Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > DF21/S192 > FGC3213 > ZZ1 > S3058 > S424 > S426 > S190 > FGC3215 > Z36747 > Y16487 > Y16486 > Y16490

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
544226
FB38
544226-A
BigY2
544226
20384647-T-G 18222761-T-G P5_Dst A*
18447595-C-T 16335715-C-T P6_Dst A*
18447603-C-T 16335723-C-T P6_Dst A*
26241148-T-C 24095001-T-C P1_Y1 ****A*
19770346-G-A 17658466-G-A P5_Prx *A*
19682348-T-A 17570468-T-A P5_Prx A*
20019210-A-T 17907330-A-T P5_Prx A*
20522399-T-TAC 18360513-T-TAC P5_Dst ***A*
19811648-T-A 17699768-T-A P5_Prx A*
16108070-G-T 13996190-G-T P8_Prx A*
16111915-G-T 14000035-G-T P8_Prx A*
16114266-G-T 14002386-G-T P8_Prx ***A*
18438435-T-C 16326555-T-C P6_Dst A*
18466857-G-T 16354977-G-T P6_Dst A*
18502569-G-T 16390689-G-T P6_Dst ***A*
19590609-G-T 17478729-G-T P5_Prx Y***A*
19735738-C-T 17623858-C-T P5_Prx A*
19753401-A-C 17641521-A-C P5_Prx A*
19846587-G-T 17734707-G-T P5_Prx A*
19923657-C-A 17811777-C-A P5_Prx A*
19965388-T-C 17853508-T-C P5_Prx A*
20076483-C-A 17964603-C-A P5_Dst A*
20104262-A-G 17992382-A-G P5_Dst A*
20397177-G-T 18235291-G-T P5_Dst ***A*
20419180-G-T 18257294-G-T P5_Dst A*
20430560-C-A 18268674-C-A P5_Dst A*
20474913-G-T 18313027-G-T P5_Dst A*
20566846-C-A 18404960-C-A P5_Dst ***A*
20751028-C-A 18589142-C-A P4_Prx A*
20920171-C-A 18758285-C-A P4_Dst A*
20931291-G-T 18769405-G-T P4_Dst ***A*
20938825-A-G 18776939-A-G P4_Dst ***A*
20973371-A-G 18811485-A-G P4_Dst A*
20985501-A-G 18823615-A-G P4_Dst A*
21007825-G-T 18845939-G-T P4_Dst Y***A*
33254-G-A A*
27039254-C-G 24893107-C-G P1_r4 +
19011154-G-T 16899274-G-T Y103366 YY+++
19031765-A-G 16919885-A-G Y103414 YY+++
22503586-A-C 20341700-A-C DYZ19 *
13489696-CGTGCCC-TGGGCCG 11334020-CGTGCCC-TGGGCCG *
22431994-CCC-TCA 20270108-CCC-TCA DYZ19 *
22237644-AGG-GGA 20075758-AGG-GGA DYZ19 *
22268692-G-A 20106806-G-A DYZ19 *****
22247493-TTA-GTC 20085607-TTA-GTC DYZ19 *
13448641-TT-C 11292965-TT-C *
22289475-AC-TG 20127589-AC-TG DYZ19 *
13470444-TCTGCGT-CCTGCTG 11314768-TCTGCGT-CCTGCTG *
13490194-GCAA-TCAG 11334518-GCAA-TCAG *
56830657-TTCCACTG-CTCCACTG,CTCCCCTT *
22451252-TGA-CAT 20289366-TGA-CAT DYZ19 *
13452125-TTCCACTG-CTCTACTC 11296449-TTCCACTG-CTCTACTC *
13452369-TTCCATTCCATTCCATTCCATTCCAT-G 11296693-TTCCATTCCATTCCATTCCATTCCAT-G *
13448351-ACTC-GCTT 11292675-ACTC-GCTT *
13449323-TCCT-ACCC 11293647-TCCT-ACCC *
13449752-TCAACCCCATTCTATTC-GAAACCCCATTCCATTG,TTCATTCAATTC 11294076-TCAACCCCATTCTATTC-GAAACCCCATTCCATTG,TTCATTCAATTC *
13450521-CTTCACTCCAC-ATCCATCCCAT,TCCCAT 11294845-CTTCACTCCAC-ATCCATCCCAT,TCCCAT *
13450590-GCTCCATTCCATTCCATTCCATTCC-ACTCCATTCCATTCCATTCT 11294914-GCTCCATTCCATTCCATTCCATTCC-ACTCCATTCCATTCCATTCT *
13489557-TTG-GTG,GTT 11333881-TTG-GTG,GTT *
13489619-ACCCCCACCACCACCCA-CGTCCTCACCCACACCAC,CGTCCTCACCCTCACCAC 11333943-ACCCCCACCACCACCCA-CGTCCTCACCCACACCAC,CGTCCTCACCCTCACCAC *
13869280-GAATGGAATGGCATTGAAT-AAAAGGAGTGGCATCAAAC 11748574-GAATGGAATGGCATTGAAT-AAAAGGAGTGGCATCAAAC *
22235145-AAAAT-GAAAC,GAAAT 20073259-AAAAT-GAAAC,GAAAT DYZ19 *
22293412-CCTTA-GCTCA,GCTCG 20131526-CCTTA-GCTCA,GCTCG DYZ19 *
22352486-AGAGTTTTTTCCTTT-AGAGTTTGTTCCTTC,TGAGTTTTTTTCCTTC 20190600-AGAGTTTTTTCCTTT-AGAGTTTGTTCCTTC,TGAGTTTTTTTCCTTC DYZ19 *
22444290-TGTGTC-AGTGGT 20282404-TGTGTC-AGTGGT DYZ19 *
22503611-T-C 20341725-T-C DYZ19 *
24035198-TA-T,TAA 21889051-TA-T,TAA 14×A*
25240239-CTTT-C,CT 23094092-CTTT-C,CT P2_r1 22×T*
25298822-T-C 23152675-T-C P2_r1 *
56829392-TTCCATTCGATTCCAT-G,TTCCATTTGATTCCAT *
56830999-C-CTCCAT,T *
56831409-TG-CGTTTCA,TGTTCCA *
56831466-CTCCTC-CTCCAC,TTCCAT *
56831592-ATTG-ATTC,TTTG *
56831762-TGG-CCA,CTG *
56831877-GCATTCCA-ACATCCT,CCATTCCA 4×CATTC*
56834399-TCTCCAC-ATTCCAT *
56834455-TTCCATTCCCTTCCATTA-CTCCATTCCATTCCCTTCCATTA,CTCCATTCCATTCCCTTCCCTTC *
13855429-C-A 11734723-C-A **
20230740-A-G 18068854-A-G P5_Dst **
20230742-T-C 18068856-T-C P5_Dst **
24658480-CT-C 22512333-CT-C P3_b2 14×T**
20949965-G-C 18788079-G-C P4_Dst **
20949930-CATT-C 18788044-CATT-C P4_Dst **
20229254-GT-G 18067368-GT-G P5_Dst 15×T**
13472205-GA-CC 11316529-GA-CC **
8218167-CTT-C 8350126-CTT-C **
58982012-GTGCCAC-ATGTCAA 56835865-GTGCCAC-ATGTCAA **
22504562-A-C 20342676-A-C DYZ19 **
19537941-G-A 17426061-G-A **
20949941-TTGATG-CTGACA 18788055-TTGATG-CTGACA P4_Dst **
22297294-C-T 20135408-C-T DYZ19 **
22434884-C-A 20272998-C-A DYZ19 **
19339982-CTTTC-TTTTT 17228102-CTTTC-TTTTT **
13474535-T-C 11318859-T-C **
9991275-G-A 10153666-G-A **
13474540-C-A 11318864-C-A **
8673863-C-A 8805822-C-A *****
10630675-A-G **
10975875-C-T **
16245943-G-T 14134063-G-T **
10668575-AATTTC-A **
7160930-G-T 7292889-G-T **
15491882-C-T 13380002-C-T **
10761139-A-T **
10761152-C-T **
10761162-C-G **
10760089-C-A ****
14590549-C-A 12478749-C-A **
19319836-A-G 17207956-A-G A2101 *****
10945055-G-T **
3271535-C-A 3403494-C-A **
7436374-C-A 7568333-C-A ****
3549525-A-G 3681484-A-G **
3575371-C-A 3707330-C-A ****
3659126-G-T 3791085-G-T ****
3963575-C-A 4095534-C-A ****
4131463-G-T 4263422-G-T ****
4181581-G-T 4313540-G-T ****
5711649-C-A 5843608-C-A ****
5767416-G-T 5899375-G-T ****
6177447-G-T 6309406-G-T IR3_Dst **
6354249-G-A 6486208-G-A **
7407281-T-C 7539240-T-C *****
8080399-G-T 8212358-G-T FT57547 ****
8697984-GA-G 8829943-GA-G ****
8719028-C-A 8850987-C-A *****
9674762-C-A 9837153-C-A IR3_Prx ****
10656905-C-A ****
10667574-C-A ****
10685351-C-A ****
10690975-T-C *****
10762185-C-A ****
10763201-C-A **
10770153-C-T **
10780782-G-T **
10793290-C-A ****
10801662-C-CACTCTTGTTG **
10822366-C-A *****
10823519-T-C **
10840088-C-A ****
10841419-C-T ****
10912404-C-A *****
10912554-C-A *****
10924283-A-G *****
10929547-C-A **
10975859-TC-T **
10975890-C-A **
10975891-C-T **
10975909-G-A **
10975917-T-A **
10975937-C-CG **
10975956-G-C **
10975959-T-A **
10975961-G-C **
10980903-T-A **
10987740-A-G **
10989564-C-A ****
10992360-C-G **
10992369-C-A **
10999749-C-A ****
11030582-C-A ****
13474536-G-A 11318860-G-A **
13592028-T-C 11436352-T-C **
13592038-C-A 11436362-C-A *****
13597121-G-T 11441445-G-T *****
11675576-G-A ****
13809386-C-T 11688680-C-T FT248760 **
13946018-G-T 11825312-G-T ****
13946127-C-T 11825421-C-T *****
14011905-C-A 11891199-C-A **
14685959-A-G 12574025-A-G **
14794553-C-T 12682624-C-T ****
15338735-C-A 13226853-C-A *****
15599322-A-G 13487442-A-G ****
15922340-G-T 13810460-G-T *****
16065763-C-T 13953883-C-T ****
16868744-T-A 14756864-T-A ****
17367795-C-T 15255915-C-T *****
18185137-T-C 16073257-T-C ****
18188316-A-G 16076436-A-G ****
18271079-C-A 16159199-C-A **
18593524-C-A 16481644-C-A *****
18623463-G-T 16511583-G-T ****
19388394-C-A 17276514-C-A **
19463447-T-A 17351567-T-A *****
20842592-C-A 18680706-C-A P4_Dst **
21225195-C-A 19063309-C-A **
21771376-G-GT 19609490-G-GT 9×T**
22309941-A-C 20148055-A-C DYZ19 **
23096592-A-G 20934706-A-G ****
23127029-C-A 20965143-C-A FT425749 ****
23262731-G-C 21100845-G-C *****
23339107-C-A 21177221-C-A ****
23569569-G-T 21407683-G-T ****
24295367-AC-A 22149220-AC-A P3_t1 **
25733058-A-T 23586911-A-T P1_b3 **
27527086-A-G 25380939-A-G P1_Y2 **
28558495-C-T 26412348-C-T FT416851 *****
56871043-C-A **
10892540-T-C FT435718 **
10892534-A-T **
24663415-A-G 22517268-A-G P3_b2 **
24663420-TCTA-T 22517273-TCTA-T P3_b2 **
24663450-T-C 22517303-T-C P3_b2 **
24663457-T-C 22517310-T-C P3_b2 **
22493075-T-G 20331189-T-G DYZ19 **
11024664-TTTC-ATTT **
22493834-CCT-GCA 20331948-CCT-GCA DYZ19 **
22493699-TT-GG 20331813-TT-GG DYZ19 **
7387396-A-TT 7519355-A-TT 22×T**
26927860-C-G 24781713-C-G P1_r3 **
21780406-GAA-G **
4223933-A-G 4355892-A-G **
6219256-G-T 6351215-G-T IR3_Dst **
6403221-CGGTA-TGGTG 6535180-CGGTA-TGGTG **
10672010-ATTAC-TTTCT **
10678062-G-CATTCCATTCCATTCC **
10683305-CA-AT **
10683331-CGAC-TGAA **
10689009-ATTC-TCTCAAAAT **
10692318-ATTAC-TTTCT **
10693744-AATTCCT-CA **
10799565-TATTTCATTCCTC-CAT **
10799586-AC-TT **
10833356-C-A **
10851083-TCT-GCC **
10866366-CC-GA **
10973945-CTC-TT **
10973966-CC-TCA **
10976461-T-C **
11020108-GTCT-TTCC **
13297454-T-G 11141778-T-G **
14926418-G-T 12814483-G-T **
15876360-C-AA 13764480-C-AA 21×A**
16143321-G-T 14031441-G-T P8_Dst **
16164869-C-A 14052989-C-A P8_Dst **
17278250-AGAAAGGAAGAAAGGAAGAAGAACGAAAGAAA-GAAAGGAAGAAAGGAAGAAGAAC 15166370-AGAAAGGAAGAAAGGAAGAAGAACGAAAGAAA-GAAAGGAAGAAAGGAAGAAGAAC **
18109387-A-G 15997507-A-G **
18373392-G-T 16261512-G-T P6_Prx **
18455265-A-G 16343385-A-G P6_Dst **
18487151-G-T 16375271-G-T P6_Dst **
18521463-G-T 16409583-G-T P6_Dst **
20103976-C-G 17992096-C-G P5_Dst **
20217960-T-AA 18056074-T-AA P5_Dst 13×A**
20256671-T-A 18094785-T-A P5_Dst **
20275017-G-T 18113131-G-T P5_Dst **
20280032-T-C 18118146-T-C P5_Dst **
20391474-G-T 18229588-G-T P5_Dst **
20425364-G-T 18263478-G-T P5_Dst **
20431437-C-A 18269551-C-A P5_Dst **
20480368-GGATTTTA-G 18318482-GGATTTTA-G P5_Dst **
20557333-C-A 18395447-C-A P5_Dst **
20579107-G-T 18417221-G-T P5_Dst **
20775131-GAAA-G 18613245-GAAA-G P4_Prx 21×A**
20949658-A-T 18787772-A-T P4_Dst **
20991023-A-G 18829137-A-G P4_Dst **
20996797-G-T 18834911-G-T P4_Dst **
21006259-C-A 18844373-C-A P4_Dst **
21535757-A-T 19373871-A-T **
22235076-T-C 20073190-T-C DYZ19 **
22235085-CCATACAA-ACACTCAG 20073199-CCATACAA-ACACTCAG DYZ19 **
22297312-C-A 20135426-C-A DYZ19 **
22297317-C-A 20135431-C-A DYZ19 **
22337296-G-C 20175410-G-C DYZ19 **
22492891-T-A 20331005-T-A DYZ19 **
22492896-C-G 20331010-C-G DYZ19 **
22493509-TCG-ACA 20331623-TCG-ACA DYZ19 **
22496911-C-G 20335025-C-G DYZ19 **
22496919-CTTAA-TTTAC 20335033-CTTAA-TTTAC DYZ19 **
22496933-T-C 20335047-T-C DYZ19 **
24012886-C-A 21866739-C-A **
24021166-C-A 21875019-C-A **
24099584-ATTGT-TTTG 21953437-ATTGT-TTTG P3_b1 **
24374517-G-A 22228370-G-A **
24539905-T-C 22393758-T-C P3_t2 **
24599105-G-T 22452958-G-T P3_t2 **
24663390-CAATATA-GAATCTG 22517243-CAATATA-GAATCTG P3_b2 **
24670171-TGTTAG-T 22524024-TGTTAG-T P3_b2 **
24869262-A-G 22723115-A-G IR1_R **
25429198-CTT-C 23283051-CTT-C P2_r2 13×T**
25672328-CG-C 23526181-CG-C P1_b3 **
25706148-C-CA 23560001-C-CA P1_b3 16×A**
25919930-G-T 23773783-G-T P1_Y1 **
26563869-GTTTGCTCTT-TTTTTCTC 24417722-GTTTGCTCTT-TTTTTCTC P1_g2 **
26616999-C-A 24470852-C-A P1_g2 **
27045350-G-T 24899203-G-T P1_r4 **
27045374-G-T 24899227-G-T P1_r4 **
27236555-G-T 25090408-G-T P1_g3 **
27359571-G-T 25213424-G-T P1_g3 **
27370312-T-A 25224165-T-A P1_g3 **
27508834-A-T 25362687-A-T P1_Y2 **
27732463-TTTTTC-T 25586316-TTTTTC-T P1_Y2 **
27844040-C-T 25697893-C-T P1_Y2 **
27874549-TAGAT-GAGA 25728402-TAGAT-GAGA P1_Y2 **
27904476-CTT-C 25758329-CTT-C P1_Y2 11×T**
27950909-GA-G 25804762-GA-G P1_Y2 10×A**
28113221-C-A 25967074-C-A P1_Y2 **
28428164-G-A 26282017-G-A P1_gr2 8×A**
56707082-A-T **
56844566-TACTCTTG-AACTTC **
56884424-TTTAT-A **
13845476-G-C 11724770-G-C ***
22504188-G-A 20342302-G-A DYZ19 ***
25466146-GA-G 23319999-GA-G P2_r2 12×A***
13867191-A-T 11746485-A-T ***
18471858-TAC-T 16359978-TAC-T P6_Dst 12×AC***
25356955-TA-T 23210808-TA-T P2_r2 10×A***
19586695-ATT-A 17474815-ATT-A P5_Prx 22×T***
24728547-G-T 22582400-G-T P3_b2 ***
20134533-T-TA 18022653-T-TA P5_Dst 11×A***
25718213-G-GT 23572066-G-GT P1_b3 13×T***
26538252-C-CA 24392105-C-CA P1_g2 17×A***
6776606-AAC-A 6908565-AAC-A 9×AC***
22368407-T-A 20206521-T-A DYZ19 ***
22368421-G-A 20206535-G-A DYZ19 ***
13866779-AG-CA 11746073-AG-CA ***
14642445-G-T 12530514-G-T ***
18457134-A-C 16345254-A-C P6_Dst ***
23267058-G-T 21105172-G-T ***
20428140-AT-A 18266254-AT-A P5_Dst 17×T***
22488767-G-C 20326881-G-C DYZ19 ***
22352479-T-C 20190593-T-C DYZ19 ***
21457482-G-T 19295596-G-T ***
10012176-C-T 10174567-C-T ***
13724137-C-G 11568461-C-G ***
13453418-T-A 11297742-T-A ***
26318196-GT-G 24172049-GT-G P1_Y1 12×T***
58975998-CACG-TGTT 56829851-CACG-TGTT ***
24027307-G-GA 21881160-G-GA 12×A***
27801225-G-GA 25655078-G-GA P1_Y2 13×A***
17489359-G-GA 15377479-G-GA 9×A******
13810176-ATGG-A 11689470-ATGG-A ***
27243779-TTTTG-T 25097632-TTTTG-T P1_g3 ***
13447101-ACTTTC-CCTTTG 11291425-ACTTTC-CCTTTG ***
13474515-G-A 11318839-G-A ***
22236372-A-T 20074486-A-T DYZ19 ***
2809578-G-T 2941537-G-T ***
14168640-TAA-T,TAAA 12047934-TAA-T,TAAA 12×A***
13474491-G-A 11318815-G-A ***
10959749-C-A ***
10790232-T-C ***
10761747-A-G ******
10028483-C-A 10190874-C-A ***
19511971-C-A 17400091-C-A ***
21518296-C-A 19356410-C-A ***
11031632-G-T ***
2773557-G-T 2905516-G-T ******
2810515-C-A 2942474-C-A ***
2894591-G-T 3026550-G-T ******
3641092-C-CTCTT,CTCTTTCTT 3773051-C-CTCTT,CTCTTTCTT 13×TCTT******
3847089-C-A 3979048-C-A ******
4063368-T-C 4195327-T-C ***
4241767-C-A 4373726-C-A ***
6942624-C-A 7074583-C-A ******
7146776-GTT-G,GTTTTT 7278735-GTT-G,GTTTTT 18×T***
7222287-C-A 7354246-C-A ******
7243093-C-A 7375052-C-A ******
7615209-A-G 7747168-A-G ***
9042269-G-T 9204660-G-T ******
10020373-A-G 10182764-A-G ***
10654199-A-C ***
10654202-A-G ***
10669464-CAT-C ***
10673606-C-A ******
10778179-T-C ***
10780802-C-G ***
10780842-A-T ***
10780845-T-C ***
10780847-C-G ***
10780855-A-C ***
10780869-T-C ***
10780879-G-C ***
10780889-C-T ***
10795013-G-T ******
10800783-T-C ***
10825468-T-TTGATTCCG ***
10825470-T-TCC ***
10825475-C-A ***
10825484-C-G ******
10924504-C-A ******
10924524-C-A ******
10995550-C-A ******
13474485-G-C 11318809-G-C ***
13474498-C-A 11318822-C-A ***
13474507-C-T 11318831-C-T ***
13474516-G-T 11318840-G-T ***
13482338-A-C 11326662-A-C ***
14424169-G-T 12303444-G-T ******
14557620-C-G 12445821-C-G ***
15279074-C-G 13167173-C-G ******
15374399-C-A 13262519-C-A ***
16319549-C-A 14207669-C-A ***
16342093-CAAA-C 14230213-CAAA-C 13×A***
16711179-C-A 14599299-C-A ******
16768593-G-T 14656713-G-T ***
17048855-G-T 14936975-G-T ***
17185181-C-A 15073301-C-A ******
17648009-CAAA-C,CAAAA 15536129-CAAA-C,CAAAA 17×A***
17885945-G-T 15774065-G-T ******
17923380-C-A 15811500-C-A ***
18154435-G-T 16042555-G-T ******
18653683-GC-G 16541803-GC-G ***
18996957-C-A 16885077-C-A ******
19133783-C-A 17021903-C-A ******
19204091-T-C 17092211-T-C ******
19226057-C-A 17114177-C-A ***
19529483-C-A 17417603-C-A Y105057 ******
21033565-A-G 18871679-A-G ***
21162743-C-A 19000857-C-A ******
21464771-GTTC-G,GTTCTTCTTCTTCTTC 19302885-GTTC-G,GTTCTTCTTCTTCTTC 16×TTC******
21663296-C-A 19501410-C-A ***
21762477-TTATA-T 19600591-TTATA-T ******
21773891-A-G 19612005-A-G ******
21888780-A-T 19726894-A-T ***
22010479-G-A 19848593-G-A ***
23272282-C-A 21110396-C-A ******
23498113-G-T 21336227-G-T ***
23597394-G-T 21435508-G-T ***
23759112-CT-C 21597226-CT-C ***
28062593-A-G 25916446-A-G P1_Y2 ***
56847066-G-T ******
13698511-C-T 11542835-C-T ***
16737038-C-A 14625158-C-A ***
7134894-CA-C,CAA 7266853-CA-C,CAA 13×A***
21457525-G-T 19295639-G-T ***
17648009-CA-C,CAA 15536129-CA-C,CAA 17×A***
24624603-AT-A 22478456-AT-A P3_t2 11×T***
17951299-ATTTTTTTTT-A,ATTTT 15839419-ATTTTTTTTT-A,ATTTT 25×T***
2772738-C-A 2904697-C-A ***
18614211-C-A 16502331-C-A ***
15580026-C-A 13468146-C-A ***
9564547-ATG-A 9726938-ATG-A IR3_Prx ***
18191209-C-A 16079329-C-A ***
14557862-C-A 12446063-C-A ***
6663252-C-A 6795211-C-A ***
14697194-C-A 12585260-C-A ***
14286784-CTTTT-C,CTTT 12166078-CTTTT-C,CTTT 22×T***
6354150-AT-A 6486109-AT-A ***
16058659-C-A 13946779-C-A ***
22493894-G-T 20332008-G-T DYZ19 ***
22493901-T-A 20332015-T-A DYZ19 ***
22493944-T-A 20332058-T-A DYZ19 ***
25929232-CTTT-C 23783085-CTTT-C P1_Y1 17×T***
56827545-TCCTTTCCAT-GCGAG ***
13723982-A-G 11568306-A-G ***
13464392-ACT-GCC 11308716-ACT-GCC ***
13456253-CCTTTCA-TCATTCC 11300577-CCTTTCA-TCATTCC ***
10625464-CC-TG ***
22496158-A-G 20334272-A-G DYZ19 ***
56832846-G-C,CTCCATTCCAC ***
56833059-TGCG-AGTA,TGCA ***
6237420-G-T 6369379-G-T IR3_Dst ***
6239796-C-A 6371755-C-A IR3_Dst ***
6274829-G-T 6406788-G-T IR3_Dst ***
6401151-G-C 6533110-G-C BY60184 ***
6402312-TTCC-GTTT 6534271-TTCC-GTTT ***
8452192-CA-AA,C 8584151-CA-AA,C 15×A***
9226632-G-A 9389023-G-A ***
9533420-G-T 9695811-G-T IR3_Prx ***
9555002-T-C 9717393-T-C IR3_Prx ***
9714234-G-T 9876625-G-T IR3_Prx ***
10657415-AAT-CAA ***
10661198-ACTG-CCTC ***
10661451-ACTC-TCTC,TCTT ***
10663679-TTCCATTCCATTCC-GTCCATTCC,TTCCATTCA ***
10693986-CATTCA-C,CATTCCATTCCATTCCATTCCATTCC ***
10799539-CCA-ACC ***
10825470-TTTTCC-GATTCCGTTCCTTTCA ***
11643725-AT-TA ***
14080035-GATATATATATATAT-G,GATAT 11959329-GATATATATATATAT-G,GATAT 29×AT***
14453709-GAAAA-G,GAA 12332982-GAAAA-G,GAA 18×A***
15138287-A-T 13026374-A-T ***
15494987-C-A 13383107-C-A ***
15532648-C-A 13420768-C-A ***
16540540-A-T 14428660-A-T ***
17071462-AAGAGAAAGAAAGAAAGA-GAAAGAAAGAAAG,GAAAGAAAGAAAGA 14959582-AAGAGAAAGAAAGAAAGA-GAAAGAAAGAAAG,GAAAGAAAGAAAGA ***
17919855-G-A,AA 15807975-G-A,AA 25×A***
18019832-CTT-C,TTT 15907952-CTT-C,TTT 22×T***
18504452-G-T 16392572-G-T P6_Dst ***
18531111-GAA-G,GA 16419231-GAA-G,GA P6_Dst 19×A***
18567529-T-C 16455649-T-C ***
19572120-C-A 17460240-C-A P5_Prx ***
19685433-C-A 17573553-C-A P5_Prx ***
19930469-G-T 17818589-G-T P5_Prx ***
20074651-G-T 17962771-G-T P5_Dst ***
20074752-G-T 17962872-G-T P5_Dst ***
20088505-G-C 17976625-G-C P5_Dst ***
20140373-C-A 18028493-C-A P5_Dst ***
20206644-TA-T,TAA 18044758-TA-T,TAA P5_Dst 11×A***
20215024-A-G 18053138-A-G P5_Dst ***
20563449-AT-A 18401563-AT-A P5_Dst ***
20573652-TA-T 18411766-TA-T P5_Dst ***
20580603-ATGG-A 18418717-ATGG-A P5_Dst ***
20601063-CTA-C 18439177-CTA-C P5_Dst ***
20844357-G-T 18682471-G-T P4_Dst ***
20911235-G-T 18749349-G-T P4_Dst ***
20917918-C-A 18756032-C-A P4_Dst ***
20944711-T-C 18782825-T-C P4_Dst ***
21002371-AGTCTC-A 18840485-AGTCTC-A P4_Dst ***
21491260-G-A 19329374-G-A ***
22223298-CTTC-ATTT,CTTT 20061412-CTTC-ATTT,CTTT DYZ19 ***
22229588-ACG-CCC,CCG 20067702-ACG-CCC,CCG DYZ19 ***
22235133-AGC-TG,TGC 20073247-AGC-TG,TGC DYZ19 ***
22236381-A-G 20074495-A-G DYZ19 ***
22236610-A-G 20074724-A-G DYZ19 ***
22256240-CA-AT 20094354-CA-AT DYZ19 ***
22329473-G-C 20167587-G-C DYZ19 ***
22333461-G-C 20171575-G-C DYZ19 ***
22421241-TATG-GATA 20259355-TATG-GATA DYZ19 ***
22444316-AGT-GGA 20282430-AGT-GGA DYZ19 ***
22457251-TT-AA,TA 20295365-TT-AA,TA DYZ19 ***
22493820-TAA-CAT 20331934-TAA-CAT DYZ19 ***
22498855-TT-CG 20336969-TT-CG DYZ19 ***
22501003-C-A 20339117-C-A DYZ19 ***
22503332-CCAGAT-CCAGAG,GCTGAG 20341446-CCAGAT-CCAGAG,GCTGAG DYZ19 ***
22503618-T-A 20341732-T-A DYZ19 ***
21772302-CT-C ***
21773127-C-A ***
24028684-A-T 21882537-A-T ***
24207711-T-G 22061564-T-G P3_b1 ***
24583518-G-T 22437371-G-T P3_t2 ***
24583569-AAAAAC-A 22437422-AAAAAC-A P3_t2 4×AAAAC***
24590090-G-T 22443943-G-T P3_t2 ***
24597623-C-T 22451476-C-T P3_t2 ***
24602901-G-T 22456754-G-T P3_t2 ***
24619962-T-C 22473815-T-C P3_t2 ***
24650064-C-A 22503917-C-A P3_b2 ***
24677506-TA-T 22531359-TA-T P3_b2 ***
24682836-AGTGTGTGTGTCAG-A 22536689-AGTGTGTGTGTCAG-A P3_b2 ***
24756614-G-T 22610467-G-T P3_b2 ***
24758749-T-A 22612602-T-A P3_b2 ***
24775820-A-T 22629673-A-T P3_b2 ***
24777709-G-T 22631562-G-T P3_b2 ***
24792127-G-T 22645980-G-T P3_b2 ***
24853341-C-A 22707194-C-A IR1_R ***
24938133-T-C 22791986-T-C g1 ***
25230605-C-A 23084458-C-A P2_r1 ***
25245715-C-A 23099568-C-A P2_r1 ***
25370417-A-T 23224270-A-T P2_r2 ***
25412099-G-T 23265952-G-T P2_r2 ***
25461433-CTTTT-C,CTTT 23315286-CTTTT-C,CTTT P2_r2 26×T***
25467726-T-C 23321579-T-C P2_r2 ***
25659530-G-T 23513383-G-T P1_b3 ***
25661593-T-C 23515446-T-C P1_b3 ***
25665349-G-T 23519202-G-T P1_b3 ***
26113193-G-A 23967046-G-A P1_Y1 ***
26190682-TAAG-AAAA 24044535-TAAG-AAAA P1_Y1 ***
26277717-GTA-TTT 24131570-GTA-TTT P1_Y1 ***
26296805-AT-A 24150658-AT-A P1_Y1 10×T***
27005052-T-A 24858905-T-A P1_r4 ***
27129771-CAAA-C 24983624-CAAA-C P1_g3 25×A***
27133022-G-T 24986875-G-T P1_g3 ***
27145977-G-T 24999830-G-T P1_g3 ***
27161272-C-A 25015125-C-A P1_g3 ***
27166764-C-A 25020617-C-A P1_g3 ***
27171500-G-T 25025353-G-T P1_g3 ***
27177509-G-T 25031362-G-T P1_g3 ***
27197414-G-T 25051267-G-T P1_g3 ***
27197659-C-A 25051512-C-A P1_g3 ***
27205714-G-T 25059567-G-T P1_g3 ***
27214424-G-T 25068277-G-T P1_g3 ***
27215098-A-G 25068951-A-G P1_g3 ***
27218010-A-T 25071863-A-T P1_g3 ***
27227856-G-T 25081709-G-T P1_g3 ***
27228784-G-T 25082637-G-T P1_g3 ***
27237633-G-T 25091486-G-T P1_g3 ***
27300803-G-T 25154656-G-T P1_g3 ***
27301885-T-C 25155738-T-C P1_g3 ***
27301924-C-A 25155777-C-A P1_g3 ***
27305167-C-A 25159020-C-A P1_g3 ***
27346416-T-C 25200269-T-C P1_g3 ***
27354160-G-T 25208013-G-T P1_g3 ***
27369948-G-T 25223801-G-T P1_g3 ***
27371653-G-T 25225506-G-T P1_g3 ***
27376544-C-A 25230397-C-A P1_g3 ***
27377934-G-T 25231787-G-T P1_g3 ***
27380389-G-T 25234242-G-T P1_g3 ***
27420703-A-AT 25274556-A-AT P1_g3 9×T***
27467745-G-T 25321598-G-T P1_Y2 ***
27552524-G-T 25406377-G-T P1_Y2 ***
27719223-G-T 25573076-G-T P1_Y2 ***
27741574-G-T 25595427-G-T P1_Y2 ***
27766951-G-T 25620804-G-T P1_Y2 ***
27795395-TACACACACAG-T 25649248-TACACACACAG-T P1_Y2 ***
27797311-G-A 25651164-G-A P1_Y2 ***
27807369-C-T 25661222-C-T P1_Y2 ***
27831266-G-T 25685119-G-T P1_Y2 ***
27847886-C-A 25701739-C-A P1_Y2 ***
27877263-C-A 25731116-C-A P1_Y2 ***
27915825-G-T 25769678-G-T P1_Y2 ***
27937989-TTTTTTA-T 25791842-TTTTTTA-T P1_Y2 ***
27953797-G-T 25807650-G-T P1_Y2 ***
27978996-G-T 25832849-G-T P1_Y2 ***
27980710-G-T 25834563-G-T P1_Y2 ***
28023709-G-T 25877562-G-T P1_Y2 ***
28029767-G-T 25883620-G-T P1_Y2 ***
28077445-G-T 25931298-G-T P1_Y2 ***
28091035-A-T 25944888-A-T P1_Y2 ***
28235510-C-A 26089363-C-A P1_b4 ***
56826847-GATTCCATTCCATTCAATTCC-CTTTCCATTCCATTCGATTAG ***
56831390-ATTC-GTTCCACTCCATTT ***
56832332-GTC-ATG ***
56833005-AAG-AAA,GAA ***
56833090-ATATTTCAC-CTATTTCAC,CTATTTCAT ***
56833163-TTGCACTCCAC-CTGCAA,CTGCAC ***
56834581-TCCAT-CCTATTCCAA ***
56837046-CG-CA,TA ***
56861817-AAAAAAAAAAAAAA-CAAACAAACAAACAAAA,CAAACAAACAAACAAAC ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.