Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > DF21/S192 > FGC3213 > ZZ1 > S3058 > S424 > S426 > S190 > FGC3215 > Z36747 > Y16487 > Y16486 > Y16490

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
544226
FB38
544226-A
BigY2
544226
20397177-G-T 18235291-G-T P5_Dst ***A*
20931291-G-T 18769405-G-T P4_Dst ***A*
20419180-G-T 18257294-G-T P5_Dst A*
20430560-C-A 18268674-C-A P5_Dst A*
20474913-G-T 18313027-G-T P5_Dst A*
20566846-C-A 18404960-C-A P5_Dst ***A*
20751028-C-A 18589142-C-A P4_Prx A*
20920171-C-A 18758285-C-A P4_Dst A*
20938825-A-G 18776939-A-G P4_Dst ***A*
20076483-C-A 17964603-C-A P5_Dst A*
20985501-A-G 18823615-A-G P4_Dst A*
21007825-G-T 18845939-G-T P4_Dst Y***A*
33254-G-A A*
20384647-T-G 18222761-T-G P5_Dst A*
18447595-C-T 16335715-C-T P6_Dst A*
18447603-C-T 16335723-C-T P6_Dst A*
26241148-T-C 24095001-T-C P1_Y1 ****A*
20104262-A-G 17992382-A-G P5_Dst A*
20973371-A-G 18811485-A-G P4_Dst A*
19965388-T-C 17853508-T-C P5_Prx A*
16111915-G-T 14000035-G-T P8_Prx A*
19770346-G-A 17658466-G-A P5_Prx *A*
19923657-C-A 17811777-C-A P5_Prx A*
19682348-T-A 17570468-T-A P5_Prx A*
20692862-A-AT 18530976-A-AT P4_Prx 12×TA*
20522399-T-TAC 18360513-T-TAC P5_Dst ***A*
19811648-T-A 17699768-T-A P5_Prx A*
16108070-G-T 13996190-G-T P8_Prx A*
13719273-T-C 11563597-T-C A*
16114266-G-T 14002386-G-T P8_Prx ***A*
19590609-G-T 17478729-G-T P5_Prx Y***A*
19846587-G-T 17734707-G-T P5_Prx A*
19753401-A-C 17641521-A-C P5_Prx A*
19735738-C-T 17623858-C-T P5_Prx A*
18502569-G-T 16390689-G-T P6_Dst ***A*
18466857-G-T 16354977-G-T P6_Dst A*
18438435-T-C 16326555-T-C P6_Dst A*
19011154-G-T 16899274-G-T Y103366 YY+++
27039254-C-G 24893107-C-G P1_r4 +
19031765-A-G 16919885-A-G Y103414 YY+++
22235145-AAAAT-GAAAC,GAAAT 20073259-AAAAT-GAAAC,GAAAT DYZ19 *
13450590-GCTCCATTCCATTCCATTCCATTCC-ACTCCATTCCATTCCATTCT 11294914-GCTCCATTCCATTCCATTCCATTCC-ACTCCATTCCATTCCATTCT *
22268692-G-A 20106806-G-A DYZ19 *****
22247493-TTA-GTC 20085607-TTA-GTC DYZ19 *
13448641-TT-C 11292965-TT-C *
13869280-GAATGGAATGGCATTGAAT-AAAAGGAGTGGCATCAAAC 11748574-GAATGGAATGGCATTGAAT-AAAAGGAGTGGCATCAAAC *
13489557-TTG-GTG,GTT 11333881-TTG-GTG,GTT *
13448351-ACTC-GCTT 11292675-ACTC-GCTT *
13450521-CTTCACTCCAC-ATCCATCCCAT,TCCCAT 11294845-CTTCACTCCAC-ATCCATCCCAT,TCCCAT *
13449752-TCAACCCCATTCTATTC-GAAACCCCATTCCATTG,TTCATTCAATTC 11294076-TCAACCCCATTCTATTC-GAAACCCCATTCCATTG,TTCATTCAATTC *
13449323-TCCT-ACCC 11293647-TCCT-ACCC *
22237644-AGG-GGA 20075758-AGG-GGA DYZ19 *
13452369-TTCCATTCCATTCCATTCCATTCCAT-G 11296693-TTCCATTCCATTCCATTCCATTCCAT-G *
13452125-TTCCACTG-CTCTACTC 11296449-TTCCACTG-CTCTACTC *
22451252-TGA-CAT 20289366-TGA-CAT DYZ19 *
56830657-TTCCACTG-CTCCACTG,CTCCCCTT *
13490194-GCAA-TCAG 11334518-GCAA-TCAG *
13470444-TCTGCGT-CCTGCTG 11314768-TCTGCGT-CCTGCTG *
22289475-AC-TG 20127589-AC-TG DYZ19 *
22293412-CCTTA-GCTCA,GCTCG 20131526-CCTTA-GCTCA,GCTCG DYZ19 *
13489619-ACCCCCACCACCACCCA-CGTCCTCACCCACACCAC,CGTCCTCACCCTCACCAC 11333943-ACCCCCACCACCACCCA-CGTCCTCACCCACACCAC,CGTCCTCACCCTCACCAC *
13489696-CGTGCCC-TGGGCCG 11334020-CGTGCCC-TGGGCCG *
22503611-T-C 20341725-T-C DYZ19 *
56831466-CTCCTC-CTCCAC,TTCCAT *
56831409-TG-CGTTTCA,TGTTCCA *
24035198-TA-T,TAA 21889051-TA-T,TAA 14×A*
22431994-CCC-TCA 20270108-CCC-TCA DYZ19 *
56830999-C-CTCCAT,T *
56831762-TGG-CCA,CTG *
22503586-A-C 20341700-A-C DYZ19 *
56831877-GCATTCCA-ACATCCT,CCATTCCA 4×CATTC*
56829392-TTCCATTCGATTCCAT-G,TTCCATTTGATTCCAT *
56834399-TCTCCAC-ATTCCAT *
56834455-TTCCATTCCCTTCCATTA-CTCCATTCCATTCCCTTCCATTA,CTCCATTCCATTCCCTTCCCTTC *
56831592-ATTG-ATTC,TTTG *
22352486-AGAGTTTTTTCCTTT-AGAGTTTGTTCCTTC,TGAGTTTTTTTCCTTC 20190600-AGAGTTTTTTCCTTT-AGAGTTTGTTCCTTC,TGAGTTTTTTTCCTTC DYZ19 *
22444290-TGTGTC-AGTGGT 20282404-TGTGTC-AGTGGT DYZ19 *
25240239-CTTT-C,CT 23094092-CTTT-C,CT P2_r1 22×T*
25298822-T-C 23152675-T-C P2_r1 *
27045350-G-T 24899203-G-T P1_r4 **
26563869-GTTTGCTCTT-TTTTTCTC 24417722-GTTTGCTCTT-TTTTTCTC P1_g2 **
22493699-TT-GG 20331813-TT-GG DYZ19 **
22493834-CCT-GCA 20331948-CCT-GCA DYZ19 **
25429198-CTT-C 23283051-CTT-C P2_r2 13×T**
25672328-CG-C 23526181-CG-C P1_b3 **
25706148-C-CA 23560001-C-CA P1_b3 16×A**
25919930-G-T 23773783-G-T P1_Y1 **
56707082-A-T **
27045374-G-T 24899227-G-T P1_r4 **
28428164-G-A 26282017-G-A P1_gr2 8×A**
28113221-C-A 25967074-C-A P1_Y2 **
27950909-GA-G 25804762-GA-G P1_Y2 10×A**
27904476-CTT-C 25758329-CTT-C P1_Y2 11×T**
27874549-TAGAT-GAGA 25728402-TAGAT-GAGA P1_Y2 **
27844040-C-T 25697893-C-T P1_Y2 **
26616999-C-A 24470852-C-A P1_g2 **
27508834-A-T 25362687-A-T P1_Y2 **
27370312-T-A 25224165-T-A P1_g3 **
27359571-G-T 25213424-G-T P1_g3 **
27236555-G-T 25090408-G-T P1_g3 **
27732463-TTTTTC-T 25586316-TTTTTC-T P1_Y2 **
22337296-G-C 20175410-G-C DYZ19 **
11024664-TTTC-ATTT **
23096592-A-G 20934706-A-G ****
16868744-T-A 14756864-T-A ****
17367795-C-T 15255915-C-T *****
18185137-T-C 16073257-T-C ****
18188316-A-G 16076436-A-G ****
18271079-C-A 16159199-C-A **
18593524-C-A 16481644-C-A *****
18623463-G-T 16511583-G-T ****
19388394-C-A 17276514-C-A **
19463447-T-A 17351567-T-A *****
56844566-TACTCTTG-AACTTC **
20842592-C-A 18680706-C-A P4_Dst **
21225195-C-A 19063309-C-A **
21771376-G-GT 19609490-G-GT 9×T**
22309941-A-C 20148055-A-C DYZ19 **
23127029-C-A 20965143-C-A ****
22493075-T-G 20331189-T-G DYZ19 **
23262731-G-C 21100845-G-C *****
23339107-C-A 21177221-C-A ****
23569569-G-T 21407683-G-T ****
24295367-AC-A 22149220-AC-A P3_t1 **
25733058-A-T 23586911-A-T P1_b3 **
27527086-A-G 25380939-A-G P1_Y2 **
28558495-C-T 26412348-C-T *****
56871043-C-A **
10892540-T-C **
10892534-A-T **
24663415-A-G 22517268-A-G P3_b2 **
24663420-TCTA-T 22517273-TCTA-T P3_b2 **
24663450-T-C 22517303-T-C P3_b2 **
7387396-A-TT 7519355-A-TT 22×T**
24663457-T-C 22517310-T-C P3_b2 **
24670171-TGTTAG-T 22524024-TGTTAG-T P3_b2 **
26927860-C-G 24781713-C-G P1_r3 **
20480368-GGATTTTA-G 18318482-GGATTTTA-G P5_Dst **
18109387-A-G 15997507-A-G **
18373392-G-T 16261512-G-T P6_Prx **
22496933-T-C 20335047-T-C DYZ19 **
18455265-A-G 16343385-A-G P6_Dst **
18487151-G-T 16375271-G-T P6_Dst **
18521463-G-T 16409583-G-T P6_Dst **
20103976-C-G 17992096-C-G P5_Dst **
20217960-T-AA 18056074-T-AA P5_Dst 13×A**
20256671-T-A 18094785-T-A P5_Dst **
20275017-G-T 18113131-G-T P5_Dst **
20280032-T-C 18118146-T-C P5_Dst **
20391474-G-T 18229588-G-T P5_Dst **
20425364-G-T 18263478-G-T P5_Dst **
20431437-C-A 18269551-C-A P5_Dst **
20557333-C-A 18395447-C-A P5_Dst **
16164869-C-A 14052989-C-A P8_Dst **
22235076-T-C 20073190-T-C DYZ19 **
22297312-C-A 20135426-C-A DYZ19 **
22492891-T-A 20331005-T-A DYZ19 **
22492896-C-G 20331010-C-G DYZ19 **
22493509-TCG-ACA 20331623-TCG-ACA DYZ19 **
22496911-C-G 20335025-C-G DYZ19 **
22235085-CCATACAA-ACACTCAG 20073199-CCATACAA-ACACTCAG DYZ19 **
22496919-CTTAA-TTTAC 20335033-CTTAA-TTTAC DYZ19 **
20579107-G-T 18417221-G-T P5_Dst **
21535757-A-T 19373871-A-T **
21006259-C-A 18844373-C-A P4_Dst **
20996797-G-T 18834911-G-T P4_Dst **
20991023-A-G 18829137-A-G P4_Dst **
20949658-A-T 18787772-A-T P4_Dst **
20775131-GAAA-G 18613245-GAAA-G P4_Prx 21×A**
17278250-AGAAAGGAAGAAAGGAAGAAGAACGAAAGAAA-GAAAGGAAGAAAGGAAGAAGAAC 15166370-AGAAAGGAAGAAAGGAAGAAGAACGAAAGAAA-GAAAGGAAGAAAGGAAGAAGAAC **
16143321-G-T 14031441-G-T P8_Dst **
24869262-A-G 22723115-A-G IR1_R **
10693744-AATTCCT-CA **
22297317-C-A 20135431-C-A DYZ19 **
24663390-CAATATA-GAATCTG 22517243-CAATATA-GAATCTG P3_b2 **
24599105-G-T 22452958-G-T P3_t2 **
24539905-T-C 22393758-T-C P3_t2 **
21780406-GAA-G **
4223933-A-G 4355892-A-G **
6219256-G-T 6351215-G-T IR3_Dst **
6403221-CGGTA-TGGTG 6535180-CGGTA-TGGTG **
10672010-ATTAC-TTTCT **
10678062-G-CATTCCATTCCATTCC **
10683305-CA-AT **
10683331-CGAC-TGAA **
10689009-ATTC-TCTCAAAAT **
10692318-ATTAC-TTTCT **
10799565-TATTTCATTCCTC-CAT **
15876360-C-AA 13764480-C-AA 21×A**
13297454-T-G 11141778-T-G **
14926418-G-T 12814483-G-T **
15922340-G-T 13810460-G-T *****
24012886-C-A 21866739-C-A **
24021166-C-A 21875019-C-A **
24099584-ATTGT-TTTG 21953437-ATTGT-TTTG P3_b1 **
24374517-G-A 22228370-G-A **
11020108-GTCT-TTCC **
10799586-AC-TT **
10976461-T-C **
10973966-CC-TCA **
10973945-CTC-TT **
10866366-CC-GA **
10851083-TCT-GCC **
10833356-C-A **
16065763-C-T 13953883-C-T ****
56884424-TTTAT-A **
15599322-A-G 13487442-A-G ****
10793290-C-A ****
7407281-T-C 7539240-T-C *****
8080399-G-T 8212358-G-T FT57547 ****
8697984-GA-G 8829943-GA-G ****
8719028-C-A 8850987-C-A *****
9674762-C-A 9837153-C-A IR3_Prx ****
10656905-C-A ****
10667574-C-A ****
22504562-A-C 20342676-A-C DYZ19 **
58982012-GTGCCAC-ATGTCAA 56835865-GTGCCAC-ATGTCAA **
10685351-C-A ****
10690975-T-C *****
10763201-C-A **
10770153-C-T **
10780782-G-T **
10801662-C-CACTCTTGTTG **
6354249-G-A 6486208-G-A **
10822366-C-A *****
10823519-T-C **
10840088-C-A ****
10841419-C-T ****
10912404-C-A *****
10912554-C-A *****
10924283-A-G *****
10929547-C-A **
8218167-CTT-C 8350126-CTT-C **
10975859-TC-T **
10975890-C-A **
10975891-C-T **
10975909-G-A **
10975917-T-A **
16150948-TAA-T 14039068-TAA-T P8_Dst 22×A**
6177447-G-T 6309406-G-T IR3_Dst **
10975956-G-C **
10760089-C-A ****
8673863-C-A 8805822-C-A *****
9991275-G-A 10153666-G-A **
14324894-CTTTT-C 12204188-CTTTT-C 26×T**
10630675-A-G **
13474535-T-C 11318859-T-C **
10975875-C-T **
16245943-G-T 14134063-G-T **
10668575-AATTTC-A **
7160930-G-T 7292889-G-T **
15491882-C-T 13380002-C-T **
10761139-A-T **
10761152-C-T **
10761162-C-G **
19339982-CTTTC-TTTTT 17228102-CTTTC-TTTTT **
22434884-C-A 20272998-C-A DYZ19 **
5767416-G-T 5899375-G-T ****
3549525-A-G 3681484-A-G **
5711649-C-A 5843608-C-A ****
4181581-G-T 4313540-G-T ****
4131463-G-T 4263422-G-T ****
3963575-C-A 4095534-C-A ****
3659126-G-T 3791085-G-T ****
3575371-C-A 3707330-C-A ****
19537941-G-A 17426061-G-A **
22297294-C-T 20135408-C-T DYZ19 **
7436374-C-A 7568333-C-A ****
3271535-C-A 3403494-C-A **
10945055-G-T **
20949941-TTGATG-CTGACA 18788055-TTGATG-CTGACA P4_Dst **
19319836-A-G 17207956-A-G A2101 *****
14590549-C-A 12478749-C-A **
10975937-C-CG **
10762185-C-A ****
13474540-C-A 11318864-C-A **
24658480-CT-C 22512333-CT-C P3_b2 14×T**
14794553-C-T 12682624-C-T ****
10992369-C-A **
13472205-GA-CC 11316529-GA-CC **
20230740-A-G 18068854-A-G P5_Dst **
14685959-A-G 12574025-A-G **
10999749-C-A ****
20230742-T-C 18068856-T-C P5_Dst **
11030582-C-A ****
13946127-C-T 11825421-C-T *****
20229254-GT-G 18067368-GT-G P5_Dst 15×T**
10992360-C-G **
20949965-G-C 18788079-G-C P4_Dst **
13946018-G-T 11825312-G-T ****
13474536-G-A 11318860-G-A **
13809386-C-T 11688680-C-T FT248760 **
11675576-G-A ****
13597121-G-T 11441445-G-T *****
20949930-CATT-C 18788044-CATT-C P4_Dst **
13592038-C-A 11436362-C-A *****
13592028-T-C 11436352-T-C **
13855429-C-A 11734723-C-A **
14011905-C-A 11891199-C-A **
10989564-C-A ****
10980903-T-A **
10975959-T-A **
10975961-G-C **
10987740-A-G **
15338735-C-A 13226853-C-A *****
24597623-C-T 22451476-C-T P3_t2 ***
22236610-A-G 20074724-A-G DYZ19 ***
24590090-G-T 22443943-G-T P3_t2 ***
24583569-AAAAAC-A 22437422-AAAAAC-A P3_t2 4×AAAAC***
24583518-G-T 22437371-G-T P3_t2 ***
13453418-T-A 11297742-T-A ***
56826847-GATTCCATTCCATTCAATTCC-CTTTCCATTCCATTCGATTAG ***
26318196-GT-G 24172049-GT-G P1_Y1 12×T***
24207711-T-G 22061564-T-G P3_b1 ***
22256240-CA-AT 20094354-CA-AT DYZ19 ***
58975998-CACG-TGTT 56829851-CACG-TGTT ***
25356955-TA-T 23210808-TA-T P2_r2 10×A***
22504188-G-A 20342302-G-A DYZ19 ***
22421241-TATG-GATA 20259355-TATG-GATA DYZ19 ***
13724137-C-G 11568461-C-G ***
22236381-A-G 20074495-A-G DYZ19 ***
56861817-AAAAAAAAAAAAAA-CAAACAAACAAACAAAA,CAAACAAACAAACAAAC ***
24619962-T-C 22473815-T-C P3_t2 ***
22235133-AGC-TG,TGC 20073247-AGC-TG,TGC DYZ19 ***
19586695-ATT-A 17474815-ATT-A P5_Prx 22×T***
24650064-C-A 22503917-C-A P3_b2 ***
28235510-C-A 26089363-C-A P1_b4 ***
24728547-G-T 22582400-G-T P3_b2 ***
28091035-A-T 25944888-A-T P1_Y2 ***
10012176-C-T 10174567-C-T ***
19498842-CA-C 17386962-CA-C 10×A***
24677506-TA-T 22531359-TA-T P3_b2 ***
24682836-AGTGTGTGTGTCAG-A 22536689-AGTGTGTGTGTCAG-A P3_b2 ***
24602901-G-T 22456754-G-T P3_t2 ***
18471858-TAC-T 16359978-TAC-T P6_Dst 12×AC***
56831390-ATTC-GTTCCACTCCATTT ***
13810176-ATGG-A 11689470-ATGG-A ***
25466146-GA-G 23319999-GA-G P2_r2 12×A***
56833163-TTGCACTCCAC-CTGCAA,CTGCAC ***
56833090-ATATTTCAC-CTATTTCAC,CTATTTCAT ***
13474515-G-A 11318839-G-A ***
56834581-TCCAT-CCTATTCCAA ***
56833005-AAG-AAA,GAA ***
56832332-GTC-ATG ***
56837046-CG-CA,TA ***
22333461-G-C 20171575-G-C DYZ19 ***
22444316-AGT-GGA 20282430-AGT-GGA DYZ19 ***
22457251-TT-AA,TA 20295365-TT-AA,TA DYZ19 ***
22329473-G-C 20167587-G-C DYZ19 ***
13447101-ACTTTC-CCTTTG 11291425-ACTTTC-CCTTTG ***
27243779-TTTTG-T 25097632-TTTTG-T P1_g3 ***
22493820-TAA-CAT 20331934-TAA-CAT DYZ19 ***
24028684-A-T 21882537-A-T ***
13867191-A-T 11746485-A-T ***
22236372-A-T 20074486-A-T DYZ19 ***
24758749-T-A 22612602-T-A P3_b2 ***
17489359-G-GA 15377479-G-GA 9×A******
22498855-TT-CG 20336969-TT-CG DYZ19 ***
22501003-C-A 20339117-C-A DYZ19 ***
22503332-CCAGAT-CCAGAG,GCTGAG 20341446-CCAGAT-CCAGAG,GCTGAG DYZ19 ***
27801225-G-GA 25655078-G-GA P1_Y2 13×A***
22503618-T-A 20341732-T-A DYZ19 ***
21772302-CT-C ***
2809578-G-T 2941537-G-T ***
21773127-C-A ***
24027307-G-GA 21881160-G-GA 12×A***
14168640-TAA-T,TAAA 12047934-TAA-T,TAAA 12×A***
24756614-G-T 22610467-G-T P3_b2 ***
27552524-G-T 25406377-G-T P1_Y2 ***
24775820-A-T 22629673-A-T P3_b2 ***
27215098-A-G 25068951-A-G P1_g3 ***
27300803-G-T 25154656-G-T P1_g3 ***
27847886-C-A 25701739-C-A P1_Y2 ***
27237633-G-T 25091486-G-T P1_g3 ***
22368407-T-A 20206521-T-A DYZ19 ***
27228784-G-T 25082637-G-T P1_g3 ***
27227856-G-T 25081709-G-T P1_g3 ***
27218010-A-T 25071863-A-T P1_g3 ***
27214424-G-T 25068277-G-T P1_g3 ***
27301924-C-A 25155777-C-A P1_g3 ***
27205714-G-T 25059567-G-T P1_g3 ***
27197659-C-A 25051512-C-A P1_g3 ***
27197414-G-T 25051267-G-T P1_g3 ***
27177509-G-T 25031362-G-T P1_g3 ***
27171500-G-T 25025353-G-T P1_g3 ***
27166764-C-A 25020617-C-A P1_g3 ***
27161272-C-A 25015125-C-A P1_g3 ***
27301885-T-C 25155738-T-C P1_g3 ***
27305167-C-A 25159020-C-A P1_g3 ***
27133022-G-T 24986875-G-T P1_g3 ***
28796096-G-T 26649949-G-T ***
27467745-G-T 25321598-G-T P1_Y2 ***
27420703-A-AT 25274556-A-AT P1_g3 9×T***
27380389-G-T 25234242-G-T P1_g3 ***
27377934-G-T 25231787-G-T P1_g3 ***
27719223-G-T 25573076-G-T P1_Y2 ***
27376544-C-A 25230397-C-A P1_g3 ***
27371653-G-T 25225506-G-T P1_g3 ***
26538252-C-CA 24392105-C-CA P1_g2 17×A***
27831266-G-T 25685119-G-T P1_Y2 ***
27741574-G-T 25595427-G-T P1_Y2 ***
27766951-G-T 25620804-G-T P1_Y2 ***
27795395-TACACACACAG-T 25649248-TACACACACAG-T P1_Y2 ***
27369948-G-T 25223801-G-T P1_g3 ***
27797311-G-A 25651164-G-A P1_Y2 ***
27354160-G-T 25208013-G-T P1_g3 ***
27346416-T-C 25200269-T-C P1_g3 ***
27807369-C-T 25661222-C-T P1_Y2 ***
27145977-G-T 24999830-G-T P1_g3 ***
25718213-G-GT 23572066-G-GT P1_b3 13×T***
28077445-G-T 25931298-G-T P1_Y2 ***
25230605-C-A 23084458-C-A P2_r1 ***
25461433-CTTTT-C,CTTT 23315286-CTTTT-C,CTTT P2_r2 26×T***
20428140-AT-A 18266254-AT-A P5_Dst 17×T***
25412099-G-T 23265952-G-T P2_r2 ***
25370417-A-T 23224270-A-T P2_r2 ***
22488767-G-C 20326881-G-C DYZ19 ***
25245715-C-A 23099568-C-A P2_r1 ***
22352479-T-C 20190593-T-C DYZ19 ***
24938133-T-C 22791986-T-C g1 ***
25659530-G-T 23513383-G-T P1_b3 ***
21457482-G-T 19295596-G-T ***
24853341-C-A 22707194-C-A IR1_R ***
6776606-AAC-A 6908565-AAC-A 9×AC***
27980710-G-T 25834563-G-T P1_Y2 ***
28023709-G-T 25877562-G-T P1_Y2 ***
28029767-G-T 25883620-G-T P1_Y2 ***
24777709-G-T 22631562-G-T P3_b2 ***
25467726-T-C 23321579-T-C P2_r2 ***
25661593-T-C 23515446-T-C P1_b3 ***
27877263-C-A 25731116-C-A P1_Y2 ***
13866779-AG-CA 11746073-AG-CA ***
13474491-G-A 11318815-G-A ***
20134533-T-TA 18022653-T-TA P5_Dst 11×A***
27129771-CAAA-C 24983624-CAAA-C P1_g3 25×A***
27915825-G-T 25769678-G-T P1_Y2 ***
22368421-G-A 20206535-G-A DYZ19 ***
27937989-TTTTTTA-T 25791842-TTTTTTA-T P1_Y2 ***
27005052-T-A 24858905-T-A P1_r4 ***
26296805-AT-A 24150658-AT-A P1_Y1 10×T***
25665349-G-T 23519202-G-T P1_b3 ***
26277717-GTA-TTT 24131570-GTA-TTT P1_Y1 ***
26190682-TAAG-AAAA 24044535-TAAG-AAAA P1_Y1 ***
26113193-G-A 23967046-G-A P1_Y1 ***
14642445-G-T 12530514-G-T ***
27953797-G-T 25807650-G-T P1_Y2 ***
27978996-G-T 25832849-G-T P1_Y2 ***
18457134-A-C 16345254-A-C P6_Dst ***
23267058-G-T 21105172-G-T ***
24792127-G-T 22645980-G-T P3_b2 ***
10028483-C-A 10190874-C-A ***
22229588-ACG-CCC,CCG 20067702-ACG-CCC,CCG DYZ19 ***
18191209-C-A 16079329-C-A ***
10924524-C-A ******
16058659-C-A 13946779-C-A ***
6354150-AT-A 6486109-AT-A ***
14286784-CTTTT-C,CTTT 12166078-CTTTT-C,CTTT 22×T***
14697194-C-A 12585260-C-A ***
6663252-C-A 6795211-C-A ***
14557862-C-A 12446063-C-A ***
9564547-ATG-A 9726938-ATG-A IR3_Prx ***
10825484-C-G ******
15580026-C-A 13468146-C-A ***
18614211-C-A 16502331-C-A ***
2772738-C-A 2904697-C-A ***
17951299-ATTTTTTTTT-A,ATTTT 15839419-ATTTTTTTTT-A,ATTTT 25×T***
24624603-AT-A 22478456-AT-A P3_t2 11×T***
17648009-CA-C,CAA 15536129-CA-C,CAA 17×A***
21457525-G-T 19295639-G-T ***
10924504-C-A ******
10825475-C-A ***
16737038-C-A 14625158-C-A ***
10780845-T-C ***
22493944-T-A 20332058-T-A DYZ19 ***
10778179-T-C ***
22493901-T-A 20332015-T-A DYZ19 ***
22493894-G-T 20332008-G-T DYZ19 ***
19963831-C-CGTAT 17851951-C-CGTAT P5_Prx 21×AT***
10780802-C-G ***
10780842-A-T ***
10780847-C-G ***
10825470-T-TCC ***
10780855-A-C ***
10780869-T-C ***
10780879-G-C ***
10780889-C-T ***
10795013-G-T ******
10800783-T-C ***
13845476-G-C 11724770-G-C ***
10825468-T-TTGATTCCG ***
7134894-CA-C,CAA 7266853-CA-C,CAA 13×A***
13698511-C-T 11542835-C-T ***
10673606-C-A ******
17923380-C-A 15811500-C-A ***
19204091-T-C 17092211-T-C ******
19133783-C-A 17021903-C-A ******
18996957-C-A 16885077-C-A ******
18653683-GC-G 16541803-GC-G ***
14424169-G-T 12303444-G-T ******
14557620-C-G 12445821-C-G ***
18154435-G-T 16042555-G-T ******
17885945-G-T 15774065-G-T ******
19529483-C-A 17417603-C-A Y105057 ******
17648009-CAAA-C,CAAAA 15536129-CAAA-C,CAAAA 17×A***
17185181-C-A 15073301-C-A ******
17048855-G-T 14936975-G-T ***
15279074-C-G 13167173-C-G ******
16768593-G-T 14656713-G-T ***
16711179-C-A 14599299-C-A ******
16342093-CAAA-C 14230213-CAAA-C 13×A***
16319549-C-A 14207669-C-A ***
19226057-C-A 17114177-C-A ***
21033565-A-G 18871679-A-G ***
56847066-G-T ******
23272282-C-A 21110396-C-A ******
28062593-A-G 25916446-A-G P1_Y2 ***
10995550-C-A ******
23759112-CT-C 21597226-CT-C ***
23597394-G-T 21435508-G-T ***
13474485-G-C 11318809-G-C ***
23498113-G-T 21336227-G-T ***
13474498-C-A 11318822-C-A ***
13474507-C-T 11318831-C-T ***
21162743-C-A 19000857-C-A ******
13474516-G-T 11318840-G-T ***
13482338-A-C 11326662-A-C ***
22010479-G-A 19848593-G-A ***
21888780-A-T 19726894-A-T ***
21773891-A-G 19612005-A-G ******
21762477-TTATA-T 19600591-TTATA-T ******
21663296-C-A 19501410-C-A ***
21464771-GTTC-G,GTTCTTCTTCTTCTTC 19302885-GTTC-G,GTTCTTCTTCTTCTTC 16×TTC******
25929232-CTTT-C 23783085-CTTT-C P1_Y1 17×T***
56827545-TCCTTTCCAT-GCGAG ***
22223298-CTTC-ATTT,CTTT 20061412-CTTC-ATTT,CTTT DYZ19 ***
21518296-C-A 19356410-C-A ***
19685433-C-A 17573553-C-A P5_Prx ***
19572120-C-A 17460240-C-A P5_Prx ***
18567529-T-C 16455649-T-C ***
18531111-GAA-G,GA 16419231-GAA-G,GA P6_Dst 19×A***
15374399-C-A 13262519-C-A ***
18504452-G-T 16392572-G-T P6_Dst ***
19511971-C-A 17400091-C-A ***
11031632-G-T ***
20074651-G-T 17962771-G-T P5_Dst ***
18019832-CTT-C,TTT 15907952-CTT-C,TTT 22×T***
17919855-G-A,AA 15807975-G-A,AA 25×A***
17071462-AAGAGAAAGAAAGAAAGA-GAAAGAAAGAAAG,GAAAGAAAGAAAGA 14959582-AAGAGAAAGAAAGAAAGA-GAAAGAAAGAAAG,GAAAGAAAGAAAGA ***
16540540-A-T 14428660-A-T ***
15532648-C-A 13420768-C-A ***
15494987-C-A 13383107-C-A ***
15138287-A-T 13026374-A-T ***
2773557-G-T 2905516-G-T ******
19930469-G-T 17818589-G-T P5_Prx ***
20074752-G-T 17962872-G-T P5_Dst ***
14080035-GATATATATATATAT-G,GATAT 11959329-GATATATATATATAT-G,GATAT 29×AT***
20844357-G-T 18682471-G-T P4_Dst ***
21491260-G-A 19329374-G-A ***
21002371-AGTCTC-A 18840485-AGTCTC-A P4_Dst ***
17864793-G-GT 15752913-G-GT 9×T***
10959749-C-A ***
20944711-T-C 18782825-T-C P4_Dst ***
20917918-C-A 18756032-C-A P4_Dst ***
20911235-G-T 18749349-G-T P4_Dst ***
10790232-T-C ***
20088505-G-C 17976625-G-C P5_Dst ***
20601063-CTA-C 18439177-CTA-C P5_Dst ***
20580603-ATGG-A 18418717-ATGG-A P5_Dst ***
20573652-TA-T 18411766-TA-T P5_Dst ***
20563449-AT-A 18401563-AT-A P5_Dst ***
10761747-A-G ******
20215024-A-G 18053138-A-G P5_Dst ***
20206644-TA-T,TAA 18044758-TA-T,TAA P5_Dst 11×A***
20140373-C-A 18028493-C-A P5_Dst ***
14453709-GAAAA-G,GAA 12332982-GAAAA-G,GAA 18×A***
2810515-C-A 2942474-C-A ***
13723982-A-G 11568306-A-G ***
10020373-A-G 10182764-A-G ***
8452192-CA-AA,C 8584151-CA-AA,C 15×A***
9042269-G-T 9204660-G-T ******
6402312-TTCC-GTTT 6534271-TTCC-GTTT ***
6401151-G-C 6533110-G-C BY60184 ***
6274829-G-T 6406788-G-T IR3_Dst ***
6239796-C-A 6371755-C-A IR3_Dst ***
6237420-G-T 6369379-G-T IR3_Dst ***
10654199-A-C ***
9533420-G-T 9695811-G-T IR3_Prx ***
10654202-A-G ***
56833059-TGCG-AGTA,TGCA ***
56832846-G-C,CTCCATTCCAC ***
22496158-A-G 20334272-A-G DYZ19 ***
10625464-CC-TG ***
10669464-CAT-C ***
13456253-CCTTTCA-TCATTCC 11300577-CCTTTCA-TCATTCC ***
13464392-ACT-GCC 11308716-ACT-GCC ***
9226632-G-A 9389023-G-A ***
9555002-T-C 9717393-T-C IR3_Prx ***
11643725-AT-TA ***
7146776-GTT-G,GTTTTT 7278735-GTT-G,GTTTTT 18×T***
2894591-G-T 3026550-G-T ******
3641092-C-CTCTT,CTCTTTCTT 3773051-C-CTCTT,CTCTTTCTT 13×TCTT******
3847089-C-A 3979048-C-A ******
4063368-T-C 4195327-T-C ***
4241767-C-A 4373726-C-A ***
10825470-TTTTCC-GATTCCGTTCCTTTCA ***
6942624-C-A 7074583-C-A ******
10799539-CCA-ACC ***
9714234-G-T 9876625-G-T IR3_Prx ***
10693986-CATTCA-C,CATTCCATTCCATTCCATTCCATTCC ***
7222287-C-A 7354246-C-A ******
7243093-C-A 7375052-C-A ******
7615209-A-G 7747168-A-G ***
10663679-TTCCATTCCATTCC-GTCCATTCC,TTCCATTCA ***
10661451-ACTC-TCTC,TCTT ***
10661198-ACTG-CCTC ***
10657415-AAT-CAA ***
28796101-T-G 26649954-T-G ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Haplotype Progression

The data below reveals the progression of changes in the haplotype. The bottom row is the haplotype for this man and above him are the inferred ancestral haplotypes for various upstream blocks. These inferred haplotypes are very much a work in progress, and any suggested modifications are appreciated. I think we can use our vast collection of haplotype data to refine these haplotypes. Mutations made from each upstream block are shown in sequence. The cell color is determined by the block in which the mutation took place.

DYS393
DYS390
DYS19
DYS391
DYS385
DYS426
DYS388
DYS439
DYS389i
DYS392
DYS389ii
DYS458
DYS459
DYS455
DYS454
DYS447
DYS437
DYS448
DYS449
DYS464
DYS460
Y-GATA-H4
YCAII
DYS456
DYS607
DYS576
DYS570
CDY
DYS442
DYS438
DYS531
DYS578
DYF395S1
DYS590
DYS537
DYS641
DYS472
DYF406S1
DYS511
DYS425
DYS413
DYS557
DYS594
DYS436
DYS490
DYS534
DYS450
DYS444
DYS481
DYS520
DYS446
DYS617
DYS568
DYS487
DYS572
DYS640
DYS492
DYS565
DYS710
DYS485
DYS632
DYS495
DYS540
DYS714
DYS716
DYS717
DYS505
DYS556
DYS549
DYS589
DYS522
DYS494
DYS533
DYS636
DYS575
DYS638
DYS462
DYS452
DYS445
Y-GATA-A10
DYS463
DYS441
Y-GGAAT-1B07
DYS525
DYS712
DYS593
DYS650
DYS532
DYS715
DYS504
DYS513
DYS561
DYS552
DYS726
DYS635
DYS587
DYS643
DYS497
DYS510
DYS434
DYS461
DYS435
P312/S1161324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123315916122626191211131210912121011113012132413101020151913241712152412231810141791211
L21/S1451324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
DF21/S1921324141111-14121212131329179-1011112515192915-15-17-17111119-231615181836-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
S30581324141011-14121212131329179-1011112515192915-15-17-17111119-231615181836-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211121211912121011113012132413101020151913241712152412231810141791211
S4261324141011-14121212131329179-1011112515193015-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526191311121211912121011113012132413101020151913231712152412231810141791211
S1901324141011-14121212131329179-1011112515193013-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526201311121211912121011113012132413101020151913231712152412231810141791211
FGC32151324141011-14121212131329189-1011112515193013-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526201311121211912121011113012132413101020151913231712152412231810141791211
Aiken1324141011-14121312131329199-1011112615192913-15-17-18111019-231615191837-39121211915-1691011810101222-23161012121581122201412111311111212

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 5442261068392077363407816394
Kit: 544226967501678778327769153
Kit: 544226-A*16000000100000008300000
Used in age calculations1068392078778327816394
Counts of SNPs42
Variant counts last updated 2020-04-03 04:03:47.

* BED data not available. Using default values.


Big Tree Main Page