Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > ZZ10 > Z253 > Z2534 > ZZ5

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
51482
BigY2
51482
19912863-C-G 17800983-C-G P5_Prx ***A*
25966635-A-G 23820488-A-G P1_Y1 ***A*
22310954-A-G 20149068-A-G S1911 DYZ19 ***A*
22454351-G-C 20292465-G-C DYZ19 ***A*
6274459-A-G 6406418-A-G IR3_Dst ***A*
22315850-C-T 20153964-C-T DYZ19 ***A*
6271182-C-G 6403141-C-G IR3_Dst ***A*
26198950-G-A 24052803-G-A P1_Y1 ***A*
6267254-A-C 6399213-A-C IR3_Dst ***A*
18276485-T-C 16164605-T-C P6_Prx ***A*
23146630-A-AT 20984744-A-AT 10×TA*
20618184-A-T 18456298-A-T P4_Prx ***A*
7919487-C-T 8051446-C-T BY68752 YY++
4931917-T-A 5063876-T-A BY58469 **+
20363414-G-T 18201528-G-T BY212147 P5_Dst **+
6943190-G-A 7075149-G-A Z40709 YY++
7407042-C-T 7539001-C-T BY65037 YY++
7694252-A-G 7826211-A-G BY66976 YY++
8853730-A-T 8985689-A-T BY76363 YY++
8753283-C-A 8885242-C-A BY75637 YY++
9120834-C-T 9283225-C-T BY78276 Y++
9450286-C-T 9612677-C-T BY79482 YY++
13677225-A-G 11521549-A-G BY88071 ++
13707868-G-T 11552192-G-T BY54419 ***+
13821601-A-T 11700895-A-T BY90556 ++
14519933-A-T 12408134-A-T BY96279 YY++
14665723-T-G 12553789-T-G BY97084 YY++
16899080-T-C 14787200-T-C Z30619 Y11991 YY++
17049769-GT-G 14937889-GT-G ++
17465448-G-C 15353568-G-C BY114988 YY++
18645454-G-A 16533574-G-A BY122821 YY++
18883025-TGATA-T 16771145-TGATA-T ++
19023741-G-A 16911861-G-A BY125598 YY++
9153451-A-G 9315842-A-G BY78598 Y++
19103860-C-T 16991980-C-T BZ4617 YY++
8413034-TTTCTGTTCTG-T 8544993-TTTCTGTTCTG-T FGC59702 7×TTCTG+*
23113296-G-T 20951410-G-T BY142993 YY++
28805506-T-A 26659359-T-A BY151822 ***+
7634393-C-T 7766352-C-T BY23504 YY++
7714984-CTGTTTGTT-C 7846943-CTGTTTGTT-C 7522818-A-G 10×TGTT+
15809114-G-A 13697234-G-A BY104231 YY++
22469158-G-C 20307272-G-C BY222197 DYZ19 +
23557693-T-A 21395807-T-A F26214 YY++
21508316-A-AT 19346430-A-AT ++
22462989-G-C 20301103-G-C BY221024 DYZ19 ++
28795401-G-T 26649254-G-T *
22288174-C-T 20126288-C-T DYZ19 ****
22287723-G-T 20125837-G-T DYZ19 ****
21477811-A-AAAAGAAAGAAAG 19315925-A-AAAAGAAAGAAAG 14×AAAG****
15870676-T-A 13758796-T-A **
15928723-T-G 13816843-T-G **
15743685-C-A 13631805-C-A **
15918579-C-A 13806699-C-A **
15658161-C-A 13546281-C-A **
15748080-C-A 13636200-C-A **
15916567-C-A 13804687-C-A **
15815356-A-AT 13703476-A-AT **
15866108-G-A 13754228-G-A **
15803536-G-T 13691656-G-T **
15803578-T-G 13691698-T-G **
15803560-A-T 13691680-A-T **
15622370-C-A 13510490-C-A **
15732962-T-G 13621082-T-G **
15626685-A-C 13514805-A-C **
15803528-A-T 13691648-A-T **
15669794-C-A 13557914-C-A **
18354164-T-A 16242284-T-A P6_Prx 13×AGAA**
15605728-T-A 13493848-T-A **
15284268-A-G 13172367-A-G **
15034863-A-C 12922951-A-C **
15061683-C-A 12949775-C-A **
15111485-A-G 12999572-A-G **
15116501-G-T 13004588-G-T **
15116584-G-T 13004671-G-T **
15157691-A-G 13045778-A-G **
15157698-CAA-C 13045785-CAA-C **
15157859-T-C 13045946-T-C **
15212521-T-A 13100607-T-A **
15231058-C-A 13119144-C-A **
15232234-A-C 13120320-A-C **
15239581-C-A 13127667-C-A **
15324102-C-G 13212220-C-G **
15597259-G-T 13485379-G-T **
15324121-A-T 13212239-A-T **
15324123-T-C 13212241-T-C **
15381300-C-A 13269420-C-A **
15388006-G-T 13276126-G-T **
15400372-G-T 13288492-G-T **
15500662-G-T 13388782-G-T **
15513598-A-G 13401718-A-G **
15513601-C-CA 13401721-C-CA **
15513612-T-C 13401732-T-C **
15513619-A-G 13401739-A-G **
15532415-T-G 13420535-T-G **
15566742-A-C 13454862-A-C **
15971219-T-G 13859339-T-G **
15940291-A-G 13828411-A-G **
16445614-G-T 14333734-G-T **
15971224-T-C 13859344-T-C **
17104081-T-A 14992201-T-A **
16842650-C-A 14730770-C-A **
16848380-T-A 14736500-T-A **
16933108-T-G 14821228-T-G **
16987892-C-A 14876012-C-A **
17012907-C-T 14901027-C-T **
17012986-T-A 14901106-T-A **
17013013-A-T 14901133-A-T **
17066071-T-C 14954191-T-C **
17090864-T-G 14978984-T-G **
17126074-G-T 15014194-G-T **
16700310-C-A 14588430-C-A **
17130454-G-A 15018574-G-A **
17134514-C-A 15022634-C-A **
17151327-T-C 15039447-T-C **
17157514-C-T 15045634-C-T **
17215016-A-G 15103136-A-G **
17231323-T-G 15119443-T-G **
17231374-G-C 15119494-G-C **
17313656-T-C 15201776-T-C **
17355718-C-A 15243838-C-A **
17370932-T-G 15259052-T-G **
16777974-G-T 14666094-G-T **
16685218-T-G 14573338-T-G **
16003829-C-A 13891949-C-A **
16211026-A-G 14099146-A-G **
16005178-G-A 13893298-G-A **
16005188-T-C 13893308-T-C **
16041952-T-C 13930072-T-C **
16047174-A-AT 13935294-A-AT **
16053517-G-C 13941637-G-C **
16055241-C-A 13943361-C-A **
16062192-A-C 13950312-A-C **
16085676-C-A 13973796-C-A **
16146557-C-A 14034677-C-A P8_Dst **
16324110-G-A 14212230-G-A **
16605597-G-A 14493717-G-A **
16336897-GTTTTTT-G 14225017-GTTTTTT-G 23×T**
16411303-A-T 14299423-A-T **
15012735-A-G 12900823-A-G **
16445865-C-G 14333985-C-G **
16451657-C-A 14339777-C-A **
16464682-C-A 14352802-C-A **
16539697-C-A 14427817-C-A **
16539742-C-A 14427862-C-A **
16554750-T-C 14442870-T-C **
16562805-A-G 14450925-A-G **
15012779-T-G 12900867-T-G **
14352821-C-A 12232116-C-A **
14986063-C-A 12874131-C-A **
13523461-A-T 11367785-A-T **
13317202-C-A 11161526-C-A **
13364257-G-T 11208581-G-T **
13429973-C-A 11274297-C-A **
13445974-T-G 11290298-T-G **
13460513-G-T 11304837-G-T **
13474015-C-A 11318339-C-A **
13476314-C-A 11320638-C-A **
13487007-G-A 11331331-G-A **
13488112-G-T 11332436-G-T **
13526052-C-A 11370376-C-A **
13302331-T-A 11146655-T-A **
13542096-C-A 11386420-C-A **
13566063-C-A 11410387-C-A **
13626714-G-A 11471038-G-A **
13643865-A-C 11488189-A-C **
13699027-G-T 11543351-G-T **
11647861-G-T **
11650311-G-A **
11652968-A-G **
11672902-C-A **
13316165-A-C 11160489-A-C **
13267780-T-CC 11112104-T-CC **
13839876-G-A 11719170-G-A **
10988545-C-A **
10927871-C-A **
10927898-C-G **
10931280-A-G **
10942253-C-A **
10975539-T-C **
10975574-T-C **
10978843-C-T **
10988079-C-A **
10988543-T-G **
10988556-A-T **
13253197-C-A 11097521-C-A **
10999851-T-A **
11008714-C-A **
11022983-A-T **
11022994-A-G **
11022998-A-C **
11023010-T-G **
13194010-G-T 11038334-G-T **
13196065-C-A 11040389-C-A **
13234809-T-G 11079133-T-G **
13249245-C-A 11093569-C-A **
13839826-G-A 11719120-G-A **
13898839-G-T 11778133-G-T **
14784726-G-A 12672796-G-A **
14549197-C-A 12437398-C-A **
14404822-TT-A 12284119-TT-A **
14462651-A-G 12341924-A-G **
14478826-C-A 12358095-C-A **
14492785-C-T 12380982-C-T **
14499594-G-T 12387799-G-T **
14509430-G-C 12397635-G-C **
14513299-C-A 12401504-C-A **
14540744-T-C 12428945-T-C **
14544057-C-A 12432258-C-A **
14549263-T-A 12437464-T-A **
17370940-T-C 15259060-T-C **
14552424-G-A 12440625-G-A **
14558515-C-T 12446716-C-T **
14560728-C-A 12448929-C-A **
14568966-C-T 12457166-C-T **
14589372-C-G 12477572-C-G **
14667815-CT-C 12555880-CT-C **
14736117-T-G 12624185-T-G **
14743650-C-A 12631719-C-A **
14761169-C-A 12649238-C-A **
14776972-C-A 12665041-C-A **
14384607-C-A 12263903-C-A **
14343928-C-A 12223223-C-A FT55885 **
13913172-G-T 11792466-G-T **
14042691-T-C 11921985-T-C **
13920920-T-C 11800214-T-C **
13951156-G-T 11830450-G-T **
13951196-C-T 11830490-C-T **
13962240-A-T 11841534-A-T **
13973137-T-C 11852431-T-C **
13973283-G-A 11852577-G-A **
13976454-T-A 11855748-T-A **
14007590-C-A 11886884-C-A **
14042622-A-C 11921916-A-C **
14069055-C-A 11948349-C-A **
14343915-T-C 12223210-T-C **
14077135-G-T 11956429-G-T **
14100902-C-A 11980196-C-A **
14128282-C-G 12007576-C-G **
14149394-A-G 12028688-A-G **
14176525-A-T 12055819-A-T **
14281090-C-A 12160384-C-A **
14281106-C-A 12160400-C-A **
14300250-T-C 12179544-T-C **
14307700-C-A 12186994-C-A **
14315577-T-C 12194871-T-C **
17370937-C-A 15259057-C-A **
17842219-A-G 15730339-A-G **
17370940-T-TG 15259060-T-TG **
22800213-C-T 20638327-C-T **
22215291-A-C 20053405-A-C **
22215294-T-C 20053408-T-C **
22296999-C-G 20135113-C-G DYZ19 **
22297000-A-T 20135114-A-T DYZ19 **
22297001-G-T 20135115-G-T DYZ19 **
22297032-TTCATGGTCTTGC-T 20135146-TTCATGGTCTTGC-T DYZ19 **
22564585-A-G 20402699-A-G **
22614296-C-A 20452410-C-A **
22659682-A-C 20497796-A-C **
22857760-G-C 20695874-G-C **
22212137-C-A 20050251-C-A **
22874529-A-G 20712643-A-G **
22996972-A-T 20835086-A-T **
23007333-T-C 20845447-T-C **
23039544-G-T 20877658-G-T **
23065531-C-A 20903645-C-A **
23079131-C-G 20917245-C-G **
23082041-C-A 20920155-C-A **
23087039-C-A 20925153-C-A **
23127550-A-C 20965664-A-C **
22215285-A-C 20053399-A-C **
22205578-C-T 20043692-C-T **
23306698-C-A 21144812-C-A **
21582521-C-A 19420635-C-A **
21299213-G-T 19137327-G-T **
21323686-G-T 19161800-G-T **
21334685-C-A 19172799-C-A **
21367290-T-A 19205404-T-A Y14155 FGC18629 **
21368745-C-T 19206859-C-T **
21392359-C-A 19230473-C-A **
21503233-C-A 19341347-C-A **
21540884-T-G 19378998-T-G **
21540972-A-T 19379086-A-T **
21604120-C-A 19442234-C-A **
22149910-C-A 19988024-C-A **
21770630-C-A 19608744-C-A FGC2884 **
21827865-T-G 19665979-T-G **
21875911-T-A 19714025-T-A **
21875915-C-A 19714029-C-A **
21922037-C-A 19760151-C-A **
21972238-C-T 19810352-C-T **
21979827-G-A 19817941-G-A **
22055346-T-A 19893460-T-A **
22097187-A-C 19935301-A-C **
22113986-C-A 19952100-C-A **
23259181-T-A 21097295-T-A **
23401435-T-G 21239549-T-G **
21255947-C-A 19094061-C-A **
28797986-TG-T 26651839-TG-T **
28600536-G-T 26454389-G-T **
28609429-C-A 26463282-C-A **
28674703-C-A 26528556-C-A **
28700920-G-T 26554773-G-T **
28722452-C-A 26576305-C-A **
28741976-T-C 26595829-T-C FT44639 **
28762638-C-A 26616491-C-A **
28797966-T-G 26651819-T-G **
28797984-A-G 26651837-A-G **
56706599-G-C **
28580497-C-A 26434350-C-A FT69338 **
56706617-T-C **
56706640-C-T **
56706646-A-T **
56825733-GTGTGTACATATATATATATATATAT-G **
56838730-G-T **
56840413-C-A **
56845174-G-T **
56848550-C-A **
56858233-A-G **
56876089-T-A **
28583664-C-A 26437517-C-A **
28542808-C-A 26396661-C-A **
23446945-A-G 21285059-A-G **
24446831-G-C 22300684-G-C **
23514332-A-G 21352446-A-G **
23848644-T-A 21686758-T-A **
21751662-C-A **
21752684-T-C **
21783688-C-A **
24244548-G-T 22098401-G-T P3_b1 **
24271377-A-C 22125230-A-C P3_b1 **
24290685-A-AT 22144538-A-AT P3_t1 **
24403140-A-T 22256993-A-T **
24870061-G-C 22723914-G-C P3_b2 **
28521811-A-C 26375664-A-C **
24929530-T-G 22783383-T-G g1 **
26045930-C-T 23899783-C-T P1_Y1 **
26169903-A-T 24023756-A-T P1_Y1 **
26908681-A-T 24762534-A-T P1_r3 **
27637333-G-C 25491186-G-C FGC41031 P1_Y2 **
27814080-T-A 25667933-T-A P1_Y2 **
27861875-CAAAAAAAAAAAAAA-C 25715728-CAAAAAAAAAAAAAA-C P1_Y2 32×A**
27872568-A-G 25726421-A-G P1_Y2 **
27908815-A-AG 25762668-A-AG P1_Y2 **
27929503-T-A 25783356-T-A P1_Y2 **
21283373-T-G 19121487-T-G **
21240644-G-T 19078758-G-T **
17387381-C-A 15275501-C-A **
18593478-A-G 16481598-A-G **
17918821-T-C 15806941-T-C **
17929094-C-A 15817214-C-A **
18008666-T-G 15896786-T-G P7_Dst **
18093882-G-T 15982002-G-T **
18201202-T-A 16089322-T-A **
18274887-T-G 16163007-T-G P6_Prx **
18401028-C-A 16289148-C-A P6_Gap **
18427767-A-G 16315887-A-G P6_Dst **
18547044-C-A 16435164-C-A **
18636606-T-A 16524726-T-A **
17842369-C-A 15730489-C-A **
18749443-C-A 16637563-C-A **
18753004-C-G 16641124-C-G **
18814807-C-A 16702927-C-A **
18838835-C-A 16726955-C-A **
18859117-T-C 16747237-T-C **
18895654-A-G 16783774-A-G **
18901282-T-C 16789402-T-C **
18901286-C-A 16789406-C-A **
18961518-G-A 16849638-G-A **
18961536-T-A 16849656-T-A **
17915885-C-A 15804005-C-A **
10927846-C-CTCTTT **
19053426-C-G 16941546-C-G **
17616776-C-A 15504896-C-A Y99742 **
17448219-C-A 15336339-C-A **
17465026-G-A 15353146-G-A **
17503017-C-A 15391137-C-A **
17503027-C-A 15391147-C-A **
17504143-G-T 15392263-G-T **
17504197-C-A 15392317-C-A **
17538167-T-C 15426287-T-C **
17538231-T-G 15426351-T-G **
17560643-T-C 15448763-T-C **
17616850-C-T 15504970-C-T **
17821908-G-T 15710028-G-T **
17616854-C-T 15504974-C-T **
17616910-C-T 15505030-C-T **
17646588-GT-G 15534708-GT-G **
17666463-C-A 15554583-C-A **
17693691-G-T 15581811-G-T **
17693702-G-T 15581822-G-T Z27075 15×T**
17702652-C-A 15590772-C-A **
17735459-C-A 15623579-C-A **
17741289-A-G 15629409-A-G **
17796520-G-T 15684640-G-T **
19044554-C-T 16932674-C-T **
19053436-C-A 16941556-C-A **
21238741-GCCC-G 19076855-GCCC-G **
20760064-T-TG 18598178-T-TG P4_Prx **
19646345-G-T 17534465-G-T P5_Prx **
19720920-G-T 17609040-G-T P5_Prx **
19845024-C-A 17733144-C-A P5_Prx **
19963824-A-G 17851944-A-G P5_Prx **
19963828-A-G 17851948-A-G P5_Prx **
19963831-C-T 17851951-C-T P5_Prx 21×AT**
19963831-C-CAT 17851951-C-CAT P5_Prx 21×AT**
20645125-T-TC 18483239-T-TC P4_Prx **
20760021-T-C 18598135-T-C P4_Prx **
20760074-C-A 18598188-C-A P4_Prx **
19601086-A-C 17489206-A-C P5_Prx **
20760081-A-C 18598195-A-C P4_Prx **
20778579-G-T 18616693-G-T P4_Prx **
20851430-A-AC 18689544-A-AC P4_Dst **
20962034-C-G 18800148-C-G P4_Dst **
20962073-T-G 18800187-T-G P4_Dst **
21115628-C-T 18953742-C-T **
21127395-G-A 18965509-G-A **
21201952-T-C 19040066-T-C **
21202078-A-C 19040192-A-C **
21207845-C-A 19045959-C-A **
19622021-T-A 17510141-T-A P5_Prx **
19557509-C-A 17445629-C-A **
19088383-C-A 16976503-C-A **
19302410-C-A 17190530-C-A **
19121836-G-T 17009956-G-T **
19129081-G-A 17017201-G-A **
19172911-A-T 17061031-A-T **
19204004-T-A 17092124-T-A **
19241517-G-A 17129637-G-A **
19241527-T-C 17129647-T-C **
19241532-A-C 17129652-A-C **
19248850-C-A 17136970-C-A **
19268296-C-A 17156416-C-A **
19328319-T-C 17216439-T-C **
19537912-A-AG 17426032-A-AG **
19351694-G-C 17239814-G-C **
19393053-C-A 17281173-C-A **
19410037-G-T 17298157-G-T **
19423919-A-G 17312039-A-G **
19460039-C-A 17348159-C-A **
19482283-C-A 17370403-C-A **
19506788-C-A 17394908-C-A **
19523440-GC-G 17411560-GC-G **
19532717-T-G 17420837-T-G **
19535562-A-C 17423682-A-C **
10927861-G-A **
10898829-C-A **
10927844-C-A **
3870953-TAA-T 4002912-TAA-T 13×A**
3390510-T-A 3522469-T-A **
3467337-G-T 3599296-G-T **
3550569-CAACTCA-C 3682528-CAACTCA-C **
3609645-C-G 3741604-C-G **
3609683-T-G 3741642-T-G **
3696028-A-G 3827987-A-G **
3732090-T-C 3864049-T-C **
3815168-G-T 3947127-G-T **
3956198-A-T 4088157-A-T **
3252608-G-A 3384567-G-A **
3960125-A-G 4092084-A-G **
3966911-G-T 4098870-G-T **
4043777-C-A 4175736-C-A **
4080984-C-A 4212943-C-A **
4081083-C-G 4213042-C-G **
4302515-A-G 4434474-A-G **
4412303-A-T 4544262-A-T **
4444748-T-A 4576707-T-A **
3334786-A-T 3466745-A-T **
3251986-T-C 3383945-T-C **
4474085-G-A 4606044-G-A FT64677 **
2680978-C-G 2812937-C-G **
15115774-G-GT 13003861-G-GT 9×T**
18950671-C-A 16838791-C-A **
5393474-C-A 5525433-C-A **
10673942-G-T **
24264540-A-G 22118393-A-G P3_b1 **
9702953-T-A 9865344-T-A IR3_Prx **
25246598-A-T 23100451-A-T P2_r1 **
21387290-C-A 19225404-C-A **
2740523-TA-T 2872482-TA-T **
3151744-G-T 3283703-G-T **
2773778-A-T 2905737-A-T **
2795134-ATGATGTGTTTGCTTACC-A 2927093-ATGATGTGTTTGCTTACC-A **
2795156-CA-T 2927115-CA-T **
2795159-CATGATTGTAAATT-C 2927118-CATGATTGTAAATT-C **
2928195-A-G 3060154-A-G **
3091992-T-C 3223951-T-C **
3111748-C-A 3243707-C-A **
3116517-C-G 3248476-C-G **
3131062-C-A 3263021-C-A **
4473872-A-T 4605831-A-T **
4505576-T-C 4637535-T-C **
14567090-G-T 12455290-G-T **
6464978-A-G 6596937-A-G **
5985916-G-A 6117875-G-A **
5985922-C-T 6117881-C-T **
5985926-T-C 6117885-T-C **
5985927-C-A 6117886-C-A **
6092207-C-A 6224166-C-A **
6147544-G-T 6279503-G-T IR3_Dst **
6231140-G-A 6363099-G-A IR3_Dst **
6384807-CACA-C 6516766-CACA-C **
6582736-C-T 6714695-C-T **
5935266-T-G 6067225-T-G **
6582775-C-A 6714734-C-A **
6622949-CT-C 6754908-CT-C **
6637292-G-T 6769251-G-T **
6744568-C-G 6876527-C-G **
6765766-C-A 6897725-C-A **
6765982-A-T 6897941-A-T **
6765988-C-G 6897947-C-G **
6771401-G-A 6903360-G-A **
5969756-C-A 6101715-C-A **
5935244-A-G 6067203-A-G **
4534091-G-T 4666050-G-T **
5264217-C-G 5396176-C-G **
4840084-A-G 4972043-A-G **
4879707-C-A 5011666-C-A **
4888593-G-T 5020552-G-T **
4898459-T-A 5030418-T-A **
4920913-G-T 5052872-G-T **
4930930-A-G 5062889-A-G **
4976805-AAAAG-A 5108764-AAAAG-A **
5186468-T-A 5318427-T-A **
10927714-CATTCCA-C **
5853494-G-T 5985453-G-T **
5393570-T-C 5525529-T-C **
5448684-CA-C 5580643-CA-C **
5550409-A-T 5682368-A-T **
5577264-C-T 5709223-C-T **
5621472-C-T 5753431-C-T **
5621499-A-T 5753458-A-T **
5626031-C-A 5757990-C-A **
5818015-C-A 5949974-C-A **
5851891-C-A 5983850-C-A **
11037802-G-T **
2859132-C-A 2991091-C-A **
6771514-A-G 6903473-A-G **
10902162-C-A **
9077312-G-T 9239703-G-T **
6619694-C-A 6751653-C-A **
11672680-C-A **
18147556-G-T 16035676-G-T **
18422861-C-A 16310981-C-A P6_Gap **
13705512-A-AATTCC 11549836-A-AATTCC **
18035711-T-C 15923831-T-C **
9535173-G-T 9697564-G-T IR3_Prx **
16562808-T-A 14450928-T-A **
13945217-C-A 11824511-C-A **
23831295-C-T 21669409-C-T **
11005382-C-A **
20510995-C-T 18349109-C-T P5_Dst **
10927846-C-T **
56861065-C-CGTTCAAAAATTAACCATATAGACGGACAA **
17879428-C-A 15767548-C-A **
19361171-C-A 17249291-C-A **
24466073-C-A 22319926-C-A **
6231166-T-A 6363125-T-A IR3_Dst **
14080222-C-A 11959516-C-A **
11658836-C-A **
26045932-A-T 23899785-A-T P1_Y1 **
58884239-G-A 56706632-C-T **
22297068-A-T 20135182-A-T DYZ19 **
2855484-G-T 2987443-G-T **
13295276-A-G 11139600-A-G **
21464577-C-A 19302691-C-A **
19410150-C-A 17298270-C-A FT58562 **
22215290-G-A 20053404-G-A **
17994809-G-A 15882929-G-A P7_Prx **
22296984-T-C 20135098-T-C DYZ19 **
11659101-C-A **
28700731-CTATATATA-C 26554584-CTATATATA-C 17×TA**
58884258-C-T 56706613-G-A **
8016924-CT-C 8148883-CT-C 8×T**
18085708-A-G 15973828-A-G **
7186238-A-C 7318197-A-C **
22241130-A-G 20079244-A-G DYZ19 *****
3726368-C-A 3858327-C-A **
17942103-CTT-C 15830223-CTT-C 11×T**
10986455-T-A **
7335730-C-A 7467689-C-A **
24884192-A-T 22738045-A-T g1 **
14561895-C-A 12450096-C-A **
10986456-T-C **
3847319-C-A 3979278-C-A **
16095267-A-C 13983387-A-C **
21428566-C-A 19266680-C-A **
19963812-G-A 17851932-G-A P5_Prx **
19187443-AC-A 17075563-AC-A **
10986426-C-T **
10986436-T-C **
10986438-C-G **
15969954-C-A 13858074-C-A **
20893455-A-AC 18731569-A-AC P4_Dst **
10763453-C-A **
4900817-G-T 5032776-G-T **
18480346-G-A 16368466-G-A P6_Dst **
15732086-C-A 13620206-C-A **
10845713-T-C **
15785853-GT-G 13673973-GT-G **
19415910-C-A 17304030-C-A **
4604348-C-A 4736307-C-A **
20775220-T-A 18613334-T-A P4_Prx **
6751550-C-A 6883509-C-A **
14008778-GAAAAA-G 11888072-GAAAAA-G 25×A**
4178897-C-A 4310856-C-A **
15866107-T-A 13754227-T-A **
19270564-T-G 17158684-T-G **
2960048-C-A 3092007-C-A **
10877898-T-C **
10877903-T-A **
10877904-A-C **
10877916-C-T **
10877933-G-A **
10764548-T-C **
11023016-G-C **
13299505-C-A 11143829-C-A **
9551441-T-TA 9713832-T-TA IR3_Prx **
18858566-C-A 16746686-C-A **
10911698-G-A **
10911728-G-C **
6295515-T-TA 6427474-T-TA IR3_Dst **
24109043-C-A 21962896-C-A P3_b1 **
6179636-A-C 6311595-A-C IR3_Dst **
21141426-C-A 18979540-C-A **
6771411-G-T 6903370-G-T **
5292844-A-T 5424803-A-T **
6808021-C-A 6939980-C-A **
10686471-C-G **
10662573-A-C **
10662577-T-C **
10662595-A-T **
10663420-C-A **
10668355-C-A **
10672748-C-A **
6881158-A-G 7013117-A-G **
10686276-G-T **
10691535-C-T **
10662541-A-T **
10744245-TC-T **
10744248-ATTCC-A **
10755392-A-CGTTC **
10760253-T-A **
10760289-CCG-C **
10760295-G-TCC **
10760297-T-C **
10760323-T-C **
10662572-G-A **
10662540-T-C **
10763690-C-G **
10017984-C-A 10180375-C-A **
9937025-A-C 10099416-A-C **
9937837-C-A 10100228-C-A **
9942167-C-A 10104558-C-A **
9945078-C-A 10107469-C-A **
9955411-C-A 10117802-C-A **
9978437-G-T 10140828-G-T **
9991156-C-A 10153547-C-A **
10004806-A-G 10167197-A-G **
10040066-C-T 10202457-C-T **
10662532-C-T **
10057444-C-A 10219835-C-A **
10652196-C-T **
10655199-G-T **
10660362-G-T **
10661368-A-C **
10662518-T-C **
10662520-C-G **
10662523-T-A **
10760334-C-CGTGTT **
10764554-C-CGGCTT **
9799417-G-T 9961808-G-T **
10890355-C-A **
10844665-T-C **
10844670-C-T **
10856651-C-A **
10877892-G-C **
10877940-G-T **
10879242-G-A **
10890161-C-A **
10890223-C-T **
10894038-C-A **
10844648-C-A **
10894722-C-A **
10898572-C-T **
10899486-C-T **
10921857-C-A **
10924374-T-G **
10924394-T-TC **
10924396-CCA-C **
10924472-C-A **
10844657-C-T **
10844643-C-A **
10764577-T-TTCGGGTTGAA **
10818685-C-A **
10769666-A-C **
10769695-A-G **
10792741-T-G **
10792761-T-A **
10792769-A-G **
10796869-C-A **
10801657-G-T **
10801662-C-T **
10818695-C-G **
10844630-T-C **
10818705-C-G **
10829069-A-G **
10834035-T-A **
10834079-A-G **
10834093-C-A **
10844613-A-T **
10844621-T-A **
10844625-C-T **
9832612-C-A 9995003-C-A **
10683209-T-C **
9784669-C-T 9947060-C-T **
7413960-C-A 7545919-C-A **
7277577-A-G 7409536-A-G **
7325749-C-A 7457708-C-A **
7334067-C-A 7466026-C-A **
9551425-C-A 9713816-C-A IR3_Prx **
7335727-AA-T 7467686-AA-T **
7374506-A-G 7506465-A-G **
7383888-A-G 7515847-A-G **
7385341-C-A 7517300-C-A **
7416680-A-T 7548639-A-T **
7255557-C-A 7387516-C-A **
7464054-A-C 7596013-A-C IR1_L **
7464060-A-C 7596019-A-C IR1_L **
7475365-T-A 7607324-T-A IR1_L **
7613831-C-A 7745790-C-A **
7645516-C-A 7777475-C-A **
7705540-C-A 7837499-C-A **
7758738-G-T 7890697-G-T **
7821072-C-A 7953031-C-A **
7867045-T-A 7999004-T-A **
7269692-A-G 7401651-A-G **
7243858-C-A 7375817-C-A **
7970343-G-A 8102302-G-A **
7042289-A-C 7174248-A-C **
6881369-C-G 7013328-C-G **
6892379-G-A 7024338-G-A **
6892466-A-C 7024425-A-C **
6892473-C-T 7024432-C-T **
6916173-T-A 7048132-T-A **
6925681-C-A 7057640-C-A **
7029700-A-G 7161659-A-G **
7038402-C-A 7170361-C-A **
7058220-C-A 7190179-C-A **
7225778-G-T 7357737-G-T **
7062657-A-G 7194616-A-G **
7076235-T-A 7208194-T-A **
7090607-T-G 7222566-T-G **
7098606-C-A 7230565-C-A **
7139309-C-A 7271268-C-A **
7154603-C-A 7286562-C-A **
7158964-C-A 7290923-C-A **
7186790-C-A 7318749-C-A **
7203698-G-A 7335657-G-A **
7896656-T-C 8028615-T-C **
29927-T-C **
8085349-A-C 8217308-A-C **
9108261-T-C **
8353346-C-A 8485305-C-A **
8379273-C-A 8511232-C-A **
8379687-C-A 8511646-C-A **
8734911-C-A 8866870-C-A **
8735634-T-G 8867593-T-G **
8761581-A-G 8893540-A-G **
8852219-C-G 8984178-C-G **
9015201-C-A 9177592-C-A **
8325527-A-T 8457486-A-T **
9015776-T-C 9178167-T-C **
9077280-C-A 9239671-C-A **
9330797-A-C 9493188-A-C **
9438101-T-TA 9600492-T-TA **
9444875-C-A 9607266-C-A **
9508485-C-A 9670876-C-A **
9535174-G-GT 9697565-G-GT IR3_Prx **
8333635-T-C 8465594-T-C **
9063770-T-A 9226161-T-A **
8127934-CA-C 8259893-CA-C 8×A**
8279938-C-A 8411897-C-A **
8154019-A-G 8285978-A-G **
8230395-C-A 8362354-C-A **
8158865-C-A 8290824-C-A **
21861398-G-A 19699512-G-A ***
2847143-G-T 2979102-G-T ***
22303871-G-A 20141985-G-A DYZ19 ***
18556556-CTGTG-C 16444676-CTGTG-C 15×TG***
19391771-C-A 17279891-C-A ***
28560627-C-A 26414480-C-A ***
7201611-A-T 7333570-A-T Y30462 ***
8452227-G-A 8584186-G-A ***
9190278-C-T 9352669-C-T ***
7188711-G-GGA 7320670-G-GGA 10×GA***
19411976-G-A 17300096-G-A ***
9364890-G-C 9527281-G-C ***
19596295-A-G 17484415-A-G P5_Prx ***
20030808-GTCC-G 17918928-GTCC-G P5_Prx ***
20030813-GACA-G 17918933-GACA-G P5_Prx ***
20030822-T-TG 17918942-T-TG P5_Prx ***
7803116-GAA-G 7935075-GAA-G 14×A***
22248883-G-A 20086997-G-A DYZ19 ***
22251743-G-T 20089857-G-T DYZ19 ***
9334611-C-A 9497002-C-A ***
16931693-G-T 14819813-G-T ***
28786367-A-T 26640220-A-T ***
21153123-C-A 18991237-C-A ***
18926909-A-T 16815029-A-T ***
14977709-CTT-C 12865784-CTTT-C 14×T***
25082148-C-T 22936001-C-T g1 ***
13938879-T-C 11818173-T-C ***
17815787-T-TGA 15703907-T-TGA 14×GA***
16430208-C-T 14318328-C-T ***
56835401-CAGTACATTCCACTCCACTCCACTCC-C,CAGTACATTCCCCTCCACGCCACTCA ***
56832466-C-A ***
56827681-C-A ***
23389550-G-T 21227664-G-T ***
22285483-G-A 20123597-G-A DYZ19 ***
18465454-C-A 16353574-C-A BY12043 P6_Dst ***
58981193-C-T 56835046-C-T ***
14530877-TAC-T 12419078-TAC-T 9×AC***
8124973-A-G 8256932-A-G ***
6655160-C-A 6787119-C-A ***
9937258-A-T 10099649-A-T ***
6915826-A-G 7047785-A-G ***
28792470-G-A 26646323-G-A ***
56834492-C-G ***
9954717-C-A 10117108-C-A ***
24518651-G-A 22372504-G-A ***
24074302-G-A 21928155-G-A P3_b1 ***
22435568-A-C 20273682-A-C DYZ19 ***
7359664-C-A 7491623-C-A ***
7501520-G-T 7633479-G-T IR1_L ***
15818376-C-A 13706496-C-A ***
22536603-C-A 20374717-C-A ***
22489666-G-T 20327780-G-T DYZ19 ***
8555800-C-A 8687759-C-A ***
14316186-CTT-C,CT 12195480-CTT-C,CT 14×T***
3593972-C-A 3725931-C-A ***
21923295-ATTT-A 19761409-ATTT-A 15×T***
14884685-T-G 12772751-T-G ***
10660817-G-T ***
14585846-G-T 12474046-G-T ***
14324920-TG-T 12204214-TG-T ***
15971761-GT-G 13859881-GT-G 11×T***
22122274-T-C 19960388-T-C ***
13485577-T-G 11329901-T-G ***
13485603-G-C 11329927-G-C ***
13485608-G-T 11329932-G-T ***
3790878-G-GTATATATA 3922837-G-GTATATATA 21×TA***
13493995-C-A 11338319-C-A ***
7201630-CTT-C 7333589-CTT-C 11×T***
7142465-T-C 7274424-T-C ***
22498702-T-A 20336816-T-A DYZ19 ***
23516365-C-A 21354479-C-A ***
17923862-A-T 15811982-A-T ***
24094688-C-T 21948541-C-T P3_b1 ***
24328468-T-C 22182321-T-C P3_t1 ***
24804389-C-T 22658242-C-T P3_b2 ***
24947022-A-C 22800875-A-C g1 ***
21751008-G-T ***
21750974-G-T ***
25214674-T-C 23068527-T-C P2_r1 ***
28784495-G-A 26638348-G-A ***
23196197-G-T 21034311-G-T ***
21225096-C-A 19063210-C-A ***
13958765-C-T 11838059-C-T ***
13218423-T-C 11062747-T-C ***
14367949-G-T 12247245-G-T ***
16409009-G-T 14297129-G-T ***
13484066-G-T 11328390-G-T ***
13725983-A-G 11570307-A-G ***
18688347-T-C 16576467-T-C ***
13258018-C-A 11102342-C-A ***
13446804-GC-G 11291128-GC-G 12×CCATT***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 514821064536476926007769266
Kit: 51482958898278221137724500
Used in age calculations1064536478221137769266
Counts of SNPs1820
Variant counts last updated 2019-07-19 22:58:01.



Big Tree Main Page