Tree Position

R-P312/S116 > Z40481 > ZZ11 > DF27/S250 > Z195/S355 > Z198 > ZS312 > Z262 > M167 > Z264 > BY3266 > Y36580 > Y110315

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
473435
BigY2
473435
24289234-G-A 22143087-G-A P3_t1 ***A*
22286536-G-A 20124650-G-A DYZ19 ***A*
24267223-G-A 22121076-G-A BY26610 P3_b1 15×CAA*
21470489-G-A 19308603-G-A Y106577 YY++
14710725-G-T 12598792-G-T Y92018 YY++
6735969-C-A 6867928-C-A Y82421 YY++
23451644-T-G 21289758-T-G Y111568 YY++
8594378-C-T 8726337-C-T BY74368 YY++
9172053-T-A 9334444-T-A Y88799 Y++
9463829-C-A 9626220-C-A Y89059 Y++
9643535-G-A 9805926-G-A Y89100 IR3_Prx ++
14394476-A-G 12273772-A-G BY95413 YY++
14646072-C-G 12534136-C-G Y91887 YY++
17241667-G-GA 15129787-G-GA 8×A++
16255159-C-A 14143279-C-A Y95749 YY++
17368183-C-T 15256303-C-T Y98948 YY++
18100089-G-T 15988209-G-T Y101292 YY++
21693818-C-A 19531932-C-A Y107234 YY++
22028300-A-G 19866414-A-G Y108180 YY++
22514037-T-C 20352151-T-C Y108901 Y++
22515891-A-T 20354005-A-T Y108923 Y++
22558588-G-A 20396702-G-A Y109083 YY++
22725027-T-C 20563141-T-C Y109574 YY++
2910031-A-G 3041990-A-G Y81782 YY++
8581680-G-C 8713639-G-C Y87357 YY++
22447352-T-A 20285466-T-A BY219911 DYZ19 +
22811482-G-T 20649596-G-T Y109836 Y**+
4133683-C-T 4265642-C-T ****
13487446-C-A 11331770-C-A *
15752647-T-TCTC 13640767-T-TCTC ****
15844879-C-A 13732999-C-A **
15927859-A-C 13815979-A-C **
15899121-C-A 13787241-C-A **
15864355-G-T 13752475-G-T **
15863196-C-A 13751316-C-A **
15844930-A-G 13733050-A-G **
15606397-C-T 13494517-C-T **
15844926-T-G 13733046-T-G **
15606511-A-T 13494631-A-T **
15844921-A-C 13733041-A-C **
15665714-T-A 13553834-T-A **
15844863-T-C 13732983-T-C **
15685281-T-C 13573401-T-C **
15803513-T-C 13691633-T-C **
15791024-A-C 13679144-A-C **
15743611-C-A 13631731-C-A **
15742360-A-G 13630480-A-G **
15739983-A-G 13628103-A-G **
15622586-A-T 13510706-A-T **
15622623-AT-A 13510743-AT-A **
15647087-T-C 13535207-T-C **
15733720-T-G 13621840-T-G **
15733706-C-A 13621826-C-A **
15712234-C-A 13600354-C-A **
15698660-C-A 13586780-C-A **
15841898-C-A 13730018-C-A **
6666200-A-C 6798159-A-C **
15597317-G-T 13485437-G-T **
15366049-G-T 13254169-G-T **
14993842-A-ATT 12881927-A-ATT 13×T**
14993892-C-T 12881977-C-T **
14993901-C-T 12881986-C-T **
14993928-C-T 12882013-C-T **
15001452-C-T 12889537-C-T **
15001460-C-T 12889545-C-T **
15060789-C-A 12948881-C-A **
15070485-T-G 12958576-T-G **
15157803-C-A 13045890-C-A **
15221849-C-A 13109935-C-A **
15259299-T-G 13147383-T-G **
15283173-G-T 13171272-G-T **
24910907-A-TAT 22764760-A-TAT g1 **
15374461-TG-A 13262581-TG-A **
15542035-T-G 13430155-T-G **
15379826-G-T 13267946-G-T **
15391274-A-G 13279394-A-G **
15400123-A-G 13288243-A-G **
15400143-G-C 13288263-G-C **
15400147-A-G 13288267-A-G **
15424819-T-C 13312939-T-C **
15442292-C-A 13330412-C-A **
24885595-G-T 22739448-G-T g1 **
15503406-A-T 13391526-A-T **
15515178-CTTT-C 13403298-CTTT-C 14×T**
15941521-C-G 13829641-C-G **
15530195-G-A 13418315-G-A **
15542003-T-A 13430123-T-A **
15941502-T-A 13829622-T-A **
16058949-C-A 13947069-C-A **
16001037-C-A 13889157-C-A **
16703394-C-A 14591514-C-A **
16476287-T-G 14364407-T-G **
16480081-C-A 14368201-C-A **
16481039-T-A 14369159-T-A **
16481068-C-T 14369188-C-T **
16602789-C-A 14490909-C-A **
16605238-C-A 14493358-C-A **
16617696-C-A 14505816-C-A **
16625796-T-A 14513916-T-A **
16625873-C-A 14513993-C-A **
16653141-A-C 14541261-A-C **
16663738-C-A 14551858-C-A **
16720198-C-A 14608318-C-A **
16428643-A-C 14316763-A-C **
16777741-T-G 14665861-T-G **
16826589-T-G 14714709-T-G **
16874800-C-T 14762920-C-T **
16904561-T-C 14792681-T-C **
16921199-C-A 14809319-C-A **
16928833-T-C 14816953-T-C **
16993289-C-A 14881409-C-A **
17000161-A-C 14888281-A-C **
17002772-A-C 14890892-A-C **
17002804-T-C 14890924-T-C **
17056633-C-A 14944753-C-A **
17071118-A-G 14959238-A-G **
16471227-A-T 14359347-A-T **
16354186-T-A 14242306-T-A **
16015834-C-A 13903954-C-A **
25508934-C-G 23362787-C-G P1_gr1 **
16016317-T-C 13904437-T-C **
16016367-G-A 13904487-G-A **
16018411-C-A 13906531-C-A **
16027497-G-T 13915617-G-T **
16034208-G-A 13922328-G-A **
16038811-A-T 13926931-A-T **
16044585-C-A 13932705-C-A **
16044648-A-C 13932768-A-C **
16044667-A-G 13932787-A-G **
16045489-C-A 13933609-C-A **
16048925-C-A 13937045-C-A **
16057348-A-G 13945468-A-G **
16064873-T-C 13952993-T-C **
16354061-T-A 14242181-T-A **
16091240-C-A 13979360-C-A **
16115539-T-G 14003659-T-G P8_Prx **
16184410-G-A 14072530-G-A **
16221002-C-G 14109122-C-G **
16232314-C-A 14120434-C-A **
16271806-G-A 14159926-G-A **
16272279-A-C 14160399-A-C **
24884192-A-T 22738045-A-T g1 **
16316625-C-T 14204745-C-T **
16341055-C-A 14229175-C-A **
16342364-G-T 14230484-G-T **
16345024-C-A 14233144-C-A **
14953581-C-A 12841655-C-A **
14526511-T-G 12414712-T-G **
14914774-C-A 12802841-C-A **
13698516-T-C 11542840-T-C **
13487726-C-G 11332050-C-G **
13487766-C-A 11332090-C-A **
13487784-G-A 11332108-G-A **
13487796-G-C 11332120-G-C **
13487803-G-A 11332127-G-A **
13512861-A-G 11357185-A-G **
13523341-C-A 11367665-C-A **
13570897-C-T 11415221-C-T **
13613552-A-T 11457876-A-T **
13696126-A-T 11540450-A-T **
13698499-A-T 11542823-A-T **
13698938-A-G 11543262-A-G **
13487119-C-A 11331443-C-A **
11645683-G-T **
11658836-C-A **
25964893-A-T 23818746-A-T P1_Y1 **
11673566-C-A **
25964814-C-A 23818667-C-A P1_Y1 **
13804322-A-T 11683616-A-T **
13840764-T-A 11720058-T-A **
13855601-G-T 11734895-G-T **
13856361-T-A 11735655-T-A **
13857416-G-C 11736710-G-C **
13859008-T-A 11738302-T-A **
25952189-A-T 23806042-A-T P1_Y1 **
13487698-C-T 11332022-C-T **
13479660-G-A 11323984-G-A **
13909803-C-A 11789097-C-A **
13372067-A-C 11216391-A-C **
13208134-T-C 11052458-T-C **
13213884-T-G 11058208-T-G **
26138220-T-G 23992073-T-G P1_Y1 **
13231700-T-A 11076024-T-A **
13236732-A-C 11081056-A-C **
13256013-C-A 11100337-C-A **
13271775-TAA-T 11116099-TAA-T 12×A**
13278545-C-A 11122869-C-A **
13297624-C-A 11141948-C-A **
13298985-T-C 11143309-T-C **
13320118-C-A 11164442-C-A **
13329655-G-T 11173979-G-T **
13404479-C-A 11248803-C-A **
13479659-A-C 11323983-A-C **
26114489-C-A 23968342-C-A P1_Y1 **
26075418-A-C 23929271-A-C P1_Y1 **
13456678-A-G 11301002-A-G **
26045955-A-T 23899808-A-T P1_Y1 **
13466144-C-A 11310468-C-A **
26029505-A-C 23883358-A-C P1_Y1 **
26029490-G-C 23883343-G-C P1_Y1 **
26029473-A-T 23883326-A-T P1_Y1 **
26001437-A-G 23855290-A-G P1_Y1 **
25964901-T-TCG 23818754-T-TCG P1_Y1 **
25964896-T-TAC 23818749-T-TAC P1_Y1 **
13479628-C-G 11323952-C-G **
13896333-C-T 11775627-C-T **
13909848-G-T 11789142-G-T **
14845394-T-C 12733460-T-C **
17089123-T-C 14977243-T-C Y98153 **
14420130-C-A 12299405-C-A **
14427121-T-C 12306396-T-C **
14432273-C-A 12311546-C-A **
14445108-C-A 12324381-C-A **
14461202-C-A 12340475-C-A **
14483566-A-G 12362835-A-G **
14506982-A-T 12395187-A-T **
14506997-C-G 12395202-C-G **
14517595-C-G 12405796-C-G **
14517621-C-A 12405822-C-A **
14517642-T-A 12405843-T-A **
14538679-C-T 12426880-C-T **
14401998-C-A 12281295-C-A **
14544305-T-A 12432506-T-A **
14552420-C-A 12440621-C-A **
14574597-A-T 12462797-A-T **
14593141-C-A 12481341-C-A **
14614613-C-A 12502811-C-A **
14630391-C-A 12518460-C-A **
14660342-G-T 12548407-G-T **
14714789-C-A 12602856-C-A **
14719237-G-T 12607305-G-T **
14757882-C-A 12645951-C-A **
14806013-C-A 12694084-C-A **
14806084-C-A 12694155-C-A **
14405815-C-A 12285112-C-A **
14386268-T-G 12265564-T-G **
13919213-A-C 11798507-A-C **
14130114-C-A 12009408-C-A **
13919220-A-C 11798514-A-C **
13919948-G-T 11799242-G-T **
13920978-C-A 11800272-C-A **
13921088-C-A 11800382-C-A **
13937064-A-G 11816358-A-G **
14007238-C-A 11886532-C-A **
14007315-A-C 11886609-A-C **
14046731-G-A 11926025-G-A **
14065461-C-A 11944755-C-A **
14089240-C-A 11968534-C-A **
14089322-C-A 11968616-C-A **
14118197-C-A 11997491-C-A **
14142389-C-G 12021683-C-G **
14386263-A-G 12265559-A-G **
14142418-T-G 12021712-T-G **
14225393-A-G 12104687-A-G **
14228738-T-G 12108032-T-G **
14274080-C-A 12153374-C-A **
14278398-C-A 12157692-C-A **
25509004-T-TC 23362857-T-TC P1_gr1 **
14295266-A-T 12174560-A-T **
14312272-G-A 12191566-G-A **
14367677-G-T 12246973-G-T **
14367680-A-C 12246976-A-C **
14367708-T-C 12247004-T-C **
14379358-C-A 12258654-C-A **
17071120-G-A 14959240-G-A **
17545822-C-A 15433942-C-A **
17095615-G-T 14983735-G-T **
21700569-G-A 19538683-G-A **
21297471-G-T 19135585-G-T **
21421564-GA-G 19259678-GA-G 10×A**
21455412-T-C 19293526-T-C **
21476191-C-T 19314305-C-T **
21482784-G-T 19320898-G-T **
21503190-C-A 19341304-C-A **
24509433-T-G 22363286-T-G **
21515837-T-C 19353951-T-C **
21515861-TCAAA-T 19353975-TCAAA-T **
21582325-G-T 19420439-G-T **
21584433-A-G 19422547-A-G Y27679 **
21713441-A-G 19551555-A-G **
21262588-C-A 19100702-C-A **
21738778-T-G 19576892-T-G **
21821624-T-A 19659738-T-A **
21858221-C-A 19696335-C-A **
24472421-GTTTT-G 22326274-GTTTT-G 25×T**
21922065-A-T 19760179-A-T **
21935189-T-A 19773303-T-A **
24458739-T-G 22312592-T-G **
21959092-C-A 19797206-C-A **
21959139-C-A 19797253-C-A **
22073952-A-C 19912066-A-C **
22081062-C-A 19919176-C-A **
22125748-C-A 19963862-C-A **
21279097-T-A 19117211-T-A **
21237251-G-A 19075365-G-A **
22135746-C-A 19973860-C-A **
20478272-G-T 18316386-G-T P5_Dst **
19835427-C-G 17723547-C-G P5_Prx **
19835482-T-TC 17723602-T-TC P5_Prx **
19842702-A-G 17730822-A-G P5_Prx **
19847692-C-T 17735812-C-T P5_Prx **
19882543-A-T 17770663-A-T P5_Prx **
19882576-A-C 17770696-A-C P5_Prx **
19891007-T-G 17779127-T-G P5_Prx **
20078759-A-AC 17966879-A-AC P5_Dst **
20306261-C-A 18144375-C-A P5_Dst **
20409575-G-T 18247689-G-T P5_Dst **
20478263-C-CT 18316377-C-CT P5_Dst **
20478269-A-C 18316383-A-C P5_Dst **
20497209-T-TCCA 18335323-T-TCCA P5_Dst **
21162846-G-C 19000960-G-C **
20497222-CCG-C 18335336-CCG-C P5_Dst **
20666087-T-TC 18504201-T-TC P4_Prx **
20815414-TA-T 18653528-TA-T P4_Gap **
20888623-C-A 18726737-C-A P4_Dst **
21037509-C-A 18875623-C-A **
21133463-A-C 18971577-A-C **
21134886-A-T 18973000-A-T **
21134910-C-T 18973024-C-T **
21139320-G-T 18977434-G-T **
24614241-G-T 22468094-G-T P3_t2 **
24614195-A-G 22468048-A-G P3_t2 **
21162824-C-A 19000938-C-A **
22134213-C-A 19972327-C-A **
22189058-C-A 20027172-C-A **
19753420-T-G 17641540-T-G P5_Prx **
23832941-T-C 21671055-T-C **
23189612-T-C 21027726-T-C Y36581 **
23206809-C-A 21044923-C-A **
23339373-GT-G 21177487-GT-G **
23377348-C-T 21215462-C-T **
23505095-C-A 21343209-C-A **
23569060-T-G 21407174-T-G **
23773517-C-A 21611631-C-A **
23801617-C-A 21639731-C-A **
23802083-A-AAT 21640197-A-AAT **
23807441-G-T 21645555-G-T **
23807566-G-A 21645680-G-A **
23808687-G-T 21646801-G-T **
23848039-A-G 21686153-A-G **
23111782-C-T 20949896-C-T **
21750720-G-T **
23997432-A-G 21851285-A-G **
23997460-C-A 21851313-C-A **
24264408-A-G 22118261-A-G P3_b1 **
24278049-T-G 22131902-T-G P3_b1 **
24290798-C-T 22144651-C-T P3_t1 **
24290809-A-G 22144662-A-G P3_t1 **
24300814-T-TA 22154667-T-TA P3_t1 **
24300841-A-T 22154694-A-T P3_t1 **
24300851-G-T 22154704-G-T P3_t1 **
24341919-C-A 22195772-C-A P3_t1 **
24341927-T-TC 22195780-T-TC P3_t1 **
23126655-T-G 20964769-T-G **
23097139-G-T 20935253-G-T **
22189217-G-T 20027331-G-T **
22654989-T-A 20493103-T-A **
22204505-G-T 20042619-G-T **
22253123-T-C 20091237-T-C DYZ19 **
22316314-G-T 20154428-G-T DYZ19 **
22316328-G-T 20154442-G-T DYZ19 **
22335167-G-A 20173281-G-A DYZ19 **
22471368-C-G 20309482-C-G DYZ19 **
22520600-A-T 20358714-A-T **
22529539-G-A 20367653-G-A **
22586995-A-G 20425109-A-G **
22614110-G-C 20452224-G-C **
22629860-T-C 20467974-T-C **
22650962-A-C 20489076-A-C **
22729455-G-T 20567569-G-T **
23097113-C-A 20935227-C-A **
22776970-C-A 20615084-C-A **
22781926-T-A 20620040-T-A **
22809043-C-A 20647157-C-A **
22820362-A-G 20658476-A-G **
22903696-C-A 20741810-C-A **
22965706-T-A 20803820-T-A **
22965732-C-A 20803846-C-A **
22965741-T-G 20803855-T-G **
22965742-T-A 20803856-T-A **
23004158-C-A 20842272-C-A **
23004698-T-G 20842812-T-G **
23036738-G-A 20874852-G-A **
19835421-T-G 17723541-T-G P5_Prx **
19678839-G-C 17566959-G-C P5_Prx **
17123217-G-A 15011337-G-A **
24875477-A-G 22729330-A-G g1 **
17918666-C-A 15806786-C-A **
17963533-C-T 15851653-C-T **
17968896-G-T 15857016-G-T **
17968940-G-A 15857060-G-A **
17992522-A-C 15880642-A-C P7_Prx **
17992532-A-ACC 15880652-A-ACC P7_Prx **
18154558-A-C 16042678-A-C **
18158728-C-A 16046848-C-A **
18186118-G-T 16074238-G-T **
18194567-C-A 16082687-C-A **
18201607-C-A 16089727-C-A **
24671169-G-A 22525022-G-A P3_b2 **
17865377-G-T 15753497-G-T **
18263843-C-G 16151963-C-G **
24636407-G-T 22490260-G-T P3_t2 **
18307711-C-A 16195831-C-A P6_Prx **
18307719-A-AT 16195839-A-AT P6_Prx **
18340496-A-T 16228616-A-T P6_Prx **
18340518-A-C 16228638-A-C P6_Prx **
18340561-T-C 16228681-T-C P6_Prx **
18340564-A-C 16228684-A-C P6_Prx **
18346543-G-A 16234663-G-A P6_Prx **
18389185-T-C 16277305-T-C P6_Gap **
18389292-A-G 16277412-A-G P6_Gap **
18389309-C-A 16277429-C-A P6_Gap **
17913143-A-G 15801263-A-G **
17822638-A-T 15710758-A-T **
18389321-A-G 16277441-A-G P6_Gap **
17504791-C-A 15392911-C-A **
17126474-C-A 15014594-C-A **
17139668-C-A 15027788-C-A **
17213237-G-T 15101357-G-T **
17213240-A-G 15101360-A-G **
17224304-C-A 15112424-C-A **
17297145-A-C 15185265-A-C **
17338578-G-T 15226698-G-T **
17385275-T-C 15273395-T-C **
17425087-C-A 15313207-C-A **
17431389-G-T 15319509-G-T **
17503832-C-A 15391952-C-A **
17503836-A-C 15391956-A-C **
13202569-C-A 11046893-C-A **
17770498-G-A 15658618-G-A **
17561861-G-T 15449981-G-T **
17575521-T-G 15463641-T-G **
17600457-A-G 15488577-A-G **
17644309-G-T 15532429-G-T **
17644337-T-A 15532457-T-A **
17644366-T-G 15532486-T-G **
17653891-T-G 15542011-T-G **
17685768-C-T 15573888-C-T **
17716820-C-A 15604940-C-A **
17716892-A-C 15605012-A-C **
17735524-T-C 15623644-T-C **
17752052-C-A 15640172-C-A **
18389319-T-A 16277439-T-A P6_Gap **
18391947-C-A 16280067-C-A P6_Gap **
19678832-T-C 17566952-T-C P5_Prx **
19399806-A-T 17287926-A-T **
19043004-C-A 16931124-C-A **
19081263-A-G 16969383-A-G **
19127858-C-A 17015978-C-A 17×A**
19127870-A-T 17015990-A-T **
19143125-A-ATT 17031245-A-ATT 17×T**
19146566-T-G 17034686-T-G **
19244606-C-A 17132726-C-A **
19248918-C-A 17137038-C-A **
19263494-C-A 17151614-C-A **
19280768-A-T 17168888-A-T **
19298846-T-C 17186966-T-C **
19304654-C-A 17192774-C-A **
19400007-T-A 17288127-T-A **
24634087-A-C 22487940-A-C P3_t2 **
19475139-C-A 17363259-C-A **
19475148-T-C 17363268-T-C **
19475162-G-T 17363282-G-T **
19482249-C-A 17370369-C-A **
19507153-T-G 17395273-T-G **
19517811-T-G 17405931-T-G **
19528407-A-C 17416527-A-C **
19531384-T-G 17419504-T-G **
19531510-G-A 17419630-G-A **
19547740-C-G 17435860-C-G **
19597189-T-TTTA 17485309-T-TTTA P5_Prx **
19677905-C-CACCA 17566025-C-CACCA P5_Prx **
19036824-G-C 16924944-G-C **
19012596-G-T 16900716-G-T **
18412377-A-T 16300497-A-T P6_Gap **
18890887-T-C 16779007-T-C **
18443468-G-C 16331588-G-C P6_Dst **
18454658-T-A 16342778-T-A P6_Dst **
18454697-T-A 16342817-T-A P6_Dst **
18454890-T-C 16343010-T-C P6_Dst **
18526499-C-T 16414619-C-T P6_Dst **
24634112-G-T 22487965-G-T P3_t2 **
18710379-C-A 16598499-C-A **
18789596-G-A 16677716-G-A **
18825653-T-C 16713773-T-C **
18848450-G-T 16736570-G-T **
18856243-T-G 16744363-T-G **
18875518-C-A 16763638-C-A **
18901112-C-A 16789232-C-A **
19012568-T-C 16900688-T-C **
24634102-A-C 22487955-A-C P3_t2 **
18948018-A-G 16836138-A-G **
18950681-A-T 16838801-A-T **
18959199-A-G 16847319-A-G **
18964043-T-A 16852163-T-A **
18964051-T-A 16852171-T-A **
18964077-G-A 16852197-G-A **
18965063-T-A 16853183-T-A **
18993388-T-C 16881508-T-C **
19000111-T-C 16888231-T-C **
19012494-G-T 16900614-G-T **
19012541-T-G 16900661-T-G **
13205340-G-C 11049664-G-C **
11010193-G-C **
13199318-C-A 11043642-C-A **
4805147-T-G 4937106-T-G **
4302576-T-C 4434535-T-C **
4302633-G-T 4434592-G-T **
4302641-T-C 4434600-T-C **
4356935-A-C 4488894-A-C **
4470484-C-A 4602443-C-A **
4539347-T-C 4671306-T-C **
4539391-C-A 4671350-C-A **
4540683-G-T 4672642-G-T **
4604270-C-A 4736229-C-A **
28560703-A-T 26414556-A-T **
4773567-C-A 4905526-C-A **
4840674-G-C 4972633-G-C **
4246901-C-A 4378860-C-A **
4902142-AT-A 5034101-AT-A **
4926396-A-T 5058355-A-T **
4951767-A-C 5083726-A-C **
4959950-C-A 5091909-C-A **
4959984-C-A 5091943-C-A **
4993786-A-ATG 5125745-A-ATG 10×TG**
5061097-T-G 5193056-T-G **
5061166-G-T 5193125-G-T **
5075789-C-A 5207748-C-A **
5116356-G-T 5248315-G-T **
5184244-A-C 5316203-A-C **
5210743-G-T 5342702-G-T **
4246912-C-T 4378871-C-T **
4246772-T-G 4378731-T-G **
5220492-A-C 5352451-A-C **
3887303-T-A 4019262-T-A **
3783137-G-T 3915096-G-T **
3783261-A-G 3915220-A-G **
3784022-G-T 3915981-G-T **
3791010-C-A 3922969-C-A **
3804408-C-A 3936367-C-A **
3813761-G-T 3945720-G-T **
3817021-T-A 3948980-T-A **
3834894-C-A 3966853-C-A **
3838120-G-T 3970079-G-T **
3849099-C-A 3981058-C-A **
3850054-C-A 3982013-C-A **
3875859-A-T 4007818-A-T **
3950403-G-T 4082362-G-T **
4230012-C-A 4361971-C-A **
3967643-A-T 4099602-A-T **
3967646-C-G 4099605-C-G **
3967668-G-T 4099627-G-T **
3967674-A-T 4099633-A-T **
3990498-T-C 4122457-T-C **
4073131-T-C 4205090-T-C **
4073250-C-A 4205209-C-A **
4073274-C-A 4205233-C-A **
4088443-T-A 4220402-T-A **
4101096-C-A 4233055-C-A **
4136977-A-T 4268936-A-T **
4201122-A-G 4333081-A-G **
5218562-C-T 5350521-C-T **
5228387-T-C 5360346-T-C **
3782967-C-T 3914926-C-T **
6440357-AT-A 6572316-AT-A 8×T**
6133192-C-A 6265151-C-A **
6179615-GA-G 6311574-GA-G IR3_Dst **
6182852-A-C 6314811-A-C IR3_Dst **
6191266-A-C 6323225-A-C IR3_Dst **
6199531-C-A 6331490-C-A IR3_Dst **
6310762-A-T 6442721-A-T IR3_Dst **
6310790-A-AG 6442749-A-AG IR3_Dst **
6335186-A-G 6467145-A-G IR3_Dst **
6335210-A-AG 6467169-A-AG IR3_Dst **
6354033-G-T 6485992-G-T **
6369278-C-T 6501237-C-T **
6437036-G-T 6568995-G-T **
6455914-G-T 6587873-G-T **
6094418-G-T 6226377-G-T **
6470019-T-C 6601978-T-C **
6475448-A-T 6607407-A-T **
6477426-C-G 6609385-C-G **
6514247-C-A 6646206-C-A **
6538655-A-G 6670614-A-G **
6538665-G-T 6670624-G-T **
6596125-A-T 6728084-A-T **
6646128-A-C 6778087-A-C **
6648641-AC-A 6780600-AC-A **
18283646-A-C 16171766-A-C P6_Prx **
6671224-C-A 6803183-C-A **
6709083-C-A 6841042-C-A **
6106080-A-C 6238039-A-C **
6062903-A-C 6194862-A-C **
5228389-T-TAG 5360348-T-TAG **
5426463-A-T 5558422-A-T **
5228412-A-T 5360371-A-T **
5228413-T-G 5360372-T-G **
5228431-G-C 5360390-G-C **
5228439-C-T 5360398-C-T **
5318394-T-C 5450353-T-C **
5320740-A-G 5452699-A-G **
5336098-G-A 5468057-G-A **
5375326-G-T 5507285-G-T **
5375343-A-C 5507302-A-C **
5375375-T-C 5507334-T-C **
5414187-T-C 5546146-T-C **
5420415-A-C 5552374-A-C **
5467044-A-G 5599003-A-G **
6047544-G-T 6179503-G-T **
5504976-T-A 5636935-T-A **
5504989-A-T 5636948-A-T **
5684526-C-A 5816485-C-A **
5687441-C-A 5819400-C-A **
5777476-CT-C 5909435-CT-C **
5794817-G-T 5926776-G-T **
5867549-C-A 5999508-C-A **
5888267-G-T 6020226-G-T **
5937282-ACC-A 6069241-ACC-A **
5967459-T-C 6099418-T-C **
6001652-G-T 6133611-G-T **
6040233-G-A 6172192-G-A **
3782980-G-T 3914939-G-T **
3726411-G-T 3858370-G-T **
13198077-A-G 11042401-A-G **
14284207-C-A 12163501-C-A **
13484084-T-G 11328408-T-G **
58981699-T-C 56835552-T-C **
19043480-G-GA 16931600-G-GA 10×A**
20478262-C-T 18316376-C-T P5_Dst **
7269922-C-A 7401881-C-A **
9944167-G-T 10106558-G-T **
16562755-C-A 14450875-C-A **
15873489-C-A 13761609-C-A **
11015005-TATTCC-T **
28496383-G-A 26350236-G-A **
10852791-C-T **
21677427-C-A 19515541-C-A **
28687320-A-G 26541173-A-G **
28496348-C-CAA 26350201-C-CAA 18×A**
23789508-C-A 21627622-C-A **
28624584-C-A 26478437-C-A **
28479141-C-A 26332994-C-A **
24264545-A-G 22118398-A-G P3_b1 **
26001413-CTTT-C 23855266-CTTT-C P1_Y1 18×T**
19732411-T-C 17620531-T-C BY36207 P5_Prx **
22739706-G-A 20577820-G-A **
26563899-A-T 24417752-A-T P1_g2 **
19246022-CCCTTT-C 17134142-CCCTTT-C **
18959204-G-A 16847324-G-A **
23807565-C-G 21645679-C-G **
19012539-G-C 16900659-G-C **
28745202-C-A 26599055-C-A **
22166658-C-A 20004772-C-A **
15565956-T-A 13454076-T-A **
18913861-CGATA-C 16801981-CGATA-C 6×GATA**
6913-A-T **
56858076-G-A **
22563004-C-A 20401118-C-A **
56847540-C-A **
10093217-G-T 10255608-G-T **
19882562-T-C 17770682-T-C Y16487 P5_Prx **
2738762-TC-T 2870721-TC-T **
5190004-G-A 5321963-G-A 16×A**
21552002-CAT-C 19390116-CAT-C **
16541138-C-A 14429258-C-A ****
18035697-A-G 15923817-A-G **
56847369-C-A **
28771506-C-T 26625359-C-T **
56835549-G-A **
26463145-G-T 24316998-G-T P1_Y1 **
24415718-TTATATATA-T 22269571-TTATATATA-T 31×TA**
23186074-C-A 21024188-C-A **
56830296-T-TCAATTCCTTA **
13728476-C-A 11572800-C-A **
56830219-A-T **
56830214-A-G **
9385117-T-C 9547508-T-C **
56830017-C-A **
56827622-G-T **
28808644-G-A 26662497-G-A **
56842333-C-T **
10658385-C-CTATA **
3726326-G-A 3858285-G-A **
3194192-CA-C 3326151-CA-C 11×A**
2852619-A-C 2984578-A-C **
2860146-G-C 2992105-G-C **
2970868-T-C 3102827-T-C **
2986690-C-A 3118649-C-A **
3022853-T-G 3154812-T-G **
3022894-G-T 3154853-G-T **
3022903-G-T 3154862-G-T **
3046482-A-C 3178441-A-C **
3069732-G-T 3201691-G-T **
3070785-C-A 3202744-C-A **
3078459-A-C 3210418-A-C **
3181583-C-A 3313542-C-A **
3271990-C-A 3403949-C-A **
2845714-C-A 2977673-C-A **
3275323-G-T 3407282-G-T **
3285129-A-C 3417088-A-C **
3305873-G-T 3437832-G-T **
3362270-A-T 3494229-A-T **
3371755-T-A 3503714-T-A **
3491589-G-A 3623548-G-A **
3544307-G-C 3676266-G-C **
3564426-C-A 3696385-C-A **
3620823-C-A 3752782-C-A **
3650190-C-A 3782149-C-A **
3688574-C-A 3820533-C-A **
3696582-G-A 3828541-G-A **
2845819-CTCAA-C 2977778-CTCAA-C **
2835737-C-A 2967696-C-A **
22335145-A-T 20173259-A-T DYZ19 **
10986828-A-G **
10801682-C-CTTTTG **
27417818-G-T 25271671-G-T P1_g3 **
3620819-G-A 3752778-G-A **
28624006-C-A 26477859-C-A **
10980868-C-A **
4357517-C-A 4489476-C-A **
13476117-C-A 11320441-C-A **
10792747-C-A **
11026085-C-T **
10986818-A-G **
10986823-A-G **
10986827-C-T **
10986837-C-T **
28591282-T-C 26445135-T-C **
19444230-C-A 17332350-C-A **
56830268-C-G **
10678871-C-T **
23137100-AT-A 20975214-AT-A **
18263855-TC-T 16151975-TC-T **
25333890-C-T 23187743-C-T FGC67138 P2_r1 **
21482787-G-T 19320901-G-T **
2701142-G-T 2833101-G-T **
2701143-T-A 2833102-T-A **
2759552-G-A 2891511-G-A **
2774683-G-C 2906642-G-C **
2786061-G-T 2918020-G-T **
6765703-G-C 6897662-G-C **
6765822-C-T 6897781-C-T **
6767767-T-C 6899726-T-C **
10839102-C-A **
10799487-C-G **
10799506-G-C **
10799523-G-C **
10799525-T-A **
10799530-T-C **
10799554-C-CAACTG **
10801665-T-C **
10801692-C-T **
10802654-T-A **
10803711-C-A **
10808201-A-C **
10845533-T-A **
10799467-G-T **
10845554-A-C **
10847502-C-A **
10850306-C-G **
10861053-C-A **
10865971-C-T **
10870599-A-C **
10872728-T-A **
10876951-T-A **
26563903-A-T 24417756-A-T P1_g2 **
10880646-T-C **
10887279-A-AT **
10887807-C-G **
10799468-A-G **
10799461-T-A **
10894815-G-C **
10746980-T-G **
10660925-A-G **
27417817-T-C 25271670-T-C P1_g3 **
10667211-T-C **
10668314-C-T **
10672591-T-C **
10678906-T-G **
10678944-T-A **
27232202-C-T 25086055-C-T P1_g3 **
26740664-A-C 24594517-A-C P1_g2 **
10687344-A-C **
10691456-C-T **
10746968-A-AACTATACTCT **
10748804-A-C **
10799452-C-T **
10759999-C-T **
10760006-A-T **
10760011-A-T **
10764554-C-A **
10764570-C-CAATCT **
10764572-T-TTTCAC **
10768969-A-C **
10769017-C-T **
26699218-A-C 24553071-A-C P1_g2 **
10774800-GT-G **
10774833-C-A **
10791547-C-A **
10887863-T-C **
10896447-T-TTA **
10652677-C-T FGC79865 **
11010190-A-G **
10984098-T-A **
10986810-A-ACTT **
10986821-C-A **
26328631-A-C 24182484-A-C P1_Y1 **
26225010-T-TC 24078863-T-TC P1_Y1 **
10994434-C-T **
11000290-G-C **
11003109-T-G **
11003163-T-G **
11009156-T-C **
11010182-C-G **
24341983-T-C 22195836-T-C P3_t1 **
10979579-A-T **
11010206-A-AG **
11010223-A-G **
11010249-C-A **
11010254-C-A **
11011435-C-A **
11015788-A-T **
11015790-T-A **
11026043-C-G **
26224362-T-C 24078215-T-C P1_Y1 **
26138253-A-T 23992106-A-T P1_Y1 **
11032071-C-A **
26138239-G-C 23992092-G-C P1_Y1 **
10983879-C-T **
10976194-C-A **
10896476-A-C **
10934769-T-A **
10899683-C-A **
10903456-G-T **
10903480-C-A **
10903497-C-A **
10903502-T-A **
10921750-G-T **
10927858-A-T **
10927866-C-T **
10927886-T-C **
26463136-C-T 24316989-C-T P1_Y1 **
10932890-C-A **
10932909-C-T **
10934770-C-A **
10969934-C-A **
10937525-C-A **
10939015-C-T **
10940407-A-C **
10949698-C-A **
10952421-T-A **
10952423-T-A **
26376498-T-C 24230351-T-C P1_Y1 **
26376492-T-C 24230345-T-C P1_Y1 **
10958376-T-A **
10958376-TTTCAC-T **
10958385-A-G **
10959083-C-A **
6773280-T-G 6905239-T-G **
10655839-G-T **
10093211-G-C 10255602-G-C **
7489231-C-A 7621190-C-A IR1_L **
7323028-C-A 7454987-C-A **
7335730-C-A 7467689-C-A **
7335733-C-A 7467692-C-A **
7362536-A-G 7494495-A-G **
7385607-A-G 7517566-A-G **
7387423-C-T 7519382-C-T **
7397719-A-G 7529678-A-G **
7423854-A-T 7555813-A-T **
7424319-A-C 7556278-A-C **
7424337-A-T 7556296-A-T **
7477124-G-C 7609083-G-C IR1_L **
7534426-G-GT 7666385-G-GT **
7277632-A-C 7409591-A-C **
7536513-G-T 7668472-G-T **
7608410-A-T 7740369-A-T **
7615407-T-G 7747366-T-G **
7645438-G-A 7777397-G-A **
7708794-G-C 7840753-G-C **
7896500-A-G 8028459-A-G **
7994331-C-A 8126290-C-A **
8044695-C-A 8176654-C-A **
8073948-T-G 8205907-T-G **
8073999-C-A 8205958-C-A **
8077445-C-A 8209404-C-A **
8078395-G-T 8210354-G-T **
7311825-G-T 7443784-G-T **
7250478-G-T 7382437-G-T **
10093207-T-A 10255598-T-A **
7108892-C-A 7240851-C-A **
28560695-A-T 26414548-A-T **
6901237-C-A 7033196-C-A **
6901243-A-T 7033202-A-T **
6901245-A-T 7033204-A-T **
6915967-AT-A 7047926-AT-A **
6920739-A-G 7052698-A-G **
6929491-C-A 7061450-C-A **
7000208-G-T 7132167-G-T **
7028591-A-G 7160550-A-G **
7043130-C-A 7175089-C-A **
7048055-C-A 7180014-C-A **
7108593-C-A 7240552-C-A **
7115506-C-A 7247465-C-A **
7237270-A-T 7369229-A-T **
7140360-T-C 7272319-T-C **
7140875-G-A 7272834-G-A **
7148839-A-T 7280798-A-T **
7148856-C-A 7280815-C-A **
28505251-A-G 26359104-A-G **
7164063-A-T 7296022-A-T **
7164091-A-T 7296050-A-T **
7183011-C-A 7314970-C-A **
7183040-T-G 7314999-T-G **
7202148-G-C 7334107-G-C **
7217354-C-A 7349313-C-A **
7218103-C-T 7350062-C-T **
8079578-C-A 8211537-C-A **
24341982-C-A 22195835-C-A P3_t1 **
8481876-T-A 8613835-T-A **
10012856-C-A 10175247-C-A **
9591040-A-AC 9753431-A-AC IR3_Prx **
9592611-G-T 9755002-G-T IR3_Prx **
9602672-T-G 9765063-T-G IR3_Prx **
9911639-C-A 10074030-C-A **
9932696-G-C 10095087-G-C **
9943446-G-T 10105837-G-T **
9943449-C-T 10105840-C-T **
9943471-A-G 10105862-A-G **
9944810-A-C 10107201-A-C **
9985973-C-A 10148364-C-A **
27808703-C-A 25662556-C-A P1_Y2 **
10009499-C-A 10171890-C-A **
10018039-G-C 10180430-G-C **
9574854-A-AC 9737245-A-AC IR3_Prx **
10018087-A-T 10180478-A-T **
10042109-G-T 10204500-G-T **
10093084-G-A 10255475-G-A **
10093111-A-T 10255502-A-T **
10093143-G-T 10255534-G-T **
10093159-C-G 10255550-C-G **
10093160-G-T 10255551-G-T **
10093163-C-A 10255554-C-A **
10093185-A-ATAT 10255576-A-ATAT **
10093190-AAAAGAT-A 10255581-AAAAGAT-A **
10093200-T-TGTC 10255591-T-TGTC **
10093206-T-G 10255597-T-G **
28479209-C-A 26333062-C-A **
9591035-A-ACAC 9753426-A-ACAC IR3_Prx **
9499525-G-T 9661916-G-T **
8977005-G-A 9139396-G-A **
8807126-A-T 8939085-A-T **
8807148-C-A 8939107-C-A **
8816382-C-A 8948341-C-A **
8852185-G-A 8984144-G-A F17547 **
8852545-T-C 8984504-T-C **
8907577-G-C 9039536-G-C **
9056795-T-G **
9056831-T-G **
9056875-G-CTC **
8977004-T-C 9139395-T-C **
9499236-G-T 9661627-G-T **
8725221-A-C 8857180-A-C **
8731343-C-T 8863302-C-T **
8977009-C-T 9139400-C-T **
8988084-T-A 9150475-T-A **
9079786-G-A 9242177-G-A **
9082129-C-A 9244520-C-A **
9153541-G-C 9315932-G-C **
9319198-T-C 9481589-T-C **
9319214-G-C 9481605-G-C **
28416563-G-T 26270416-G-T P1_gr2 **
9363451-G-T 9525842-G-T **
9414217-T-A 9576608-T-A **
9441530-C-A 9603921-C-A **
9492137-G-C 9654528-G-C **
8807096-T-C 8939055-T-C **
56844352-G-T ***
56830891-C-A ***
26345941-T-C 24199794-T-C P1_Y1 ***
25727946-G-T 23581799-G-T P1_b3 14×AT***
13465100-G-A 11309424-G-A ***
21946452-C-A 19784566-C-A ***
19204063-C-A 17092183-C-A ***
10932784-C-G ***
10878312-T-A,C ***
10770010-C-A ***
10682566-C-G ***
10682554-T-A ***
10662199-C-A ***
9995921-C-A 10158312-C-A ***
8631425-G-A 8763384-G-A ***
8631410-G-T 8763369-G-T ***
7163278-C-A 7295237-C-A ***
6803822-C-A 6935781-C-A ***
4769621-C-A 4901580-C-A ***
2810389-TG-T,TT 2942348-TG-T,TT ***
13228501-CTTT-C,CTT 19×T***
25096843-T-A 22950696-T-A g1 ***
10958320-A-C ***
13869544-T-A 11748838-T-A ***
24323450-T-C 22177303-T-C BY13993 P3_t1 ***
25263007-G-C 23116860-G-C P2_r1 ***
13447315-TCCACTCCACTCCACT-T,TCCACTCCATTCCACTTCACG 11291639-TCCACTCCACTCCACT-T,TCCACTCCATTCCACTTCACG ***
13453073-C-G 11297397-C-G ***
58985626-G-A 56839479-G-A ***
13803193-G-C 11682487-G-C ***
19261128-CTTTTTTT-C 17149248-CTTTTTTT-C 21×T***
24916157-G-A 22770010-G-A g1 ***
9241116-T-A 9403507-T-A ***
9241118-C-G 9403509-C-G ***
22254697-T-A 20092811-T-A DYZ19 ***
22288590-C-A 20126704-C-A DYZ19 ***
22580054-A-T 20418168-A-T ***
24121104-C-T 21974957-C-T P3_b1 ***
10958311-C-A ***
10987833-C-CGG ***
21874726-A-G 19712840-A-G ***
18261935-A-T 16150055-A-T ***
14283208-C-A 12162502-C-A ***
14916890-C-CAA 12804957-C-CAA 15×A***
13208770-GGAAGAAGAAGAAGAA-G,GGAAGAA 22×GAA***
15479982-G-T 13368102-G-T ***
16275815-G-T 14163935-G-T ***
18261934-T-A 16150054-T-A ***
13468958-C-T 11313282-C-T ***
13870906-A-G 11750200-A-G ***
18578127-G-A 16466247-G-A ***
18925052-C-A 16813172-C-A ***
19031641-C-A 16919761-C-A A12804 ***
21162280-C-A 19000394-C-A ***
21162680-C-A 19000794-C-A ***
21504024-G-T 19342138-G-T ***
13885861-T-TC,TCTTTT 11765155-T-TC,TCTTTT ***
13801098-C-A 11680392-C-A ***
10991283-T-C ***
13453195-A-T 11297519-A-T ***
10992908-C-A ***
11031820-C-A ***
11031866-C-A ***
13194035-C-A 11038359-C-A ***
13226656-C-A 11070980-C-A ***
13450610-ATTCCA-A,ATTCTT 11294934-ATTCCA-A,ATTCTT ***
13457731-C-CA 11302055-C-CA ***
11666481-C-A ***
13483970-A-T 11328294-A-T ***
13471935-G-T 11316259-G-T ***
13478230-C-A 11322554-C-A ***
13478237-C-G 11322561-C-G ***
13479617-T-C 11323941-T-C ***
13479618-G-A 11323942-G-A ***
30175-G-T ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 4734351067210277144067794709
Kit: 473435964297178540767747617
Used in age calculations1067210278540767794709
Counts of SNPs2116
Variant counts last updated 2019-09-10 00:14:02.



Big Tree Main Page