2 ***
27062987-TGTA-T 24916840-TGTA-T P1_r4 5×GTA***
20881862-CA-C 18719976-CA-C P4_Dst 16×A***
27033095-C-CT 24886948-C-CT P1_r4 17×T***
25650092-G-T 23503945-G-T P1_b3 ***
27381821-A-G 25235674-A-G P1_g3 ***
27198886-CAA-C 25052739-CAA-C P1_g3 11×A***
25500842-C-CA 23354695-C-CA P2_r2 10×A***
22492650-AT-CA 20330764-AT-CA DYZ19 ***
27361331-G-T 25215184-G-T P1_g3 ***
22503111-G-C 20341225-G-C DYZ19 ***
22494237-GTGTT-CTGTC 20332351-GTGTT-CTGTC DYZ19 ***
22494389-T-G 20332503-T-G DYZ19 ***
27207208-G-T 25061061-G-T P1_g3 ***
22499842-GATC-CTTT,GTTC 20337956-GATC-CTTT,GTTC DYZ19 ***
27193815-G-T 25047668-G-T P1_g3 ***
20230740-AAT-GAC 18068854-AAT-GAC P5_Dst ***
27125789-GA-G 24979642-GA-G P1_g3 8×A***
20230760-C-A 18068874-C-A P5_Dst ***
26946204-CTTA-ATT,CTT 24800057-CTTA-ATT,CTT P1_r3 ***
25727946-G-GAT 23581799-G-GAT P1_b3 14×AT***
25901082-C-A 23754935-C-A P1_Y1 ***
9372603-C-CT 9534994-C-CT 13×T***
22504481-G-A 20342595-G-A DYZ19 ***
14356890-CTTTT-C 12236185-CTTTT-C 17×T***
23678682-GT-G 21516796-GT-G 14×T***
20142236-C-A 18030356-C-A P5_Dst ***
7042962-G-T 7174921-G-T ******
20098149-G-T 17986269-G-T P5_Dst ***
13804320-G-T 11683614-G-T ***
16001436-G-T 13889556-G-T ******
15984499-C-A 13872619-C-A ***
19639332-C-A 17527452-C-A P5_Prx ***
20573243-G-T 18411357-G-T P5_Dst ***
13457708-C-A 11302032-C-A ******
24632587-G-T 22486440-G-T P3_t2 ***
14065911-CA-C 11945205-CA-C ******
25918151-G-T 23772004-G-T P1_Y1 ***
27782214-G-T 25636067-G-T P1_Y2 ***
28045739-C-A 25899592-C-A P1_Y2 ***
6308050-GCA-G 6440009-GCA-G IR3_Dst 9×CA***
16292054-C-A 14180174-C-A ******
11677303-GA-G ***
13723432-G-C 11567756-G-C ***
9320681-C-T 9483072-C-T ***
19647566-C-A 17535686-C-A P5_Prx ***
20867012-G-T 18705126-G-T P4_Dst ***
20894638-A-T 18732752-A-T P4_Dst ***
21002338-C-T 18840452-C-T P4_Dst ***
20751042-GA-G 18589156-GA-G P4_Prx 13×A***
13468310-T-C 11312634-T-C ***
13454568-A-G 11298892-A-G ***
20479175-A-AT 18317289-A-AT P5_Dst 8×T***
8854353-T-C 8986312-T-C ***
11030807-A-C,G ***
56763543-A-T ***
22300719-C-A 20138833-C-A DYZ19 ***
22164592-C-A 20002706-C-A ***
23352367-T-C 21190481-T-C ******
23803411-C-A 21641525-C-A ******
23876560-G-T 21714674-G-T ***
24422457-C-A 22276310-C-A ***
24475079-C-A 22328932-C-A ***
24517704-C-A 22371557-C-A ***
21397544-C-A 19235658-C-A ******
56763537-G-T ***
19422948-TCTC-T 17311068-TCTC-T 5×CTC***
22311531-T-A 20149645-T-A DYZ19 ***
19258424-C-A 17146544-C-A ******
18838704-TA-T 16726824-TA-T ***
18397900-GTA-G 16286020-GTA-G P6_Gap ******
17883677-C-A 15771797-C-A ***
20872427-A-T 18710541-A-T P4_Dst ***
13256130-C-A 11100454-C-A ***
17301276-G-T 15189396-G-T ***
17103887-G-T 14992007-G-T ******
18463148-G-T 16351268-G-T P6_Dst ***
22722338-CT-C,CTT 20560452-CT-C,CTT 24×T***
15904149-CAA-C,CA 13792269-CAA-C,CA 20×A***
11031723-C-A ***
10807293-TTCAA-GTCAT ***
20084748-C-A 17972868-C-A P5_Dst ***
56836683-TG-CA ***
56831390-ATTC-TTTCCACTTCATTT ***
56831409-TGTTCCATTC-CGTTTCATTCCATTG,CTTTTCATTCCATTC ***
6759230-C-A 6891189-C-A ***
6010204-C-A 6142163-C-A ***
5200373-G-A 5332332-G-A ***
56834455-TTCCATTCCCTTCCATTA-CTCCATTCCATTCCCTTCCCTTC ***
56834897-CAGG-CAGC,TAGT ***
56834966-C-A ***
56835426-CT-CA,TT ***
56835708-CAT-TAC ***
56846825-GAGAA-GAGAT,TAGAT ***
56830481-ATCT-GTCC ***
56850715-GA-CG,GG ***
7483638-TAA-T 7615597-TAA-T IR1_L 23×A***
7490533-G-T 7622492-G-T IR1_L ***
9543845-T-A 9706236-T-A IR3_Prx ***
9545908-A-AC 9708299-A-AC IR3_Prx ***
9564790-G-T 9727181-G-T IR3_Prx ***
27791108-G-T 25644961-G-T P1_Y2 ***
17527438-GTATATA-G,GTA 15415558-GTATATA-G,GTA 18×TA***
19829299-C-AT 17717419-C-AT P5_Prx 27×T***
22504309-T-A 20342423-T-A DYZ19 ***
19979864-CTTTT-C,CTTT 17867984-CTTTT-C,CTTT P5_Prx 28×T***
56830529-CCATTGCATTCTGCTGAATTCCATTGCATTCC-TCATTGCATTCCATTGAATTCCATTGCATTCT ***
56828824-CATTGCATTCAATTCCATTC-AATTCCATTCCATTCCATTT ***
10845703-TTCCC-CTCCA ***
13481403-TAGAAAAG-AAGGCAAC 11325727-TAGAAAAG-AAGGCAAC ***
10954612-A-C ***
10911787-CC-A ***
10949134-A-ATTACT ***
10949148-TACA-ATCT ***
10949165-TTCT-CTCC ***
13253393-TCGG-CCAGTT 11097717-TCGG-CCAGTT ***
13323494-CAA-C,CAAA 11167818-CAA-C,CAAA 24×A***
10880695-T-C ***
13461897-AAACC-CAACT 11306221-AAACC-CAACT ***
13481313-AT-CA 11325637-AT-CA ***
13489069-AAGGCGCTT-TAGGCACTC 11333393-AAGGCGCTT-TAGGCACTC ***
56827478-GTTCCATTCG-ATTCCATTCA,GTTCCATTCA ***
13489695-CCGT-ACGG 11334019-CCGT-ACGG ***
13722069-GGAATA-G,GGAATG 11566393-GGAATA-G,GGAATG ***
13722084-C-A,GGAATA 11566408-C-A,GGAATA ***
13724402-C-A 11568726-C-A ***
10678087-C-A ***
17919855-GA-AA,G 15807975-GA-AA,G 25×A***
10023813-C-A 10186204-C-A ***
10023405-C-A 10185796-C-A ******
8785587-C-T 8917546-C-T ***
56826628-CATCCCGTTT-TGTCCCGTTC ***
7098765-C-A 7230724-C-A ******
20796094-AAC-A 18634208-AAC-A P4_Prx 8×AC***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Mutation Notes:

Kit POSITION-REF-ALT (hg19) POSITION-REF-ALT (hg38) Note
Manual20007955-A-G17896075-A-G2A 1G
Manual6274770-G-A6406729-G-A1A

Haplotype Progression

The data below reveals the progression of changes in the haplotype. The bottom row is the haplotype for this man and above him are the inferred ancestral haplotypes for various upstream blocks. These inferred haplotypes are very much a work in progress, and any suggested modifications are appreciated. I think we can use our vast collection of haplotype data to refine these haplotypes. Mutations made from each upstream block are shown in sequence. The cell color is determined by the block in which the mutation took place.

DYS393
DYS390
DYS19
DYS391
DYS385
DYS426
DYS388
DYS439
DYS389i
DYS392
DYS389ii
DYS458
DYS459
DYS455
DYS454
DYS447
DYS437
DYS448
DYS449
DYS464
DYS460
Y-GATA-H4
YCAII
DYS456
DYS607
DYS576
DYS570
CDY
DYS442
DYS438
DYS531
DYS578
DYF395S1
DYS590
DYS537
DYS641
DYS472
DYF406S1
DYS511
DYS425
DYS413
DYS557
DYS594
DYS436
DYS490
DYS534
DYS450
DYS444
DYS481
DYS520
DYS446
DYS617
DYS568
DYS487
DYS572
DYS640
DYS492
DYS565
DYS710
DYS485
DYS632
DYS495
DYS540
DYS714
DYS716
DYS717
DYS505
DYS556
DYS549
DYS589
DYS522
DYS494
DYS533
DYS636
DYS575
DYS638
DYS462
DYS452
DYS445
Y-GATA-A10
DYS463
DYS441
Y-GGAAT-1B07
DYS525
DYS712
DYS593
DYS650
DYS532
DYS715
DYS504
DYS513
DYS561
DYS552
DYS726
DYS635
DYS587
DYS643
DYS497
DYS510
DYS434
DYS461
DYS435
P312/S1161324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123315916122626191211131210912121011113012132413101020151913241712152412231810141791211
L21/S1451324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
DF21/S1921324141111-14121212131329179-1011112515192915-15-17-17111119-231615181836-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
S30581324141011-14121212131329179-1011112515192915-15-17-17111119-231615181836-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211121211912121011113012132413101020151913241712152412231810141791211
S4261324141011-14121212131329179-1011112515193015-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526191311121211912121011113012132413101020151913231712152412231810141791211
S1901324141011-14121212131329179-1011112515193013-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526201311121211912121011113012132413101020151913231712152412231810141791211
FGC32151324141011-14121212131329189-1011112515193013-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526201311121211912121011113012132413101020151913231712152412231810141791211
FGC31971324141011-14121212131329189-1011112515193013-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526201311121211913121011113012132413101020151914231712152412231810141791211
Williamson1324141011-14121212141330189-1011112515193013-15-17-17111019-231615181838-391212

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 709663980428679770057851145
Kit: 709663-A*16000000100000008300000
Used in age calculations980428679770057851145
Counts of SNPs66
Variant counts last updated 2020-03-02 03:10:18.

* BED data not available. Using default values.


Big Tree Main Page