Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > Z39589 > DF49/S474 > Z2980 > Z2976 > DF23 > Z2961 > Z2956 > M222 > Z46375 > DF106 > DF104 > DF105 > A18726 > A259 > Y19870 > FGC5939 > ~24128143-T-C > 5070572-G-A

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
269999
BigY2
269999
BigY3
269999
56825816-A-G A*
20503154-T-C 18341268-T-C P5_Dst A*
20503144-A-AGGC 18341258-A-AGGC P5_Dst A*
3741535-T-G 3873494-T-G FT318331 A*
22308842-C-T 20146956-C-T DYZ19 ***A*
13687705-C-A 11532029-C-A A*
3066506-T-C 3198465-T-C A*
13451763-T-C 11296087-T-C A*
22276571-C-T 20114685-C-T DYZ19 ***A*
24637506-G-A 22491359-G-A P3_t2 A*
20965963-T-G 18804077-T-G P4_Dst A*
22506457-G-A 20344571-G-A BY26583 DYZ19 ***+
15922155-T-C 13810275-T-C Y**++
19458291-G-A 17346411-G-A BY20817 YY+++
17474933-T-G 15363053-T-G FT82044 YY+
21648763-T-C 19486877-T-C FT82182 YY**+
22475724-G-T 20313838-G-T DYZ19 +
22475695-A-G 20313809-A-G BY46154 DYZ19 +
22430617-CT-C 20268731-CT-C DYZ19 ****
5552803-G-T 5684762-G-T *
13450470-ATTCCA-A,ATTCCG 11294794-ATTCCA-A,ATTCCG *
15870497-T-C 13758617-T-C **
15871770-AT-A 13759890-AT-A 8×T**
15866156-G-A 13754276-G-A **
15904975-G-C 13793095-G-C **
15927033-A-T 13815153-A-T **
15786583-C-A 13674703-C-A **
15773505-G-C 13661625-G-C **
28555626-T-G 26409479-T-G **
15201480-A-T 13089566-A-T **
15964697-T-A 13852817-T-A **
16199663-A-T 14087783-A-T **
16354877-A-C 14242997-A-C **
16345113-G-A 14233233-G-A **
16342202-C-T 14230322-C-T **
16259136-G-A 14147256-G-A **
16245942-T-A 14134062-T-A **
16220704-A-G 14108824-A-G **
16118592-T-TG 14006712-T-TG P8_Prx **
16041289-T-A 13929409-T-A **
16118572-T-TA 14006692-T-TA P8_Prx **
16094314-G-T 13982434-G-T **
16047206-C-A 13935326-C-A **
16044210-C-T 13932330-C-T **
16044185-G-A 13932305-G-A **
15734197-C-G 13622317-C-G **
15762249-T-C 13650369-T-C **
15688292-G-C 13576412-G-C **
15700340-A-C 13588460-A-C **
15503314-C-G 13391434-C-G **
15222043-A-C 13110129-A-C **
15276506-C-G 13164595-C-G **
15276536-A-T 13164625-A-T **
15321312-C-A 13209430-C-A **
15323643-G-A 13211761-G-A **
15323644-T-G 13211762-T-G **
15355212-A-C 13243331-A-C **
15168880-T-G 13056966-T-G **
15400166-GC-G 13288286-GC-G **
15400189-A-C 13288309-A-C **
28575245-T-C 26429098-T-C **
15570741-T-G 13458861-T-G **
15700334-A-T 13588454-A-T **
15598640-G-T 13486760-G-T **
15670277-G-T 13558397-G-T FT216701 **
15147212-A-G 13035299-A-G **
15682910-A-C 13571030-A-C **
15682993-A-C 13571113-A-C **
16354971-G-C 14243091-G-C **
15140787-A-G 13028874-A-G **
15222037-T-C 13110123-T-C **
15093541-G-C 12981629-G-C **
15688363-C-A 13576483-C-A **
15688985-C-T 13577105-C-T **
16354945-T-C 14243065-T-C **
16445704-C-A 14333824-C-A **
16354978-A-T 14243098-A-T **
17375097-T-C 15263217-T-C **
17158629-A-C 15046749-A-C **
17192571-T-G 15080691-T-G **
17215912-C-A 15104032-C-A **
17215953-T-G 15104073-T-G **
17225905-A-C 15114025-A-C **
17276908-GAA-G 15165028-GAA-G 12×A**
17297222-T-A 15185342-T-A **
17301237-TCAAAA-T 15189357-TCAAAA-T **
17349217-A-C 15237337-A-C **
17349232-C-A 15237352-C-A **
17367648-T-C 15255768-T-C **
17402535-C-A 15290655-C-A **
17014561-T-C 14902681-T-C **
17428291-C-A 15316411-C-A **
17503384-T-A 15391504-T-A **
17548678-C-A 15436798-C-A **
17552185-C-A 15440305-C-A **
17605498-CA-C 15493618-CA-C **
17616992-A-AG 15505112-A-AG **
17617015-C-A 15505135-C-A **
17617046-C-T 15505166-C-T **
17617070-A-T 15505190-A-T **
17636649-A-G 15524769-A-G **
17653956-C-A 15542076-C-A **
17703234-T-A 15591354-T-A **
17104233-C-A 14992353-C-A **
16971344-A-T 14859464-A-T **
16394287-G-C 14282407-G-C **
16583298-T-G 14471418-T-G **
16409032-C-TTTTT 14297152-C-TTTTT **
16421520-G-T 14309640-G-T **
16422549-C-A 14310669-C-A **
16424817-G-T 14312937-G-T **
16429627-G-T 14317747-G-T **
16429643-A-T 14317763-A-T **
16430992-G-A 14319112-G-A **
15045693-A-G 12933783-A-G **
16462358-C-A 14350478-C-A **
16505123-T-C 14393243-T-C **
16540493-A-T 14428613-A-T **
16583306-A-T 14471426-A-T **
16952885-C-A 14841005-C-A **
28545723-T-A 26399576-T-A **
16623312-C-A 14511432-C-A **
16689785-A-T 14577905-A-T **
16707781-G-T 14595901-G-T **
16739063-T-A 14627183-T-A **
16739105-C-A 14627225-C-A **
16739448-C-A 14627568-C-A **
16786206-A-T 14674326-A-T **
16849484-A-G 14737604-A-G **
16904707-C-G 14792827-C-G **
16913402-A-T 14801522-A-T **
16932931-C-T 14821051-C-T **
15073209-A-T 12961299-A-T **
14764381-T-G 12652450-T-G **
15034941-T-A 12923029-T-A **
13870663-C-A 11749957-C-A **
11665227-C-A **
11675425-T-G **
11675430-T-G **
11677386-C-A **
13858681-A-C 11737975-A-C **
13858687-A-T 11737981-A-T **
13858689-T-A 11737983-T-A **
13858696-A-T 11737990-A-T **
13858720-G-C 11738014-G-C **
13858738-T-A 11738032-T-A FT20716 **
13859287-C-A 11738581-C-A **
13871389-C-A 11750683-C-A **
11652008-A-G **
13885879-G-A 11765173-G-A **
13885880-A-T 11765174-A-T **
13896042-A-G 11775336-A-G **
13896044-T-G 11775338-T-G **
13909878-T-C 11789172-T-C **
13944663-C-A 11823957-C-A **
13975927-C-A 11855221-C-A **
13987109-C-A 11866403-C-A **
13998175-T-G 11877469-T-G **
13998176-C-G 11877470-C-G **
13998207-T-G 11877501-T-G **
11652543-T-C **
28631645-A-C 26485498-A-C **
14067077-C-A 11946371-C-A **
13319623-C-A 11163947-C-A **
11038092-C-A **
11038124-C-A **
13201883-T-G 11046207-T-G **
13235475-C-A 11079799-C-A **
13243429-C-A 11087753-C-A **
13243431-G-T 11087755-G-T **
28742042-C-A 26595895-C-A **
28722600-C-A 26576453-C-A **
13255937-C-A 11100261-C-A **
13308238-G-T 11152562-G-T **
13309705-C-A 11154029-C-A FT442614 **
13335329-T-C 11179653-T-C **
11644471-T-G **
13402363-A-G 11246687-A-G **
13460992-T-C 11305316-T-C **
13461004-C-T 11305328-C-T **
13486608-A-C 11330932-A-C **
13490331-T-C 11334655-T-C **
13523616-C-T 11367940-C-T FT197441 **
28691671-C-A 26545524-C-A **
13628887-C-A 11473211-C-A **
13698544-A-C 11542868-A-C **
13698561-C-A 11542885-C-A BY54372 **
28691639-C-A 26545492-C-A **
11644248-G-A **
14023108-T-C 11902402-T-C **
14073697-G-T 11952991-G-T **
15011668-T-G 12899756-T-G **
14617106-C-A 12505304-C-A **
14561879-T-G 12450080-T-G **
14567376-C-A 12455576-C-A **
14570870-C-A 12459070-C-A **
14570907-T-G 12459107-T-G **
14570933-G-C 12459133-G-C **
14570936-T-C 12459136-T-C **
14570937-T-C 12459137-T-C **
14570986-C-A 12459186-C-A **
14580907-G-C 12469107-G-C FT175276 **
14610690-C-A 12498892-C-A **
14612958-T-A 12501156-T-A **
14712172-T-C 12600239-T-C **
14546745-T-G 12434946-T-G **
14712187-T-C 12600254-T-C **
14717355-G-C 12605423-G-C **
14735395-C-A 12623463-C-A **
17859819-G-C 15747939-G-C **
14774284-CAG-C 12662353-CAG-C **
14779596-C-T 12667666-C-T **
14911077-C-A 12799144-C-A **
14914748-C-A 12802815-C-A **
14959602-T-C 12847677-T-C **
14977378-C-G 12865453-C-G **
14994384-C-A 12882469-C-A **
14561868-C-A 12450069-C-A **
14546737-G-T 12434938-G-T **
14100917-A-G 11980211-A-G **
14297233-A-G 12176527-A-G **
14107102-C-A 11986396-C-A **
14160684-C-A 12039978-C-A **
14176405-C-G 12055699-C-G **
14224174-C-T 12103468-C-T **
14232983-T-C 12112277-T-C FTA36208 **
14241808-C-T 12121102-C-T **
28631477-T-A 26485330-T-A **
14284933-T-C 12164227-T-C **
14286927-A-T 12166221-A-T **
14289542-G-T 12168836-G-T **
14295292-G-T 12174586-G-T **
14343992-C-A 12223287-C-A FT377615 **
14538727-T-G 12426928-T-G **
14343993-A-G 12223288-A-G **
28629236-C-A 26483089-C-A **
14367671-C-A 12246967-C-A **
14379954-A-C 12259250-A-C **
14380917-G-T 12260213-G-T **
14446607-C-G 12325880-C-G **
14447969-T-C 12327242-T-C **
28594282-C-A 26448135-C-A **
12374404-T-G **
14506811-G-T 12395016-G-T **
14511405-C-A 12399610-C-A **
14517814-C-A 12406015-C-A **
17795563-C-A 15683683-C-A **
18059875-T-A 15947995-T-A **
17859849-G-C 15747969-G-C **
22727282-T-G 20565396-T-G **
22537892-T-A 20376006-T-A **
22563044-C-A 20401158-C-A **
28474954-A-G 26328807-A-G **
22619334-C-A 20457448-C-A **
22624952-C-A 20463066-C-A FT134866 **
22639371-C-A 20477485-C-A **
22649373-T-TA 20487487-T-TA **
22654962-G-C 20493076-G-C **
22655144-T-G 20493258-T-G **
22655156-A-T 20493270-A-T **
22696464-A-G 20534578-A-G **
22783192-C-A 20621306-C-A **
22518329-A-C 20356443-A-C **
22849711-C-T 20687825-C-T **
22875340-C-A 20713454-C-A **
22875345-G-T 20713459-G-T BY141386 **
23037928-A-T 20876042-A-T **
23058602-C-T 20896716-C-T **
23097015-A-C 20935129-A-C **
23099984-A-G 20938098-A-G **
23099998-C-A 20938112-C-A **
23169969-C-T 21008083-C-T **
23184499-A-G 21022613-A-G **
23184513-A-T 21022627-A-T **
22518402-A-T 20356516-A-T **
22474803-G-T 20312917-G-T Y2743 FGC10618 DYZ19 **
23199787-T-G 21037901-T-G **
28478433-T-G 26332286-T-G **
21582626-G-T 19420740-G-T **
21602877-T-A 19440991-T-A **
21700443-CA-C 19538557-CA-C **
21771508-T-A 19609622-T-A **
21773711-A-G 19611825-A-G **
21836185-C-A 19674299-C-A **
21888301-G-C 19726415-G-C **
21888346-A-G 19726460-A-G **
21910089-A-T 19748203-A-T **
21922026-A-C 19760140-A-C **
21945286-C-A 19783400-C-A **
22010242-C-A 19848356-C-A **
22472776-C-A 20310890-C-A DYZ19 **
22011940-T-C 19850054-T-C **
22011975-A-C 19850089-A-C **
22027777-A-G 19865891-A-G **
22088923-A-C 19927037-A-C **
22092987-C-A 19931101-C-A FT182345 **
22128638-A-T 19966752-A-T **
22170643-T-C 20008757-T-C **
22170662-G-T 20008776-G-T **
22209239-A-C 20047353-A-C **
22229556-G-T 20067670-G-T DYZ19 **
22253216-G-T 20091330-G-T DYZ19 **
22426918-G-T 20265032-G-T DYZ19 **
27996196-G-A 25850049-G-A P1_Y2 **
23201742-C-G 21039856-C-G **
21545424-T-A 19383538-T-A **
24614093-G-A 22467946-G-A P3_t2 **
24177982-T-G 22031835-T-G P3_b1 **
24177995-T-A 22031848-T-A P3_b1 **
24280799-T-C 22134652-T-C P3_t1 **
24280881-A-AC 22134734-A-AC P3_t1 **
24353289-T-C 22207142-T-C P3_t1 **
24353294-C-CCCTT 22207147-C-CCCTT P3_t1 **
24373256-C-A 22227109-C-A **
24385153-G-T 22239006-G-T **
24403551-T-G 22257404-T-G **
24598024-A-AC 22451877-A-AC P3_t2 **
24614075-T-A 22467928-T-A P3_t2 **
27996166-A-C 25850019-A-C P1_Y2 **
24177967-C-T 22031820-C-T P3_b1 **
24910853-C-CATATATATAT 22764706-C-CATATATATAT g1 26×AT**
25995485-C-T 23849338-C-T P1_Y1 **
26205002-G-T 24058855-G-T P1_Y1 **
27499285-C-A 25353138-C-A P1_Y2 **
27499305-T-A 25353158-T-A P1_Y2 **
27499425-C-A 25353278-C-A P1_Y2 **
27714330-T-G 25568183-T-G P1_Y2 **
27759176-A-T 25613029-A-T P1_Y2 **
27759198-T-G 25613051-T-G P1_Y2 **
27963447-C-T 25817300-C-T P1_Y2 **
27963482-A-AG 25817335-A-AG P1_Y2 **
27963509-A-T 25817362-A-T P1_Y2 **
24177979-T-G 22031832-T-G P3_b1 **
24177956-C-T 22031809-C-T P3_b1 **
23272276-C-A 21110390-C-A **
23476276-A-G 21314390-A-G **
23282252-C-A 21120366-C-A **
23299674-C-A 21137788-C-A **
23337127-T-C 21175241-T-C **
23337140-T-C 21175254-T-C **
23345916-T-C 21184030-T-C **
23360697-T-C 21198811-T-C **
27996182-A-T 25850035-A-T P1_Y2 **
23411379-C-A 21249493-C-A **
23416730-T-C 21254844-T-C **
23427017-C-A 21265131-C-A **
23440599-T-A 21278713-T-A **
23493550-T-A 21331664-T-A **
24177945-A-T 22031798-A-T P3_b1 **
23623294-G-T 21461408-G-T **
23638673-G-A 21476787-G-A **
21751172-C-T **
21754129-T-A **
24177862-A-T 22031715-A-T P3_b1 **
24177871-C-T 22031724-C-T P3_b1 **
24177883-C-G 22031736-C-G P3_b1 **
24177891-A-C 22031744-A-C P3_b1 **
24177897-A-C 22031750-A-C P3_b1 **
24177905-T-C 22031758-T-C P3_b1 **
24177922-A-C 22031775-A-C P3_b1 **
24177930-G-T 22031783-G-T P3_b1 **
21582555-C-T 19420669-C-T **
21545420-T-C 19383534-T-C **
17859962-T-G 15748082-T-G **
19048012-C-A 16936132-C-A **
18758978-C-T 16647098-C-T **
18779349-G-T 16667469-G-T **
18841144-A-C 16729264-A-C **
18848469-T-C 16736589-T-C **
18848477-C-A 16736597-C-A **
18892380-G-T 16780500-G-T **
18901991-C-A 16790111-C-A **
18902864-A-G 16790984-A-G **
18925568-C-A 16813688-C-A **
18959207-T-A 16847327-T-A **
28494785-G-A 26348638-G-A **
19062156-C-A 16950276-C-A **
18758963-TG-T 16647083-TG-T **
19107413-A-T 16995533-A-T **
19163175-A-G 17051295-A-G **
19200930-C-A 17089050-C-A **
19202915-G-A 17091035-G-A **
19223186-C-A 17111306-C-A **
28494601-G-T 26348454-G-T **
19235125-T-A 17123245-T-A **
19258886-C-A 17147006-C-A **
19298771-C-A 17186891-C-A **
19299248-G-C 17187368-G-C **
19304704-C-A 17192824-C-A **
18758968-G-T 16647088-G-T **
28506116-C-A 26359969-C-A **
19329382-A-T 17217502-A-T **
28544512-C-A 26398365-C-A **
17871879-C-A 15759999-C-A **
17884510-C-G 15772630-C-G **
17884569-T-G 15772689-T-G **
17902083-C-A 15790203-C-A **
17923874-C-A 15811994-C-A **
18053478-C-G 15941598-C-G **
18053526-G-C 15941646-G-C **
11037760-A-C **
18086313-G-T 15974433-G-T **
18127951-TA-T 16016071-TA-T **
18185144-C-A 16073264-C-A **
18243993-A-T 16132113-A-T **
18722994-T-C 16611114-T-C **
28537729-A-T 26391582-A-T **
18317648-G-T 16205768-G-T P6_Prx **
18343643-G-T 16231763-G-T BY121453 P6_Prx **
18454822-CT-C 16342942-CT-C P6_Dst **
18480345-A-G 16368465-A-G P6_Dst **
18539271-C-A 16427391-C-A **
28534306-C-A 26388159-C-A **
18645973-C-A 16534093-C-A **
28519676-C-A 26373529-C-A **
18687730-G-A 16575850-G-A **
18711546-A-C 16599666-A-C **
18711583-A-T 16599703-A-T **
19312762-G-A 17200882-G-A **
19329465-C-T 17217585-C-T **
21525140-G-T 19363254-G-T **
21202550-C-A 19040664-C-A **
20579349-C-CAT 18417463-C-CAT P5_Dst **
20726019-C-T 18564133-C-T P4_Prx **
20778828-A-T 18616942-A-T P4_Prx **
21012269-G-T 18850383-G-T P4_Dst **
21097363-A-G 18935477-A-G **
21115562-G-T 18953676-G-T **
21116977-A-G 18955091-A-G **
21116984-T-A 18955098-T-A **
21120863-T-C 18958977-T-C **
21153463-C-T 18991577-C-T **
21184453-A-T 19022567-A-T **
21268880-C-T 19106994-C-T FT177086 **
20460430-T-TA 18298544-T-TA P5_Dst **
21315049-T-G 19153163-T-G **
21328657-T-A 19166771-T-A **
21334689-G-C 19172803-G-C **
21334698-A-T 19172812-A-T **
21367398-G-T 19205512-G-T **
21387312-A-G 19225426-A-G **
21394419-C-T 19232533-C-T **
21394517-C-T 19232631-C-T **
21426916-C-A 19265030-C-A **
21428646-C-A 19266760-C-A **
21457686-G-T 19295800-G-T **
21522127-C-T 19360241-C-T **
20533440-T-C 18371554-T-C P5_Dst **
20460418-T-A 18298532-T-A P5_Dst **
19329466-A-T 17217586-A-T **
19531588-G-T 17419708-G-T **
19412585-C-A 17300705-C-A **
19416465-C-A 17304585-C-A **
19438561-G-A 17326681-G-A FT111976 **
19464002-T-G 17352122-T-G **
19476637-A-C 17364757-A-C **
19512132-T-G 17400252-T-G **
19517958-G-T 17406078-G-T **
19520757-G-A 17408877-G-A **
19523612-T-A 17411732-T-A **
19523627-C-A 17411747-C-A **
19528622-T-G 17416742-T-G **
19535663-T-A 17423783-T-A **
20460388-C-G 18298502-C-G P5_Dst **
19535692-C-A 17423812-C-A **
19558434-C-A 17446554-C-A **
19610423-C-A 17498543-C-A P5_Prx **
19732297-T-G 17620417-T-G P5_Prx **
19732304-G-T 17620424-G-T P5_Prx **
19758830-C-T 17646950-C-T P5_Prx **
19758838-A-C 17646958-A-C P5_Prx **
19758854-G-T 17646974-G-T P5_Prx **
19840784-A-G 17728904-A-G P5_Prx **
19957279-T-TC 17845399-T-TC P5_Prx **
20230550-A-G 18068664-A-G P5_Dst **
20460306-T-A 18298420-T-A P5_Dst **
11037764-A-C **
10998159-G-T **
11037754-A-C **
6010417-C-A 6142376-C-A **
5830155-T-A 5962114-T-A **
5845043-T-C 5977002-T-C **
5865331-G-A 5997290-G-A **
5867463-G-T 5999422-G-T **
5877472-C-G 6009431-C-G **
5944593-G-T 6076552-G-T **
5948918-T-A 6080877-T-A **
5948923-G-A 6080882-G-A **
5962209-G-T 6094168-G-T **
5968368-C-A 6100327-C-A **
5999507-T-C 6131466-T-C **
6028462-C-T 6160421-C-T **
5688498-A-C 5820457-A-C **
6037442-T-G 6169401-T-G **
6037458-T-A 6169417-T-A **
6037482-T-G 6169441-T-G **
6037490-C-A 6169449-C-A **
6039666-T-A 6171625-T-A **
6094482-T-C 6226441-T-C **
6187784-A-T 6319743-A-T IR3_Dst **
6187789-T-C 6319748-T-C IR3_Dst **
6187798-G-T 6319757-G-T IR3_Dst **
6187810-G-T 6319769-G-T IR3_Dst **
6187821-G-C 6319780-G-C IR3_Dst **
5755946-T-C 5887905-T-C **
5629548-T-C 5761507-T-C **
6187832-A-C 6319791-A-C IR3_Dst **
4908236-T-G 5040195-T-G **
4402669-G-T 4534628-G-T **
4429161-A-G 4561120-A-G **
4439359-G-T 4571318-G-T **
4444044-C-A 4576003-C-A **
4580667-C-A 4712626-C-A **
4757258-T-C 4889217-T-C **
4862708-T-C 4994667-T-C **
4889372-C-A 5021331-C-A **
4889376-C-A 5021335-C-A **
4898034-C-A 5029993-C-A **
4908165-G-A 5040124-G-A **
5011617-C-A 5143576-C-A **
5620720-AT-A 5752679-AT-A **
5073740-C-A 5205699-C-A **
37203-C-A **
5190959-C-A 5322918-C-A **
5243564-G-T 5375523-G-T **
5343527-G-A 5475486-G-A **
5343636-A-C 5475595-A-C **
5426149-A-G 5558108-A-G **
5426181-C-A 5558140-C-A **
5519167-T-A 5651126-T-A **
5524664-A-T 5656623-A-T **
5557328-C-A 5689287-C-A **
5576677-C-A 5708636-C-A **
6187824-C-G 6319783-C-G IR3_Dst **
6187849-T-G 6319808-T-G IR3_Dst **
4256988-T-C 4388947-T-C **
6983655-A-G 7115614-A-G **
6829464-G-A 6961423-G-A **
6835510-C-G 6967469-C-G **
6835536-T-C 6967495-T-C **
6881176-C-A 7013135-C-A **
6881398-T-C 7013357-T-C **
6882155-G-T 7014114-G-T **
6920694-C-G 7052653-C-G **
6920705-G-C 7052664-G-C **
6920817-C-A 7052776-C-A **
6926460-C-A 7058419-C-A **
6976241-T-C 7108200-T-C **
7005527-A-T 7137486-A-T **
6786697-C-A 6918656-C-A **
7033459-C-G 7165418-C-G **
7041766-T-A 7173725-T-A **
37190-G-A **
7081344-G-T 7213303-G-T **
7094804-C-G 7226763-C-G Z41774 **
7094955-C-A 7226914-C-A **
7110521-T-C 7242480-T-C FT248327 **
7140443-G-C 7272402-G-C **
7150700-AT-A 7282659-AT-A **
7186720-C-A 7318679-C-A **
7188392-A-C 7320351-A-C **
6814601-G-C 6946560-G-C **
6752226-A-C 6884185-A-C **
6187857-T-C 6319816-T-C IR3_Dst **
6277749-A-C 6409708-A-C IR3_Dst **
6187872-T-C 6319831-T-C IR3_Dst **
6187883-T-G 6319842-T-G IR3_Dst **
6187894-C-A 6319853-C-A IR3_Dst **
6187906-A-C 6319865-A-C IR3_Dst **
6187908-T-A 6319867-T-A IR3_Dst **
6187922-A-G 6319881-A-G IR3_Dst **
6209039-A-AG 6340998-A-AG IR3_Dst **
6209064-AG-A 6341023-AG-A IR3_Dst **
6246695-T-G 6378654-T-G IR3_Dst **
6246696-G-T 6378655-G-T IR3_Dst **
6246715-T-TC 6378674-T-TC IR3_Dst **
6277754-C-CGT 6409713-C-CGT IR3_Dst **
6642693-C-A 6774652-C-A **
6293401-C-T 6425360-C-T IR3_Dst **
6305951-C-T 6437910-C-T IR3_Dst **
6355694-A-T 6487653-A-T **
6355763-T-A 6487722-T-A **
6419442-C-G 6551401-C-G **
6444821-C-A 6576780-C-A **
6465303-C-A 6597262-C-A **
6492685-C-T 6624644-C-T **
6492716-G-T 6624675-G-T **
6528654-G-T 6660613-G-T **
6582447-A-G 6714406-A-G FTA43822 **
6641074-A-G 6773033-A-G **
4282614-G-C 4414573-G-C **
4248204-T-G 4380163-T-G **
37189-G-T **
21515861-TCAAAAAA-T 19353975-TCAAAAAA-T **
10794170-G-A **
10794198-C-G **
10794204-C-A **
19459343-C-A 17347463-C-A **
5204447-G-A 5336406-G-A **
27447499-TGAGA-T 25301352-TGAGA-T P1_Y2 10×GA**
15183723-C-A 13071809-C-A **
14108586-C-A 11987880-C-A **
27996129-A-AT 25849982-A-AT P1_Y2 **
10992283-CTCCA-C **
11024485-G-C **
14195313-C-A 12074607-C-A **
17992245-A-G 15880365-A-G P7_Prx **
16897636-T-C 14785756-T-C **
10802394-T-G **
19202926-CT-C 17091046-CT-C **
21132677-C-T 18970791-C-T **
25333890-C-T 23187743-C-T FGC67138 P2_r1 **
26073024-T-G 23926877-T-G P1_Y1 **
15252787-G-A 13140873-G-A **
19461930-C-A 17350050-C-A FGC51874 **
2699574-T-A 2831533-T-A **
2729911-T-A 2861870-T-A **
2740471-C-A 2872430-C-A **
7141025-C-A 7272984-C-A **
13404442-C-A 11248766-C-A **
2773363-T-C 2905322-T-C **
20773696-G-T 18611810-G-T P4_Prx **
27757750-A-T 25611603-A-T P1_Y2 **
25859392-A-G 23713245-A-G P1_Y1 **
3358526-A-C 3490485-A-C **
7310596-G-A 7442555-G-A S10104 **
21056107-C-T 18894221-C-T **
16739068-AG-A 14627188-AG-A **
20786116-C-T 18624230-C-T P4_Prx **
7311934-CA-C 7443893-CA-C **
18959213-T-C 16847333-T-C **
19127667-T-TAC 17015787-T-TAC 18×AC**
22473346-G-T 20311460-G-T BY53061 DYZ19 **
22473342-G-T 20311456-G-T DYZ19 **
14080035-GATATATATATATATATATATATATATATATATATATATATATAT-G 11959329-GATATATATATATATATATATATATATATATATATATATATATAT-G 29×AT**
20726803-C-A 18564917-C-A P4_Prx **
19960970-G-T 17849090-G-T P5_Prx **
19933494-G-T 17821614-G-T P5_Prx **
19922990-C-A 17811110-C-A P5_Prx **
16115520-T-A 14003640-T-A P8_Prx **
22252125-A-T 20090239-A-T DYZ19 **
22252137-A-T 20090251-A-T DYZ19 **
13858680-G-C 11737974-G-C A15001 **
15157859-TCAA-T 13045946-TCA-T **
22475730-A-G 20313844-A-G DYZ19 **
6308423-C-A 6440382-C-A IR3_Dst **
13259792-A-T 11104116-A-T **
2772534-A-AC 2904493-A-AC **
2788233-T-A 2920192-T-A **
4225979-A-G 4357938-A-G **
4063287-C-A 4195246-C-A **
3662840-C-A 3794799-C-A **
3680456-A-G 3812415-A-G **
3680504-G-T 3812463-G-T **
3771892-T-A 3903851-T-A **
3814992-G-T 3946951-G-T **
3817501-T-G 3949460-T-G **
3817983-C-A 3949942-C-A **
3834519-G-T 3966478-G-T **
3850168-C-A 3982127-C-A **
3930219-C-A 4062178-C-A **
3950878-C-T 4082837-C-T **
4077653-T-C 4209612-T-C **
3388520-C-A 3520479-C-A **
4108254-G-T 4240213-G-T **
4113017-C-A 4244976-C-A **
4138956-C-T 4270915-C-T **
4150492-A-G 4282451-A-G **
4207696-A-T 4339655-A-T **
4207833-C-A 4339792-C-A **
4212733-A-G 4344692-A-G **
4212743-C-G 4344702-C-G **
4212754-A-C 4344713-A-C **
4212760-T-G 4344719-T-G **
4215449-G-T 4347408-G-T **
3435849-C-A 3567808-C-A **
3385772-C-A 3517731-C-A **
2788245-T-A 2920204-T-A **
2974371-C-G 3106330-C-G **
2788254-T-C 2920213-T-C **
2788259-G-C 2920218-G-C **
2791266-T-A 2923225-T-A **
2845229-A-G 2977188-A-G **
2854834-C-T 2986793-C-T **
2854842-G-A 2986801-G-A **
2854850-A-T 2986809-A-T **
2884826-C-A 3016785-C-A **
2928304-C-T 3060263-C-T **
2928354-G-C 3060313-G-C **
2970411-A-T 3102370-A-T **
3093148-A-C 3225107-A-C **
3358529-A-C 3490488-A-C 18×T**
3106920-C-A 3238879-C-A **
3176162-G-T 3308121-G-T **
3176179-T-A 3308138-T-A **
3176191-A-G 3308150-A-G **
3176256-C-G 3308215-C-G **
3264481-T-C 3396440-T-C **
3284163-C-A 3416122-C-A **
3285200-G-T 3417159-G-T **
3287186-C-A 3419145-C-A **
3287203-C-A 3419162-C-A **
3340606-C-A 3472565-C-A **
3358521-A-C 3490480-A-C **
11030259-T-C **
7197570-A-ATTT 7329529-A-ATTT 19×T**
7239361-T-A 7371320-T-A **
10870078-G-T **
10837163-T-C **
10842731-A-C **
10843607-A-T **
10847427-G-T **
10849017-C-A **
10849048-A-C **
10849204-T-A **
10849240-C-A **
10850252-G-A **
10852831-A-T **
10860232-A-G **
10873815-T-C **
28764315-C-G 26618168-C-G **
10874634-G-C **
10875418-A-C **
10878524-C-A **
10878624-C-A **
10889462-C-A **
10889473-C-G **
10889492-C-A **
10889506-T-G **
10893436-T-C **
10895433-C-A **
10898525-C-A FT435857 **
28764310-T-G 26618163-T-G **
28767061-C-A 26620914-C-A **
28764284-T-A 26618137-T-A **
10782507-T-G **
10772121-C-A **
10774011-A-G **
10774012-A-T **
10774012-ATCCTC-A **
10774026-A-G **
10776103-T-G **
10778153-C-A **
10778158-C-A **
10781176-C-G **
10781256-T-C **
10781395-A-C **
10783182-G-T **
10820280-G-C **
10788564-G-A **
10788882-C-G **
10792805-T-C **
10794162-A-T **
28772991-G-A 26626844-G-A **
10800639-C-A **
10805537-T-C FT432009 **
10805587-T-C **
10808879-C-T **
10810542-A-G **
10811451-A-G **
10812313-A-C **
10901088-C-A **
10922327-T-C **
10764872-C-A **
10992302-CTCCAT-C **
10975777-T-G **
10978497-C-A **
10981116-T-A **
10983160-C-A **
10983210-C-A **
28764231-C-A 26618084-C-A **
10989328-A-G **
10990663-C-A **
10992269-T-A **
10992278-C-G **
10992280-C-G **
10992364-C-A **
10974118-T-C **
10993607-T-A **
10993780-C-A **
10995860-A-C **
10995861-T-C **
27996072-T-C 25849925-T-C P1_Y2 **
10998191-T-C **
11009880-C-A **
28757916-A-C 26611769-A-C **
11026986-C-A **
11030149-A-T **
11030163-C-G **
10974177-C-A **
28764276-T-G 26618129-T-G **
10922379-C-A **
10938363-A-G **
10922475-A-C **
10927634-TGCTGC-T **
10927658-C-T **
10927670-C-CACCTA **
10929204-T-C **
10935431-C-A **
10938281-C-A **
10938288-A-T **
10938311-C-T **
10938323-ACTACAGTCCT-A **
10938336-C-CTATGT **
10938376-C-CCTTTA **
10965429-G-C **
10938386-C-CCACTA **
10940228-A-G **
10941674-C-A **
10946590-A-T **
10946601-C-CTACAT **
10946619-C-A **
10949191-G-T **
10949348-C-A **
10956466-C-A **
10960938-G-C **
10962579-C-A **
10963020-C-T **
7239367-C-G 7371326-C-G **
10768589-A-G **
10761359-C-A **
8850113-G-T 8982072-G-T **
8276240-T-C 8408199-T-C **
8293340-T-C 8425299-T-C **
8379274-C-T 8511233-C-T **
37187-C-A **
8671298-C-A 8803257-C-A **
8730927-A-T 8862886-A-T **
8792989-T-G 8924948-T-G **
37175-A-T **
8849993-C-A 8981952-C-A **
8850024-C-G 8981983-C-G **
8850036-G-C 8981995-G-C **
8912086-G-T 9044045-G-T **
8110582-T-C 8242541-T-C **
9057265-A-C **
9057284-A-T **
9057320-T-A **
9125507-T-G **
9088875-C-A 9251266-C-A **
9094369-T-G 9256760-T-G **
9094415-C-A 9256806-C-A **
9221669-A-T 9384060-A-T **
9410913-A-T 9573304-A-T **
9416783-C-G 9579174-C-G **
37164-G-C **
8110689-A-C 8242648-A-C **
8079467-G-A 8211426-G-A **
9451298-C-A 9613689-C-A **
7282320-C-A 7414279-C-A **
7239398-C-A 7371357-C-A **
7239399-T-A 7371358-T-A **
7239422-C-G 7371381-C-G **
7239452-G-A 7371411-G-A **
7242036-T-C 7373995-T-C **
7256201-T-A 7388160-T-A **
7256266-A-C 7388225-A-C **
7256271-G-C 7388230-G-C **
7256298-G-T 7388257-G-T **
7256372-T-C 7388331-T-C **
7269748-A-T 7401707-A-T **
7303841-A-T 7435800-A-T **
8078855-T-C 8210814-T-C **
7310110-C-A 7442069-C-A **
7310530-A-T 7442489-A-T **
7310603-A-G 7442562-A-G FT159540 **
7313194-T-G 7445153-T-G **
7337415-A-T 7469374-A-T **
7430649-G-C 7562608-G-C **
7430660-G-T 7562619-G-T **
7621786-G-C 7753745-G-C **
7828958-A-C 7960917-A-C **
8052362-G-T 8184321-G-T **
8072386-G-T 8204345-G-T **
8076173-C-A 8208132-C-A **
10761319-C-A FT430039 **
9451282-T-A 9613673-T-A **
9511559-G-T 9673950-G-T **
10753621-T-C **
28791365-G-A 26645218-G-A **
10672289-A-G **
10672441-C-G **
10673024-A-T **
10677104-C-G **
28791279-C-G 26645132-C-G **
10678206-C-A **
10683846-T-C **
10690054-A-G **
10750969-C-A **
10753384-C-G **
10753626-C-T **
10669409-C-T **
10753640-G-A **
10753643-T-C **
10753668-C-A **
10754049-G-C **
10755469-C-T **
10756222-C-T **
10757345-A-C **
10758162-C-A **
10758269-C-A **
10760709-A-T **
10760718-C-G **
10760727-C-A **
9513173-T-A 9675564-T-A **
27966823-C-A 25820676-C-A P1_Y2 **
10666373-G-A **
10004903-A-G 10167294-A-G **
9513227-T-C 9675618-T-C **
9627136-TG-T 9789527-TG-T IR3_Prx **
9733974-T-G 9896365-T-G IR3_Prx **
9761182-A-C 9923573-A-C **
9820483-G-A 9982874-G-A **
9859151-C-A 10021542-C-A **
9928230-G-A 10090621-G-A **
9930087-T-C 10092478-T-C **
9977080-G-T 10139471-G-T **
9983296-C-A 10145687-C-A **
10003390-C-A 10165781-C-A **
10004875-G-A 10167266-G-A **
10004888-T-G 10167279-T-G **
10004914-G-A 10167305-G-A **
10666253-A-C **
10004925-A-G 10167316-A-G **
10004940-A-C 10167331-A-C **
10004948-A-C 10167339-A-C **
10004979-T-G 10167370-T-G **
10057877-CA-C 10220268-CA-C **
10627976-T-C **
37153-T-A **
16983-A-G **
10663017-CTCCAT-C **
10664811-A-T **
10654423-ACTC-A,ACAG ***
13963824-ATTTTTTTTTTTTTTTTTTTTTTT-A 11843118-ATTTTTTTTTTTTTTTTTTTTTTT-A 49×T***
27971753-AC-A,AA 25825606-AC-A,AA P1_Y2 ***
13450112-CACCCCATCCCATCCCATTCT-C,CATTCCATTCCATGCCATTCC 11294436-CACCCCATCCCATCCCATTCT-C,CATTCCATTCCATGCCATTCC ***
56850648-C-A ***
22473127-T-A 20311241-T-A DYZ19 ***
24636403-G-T 22490256-G-T P3_t2 ***
13709014-C-G 11553338-C-G ***
22473843-T-G 20311957-T-G Y4263 DYZ19 ***
22486333-G-A 20324447-G-A FT460477 DYZ19 ***
24163020-GAAC-G 22016873-GAAC-G P3_b1 ***
24222862-G-T 22076715-G-T P3_b1 ***
24983887-G-A 22837740-G-A g1 ***
25145418-T-C 22999271-T-C g1 ***
56850640-T-C ***
22296601-G-T 20134715-G-T DYZ19 ***
23196207-A-T 21034321-A-T ***
3148457-G-T 3280416-G-T ***
5186924-T-C 5318883-T-C ***
7076128-C-A 7208087-C-A ***
7207471-C-A 7339430-C-A ***
8486934-CAAA-C 8618893-CAAA-C 12×A***
22309510-CT-C 20147624-CT-C DYZ19 ***
22222636-G-T 20060750-G-T DYZ19 ***
9420199-C-A 9582590-C-A ***
22475590-T-A 20313704-T-A FGC52748 DYZ19 ***
17187619-G-T 15075739-G-T ***
13820888-G-A 11700182-G-A ***
15753104-C-A 13641224-C-A ***
9954392-C-T 10116783-C-T ***
13449372-C-G 11293696-C-G ***
22829663-T-A 20667777-T-A ***
22475605-G-A 20313719-G-A BY58804PLE19 FGC51202 DYZ19 ***
58997054-G-A 56850907-G-A ***
10038731-T-C 10201122-T-C S13157 ***
10038744-T-C 10201135-T-C ***
10038745-G-A 10201136-G-A ***
13450411-CTCCATTCCATTCCATTCTATTCCATTCCATTCCAT-C,CTCCATTCCATTCCATTCTATTCCATTCCAT 11294735-CTCCATTCCATTCCATTCTATTCCATTCCATTCCAT-C,CTCCATTCCATTCCATTCTATTCCATTCCAT ***
13143789-GCACAT-C,CCACTG 10633275-GCACAT-C,CCACTG ***
13810036-T-C,G 11689330-T-C,G ***
8810107-T-A 8942066-T-A ***
10652647-G-C ***
23391515-TTG-T 21229629-TTG-T ***
18568062-A-G 16456182-A-G ***
14461163-G-A 12340436-G-A ***
15470845-A-T 13358965-A-T ***
15952653-A-T 13840773-A-T ***
16619986-T-C 14508106-T-C ***
18188100-A-G 16076220-A-G ***
18256086-G-T 16144206-G-T ***
18685488-C-A 16573608-C-A BY207845 ***
14266554-T-C 12145848-T-C ***
18750188-T-C 16638308-T-C ***
18981136-C-A 16869256-C-A ***
19226615-C-A 17114735-C-A ***
21960511-C-A 19798625-C-A ***
22580032-A-G 20418146-A-G ***
23197360-CAAAA-C,CA 21035474-CAAAA-C,CA 17×A***
14356905-TTTGA-T,TGA 12236200-TTTGA-T,TGA ***
11644864-C-A ***
10657242-C-A ***
10824168-AT-A ***
10671094-C-A ***
10671220-G-A,T ***
10677474-C-A ***
10794220-A-G ***
10824158-A-G ***
10824167-C-CT ***
10918211-G-T ***
22473136-T-A 20311250-T-A DYZ19 ***
10968383-C-A ***
10987189-T-TTCCTC ***
11022834-G-T ***
13253980-A-C 11098304-A-C ***
13253991-T-C 11098315-T-C ***
13601932-C-A 11446256-C-A ***
11643269-C-A ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 2699991065938877196917801760
Kit: 269999969211578721867757960
Kit: 2699991499650294018468338508
Used in age calculations1499650294018468338508
Counts of SNPs43
Variant counts last updated 2021-04-16 03:28:53.



Big Tree Main Page