Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > DF21/S192 > FGC3213 > ZZ1 > S3058 > S424 > S426 > S190 > FGC3215 > ZZ79 > S425 > FGC64782 > BY103024

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
601990
BigY2
601990
18329071-G-A 16217191-G-A P6_Prx A*
17811923-G-A 15700043-G-A BY117581 YY++
22445759-T-G 20283873-T-G BY219705 DYZ19 ++
22299236-G-C 20137350-G-C DYZ19 ****
25887030-T-G 23740883-T-G P1_Y1 **
24013790-G-T 21867643-G-T **
13485403-A-G 11329727-A-G **
15903981-C-A 13792101-C-A **
17196748-GTAGA-G 15084868-GTAGA-G **
22461439-C-T 20299553-C-T DYZ19 ****
27014726-CTCT-C 24868579-CTCT-C P1_r4 **
5987232-CTT-C 6119191-CTT-C 12×T**
22075784-C-A 19913898-C-A **
3435818-C-A 3567777-C-A **
11026904-C-T **
10684622-G-T **
10759924-G-C FT150328 **
4002992-C-A 4134951-C-A **
27423959-C-A 25277812-C-A P1_g3 **
7310569-A-G 7442528-A-G **
19187412-TTG-T 17075532-TTG-T **
10802356-C-T **
15157878-AAAAG-A 13045964-AAAAG-A **
14067319-C-A 11946613-C-A **
10093111-A-T 10255502-A-T **
17915985-C-A 15804105-C-A **
19270564-T-G 17158684-T-G **
17668416-C-A 15556536-C-A **
9941195-C-A 10103586-C-A **
15940285-C-A 13828405-C-A **
10958935-T-C **
16413703-C-A 14301823-C-A **
18615981-A-C 16504101-A-C **
10895838-C-CCCGGATTGAA **
14934450-C-A 12822515-C-A **
10759944-G-C **
13821317-G-T 11700611-G-T **
10994122-C-T **
15969952-T-A 13858072-T-A **
10652167-T-C **
10652171-G-T **
10821906-C-G **
19463302-C-A 17351422-C-A **
25918852-C-A 23772705-C-A P1_Y1 **
17144119-G-A 15032239-G-A BY202121 **
21438776-A-C 19276890-A-C **
14297915-CCACA-C 12177209-CCACA-C 10×CA**
9444931-G-T 9607322-G-T **
2892542-ATTTT-A 3024501-ATTTT-A 18×T**
10682476-C-T **
14549308-TCAA-T 12437509-TCAA-T **
16305921-T-C 14194041-T-C **
13705401-G-T 11549725-G-T **
5576817-C-A 5708776-C-A **
10744413-ACATTC-A **
19290430-C-A 17178550-C-A **
3829006-C-A 3960965-C-A **
10781294-C-T **
21139518-C-A 18977632-C-A **
13870617-C-A 11749911-C-A **
10682548-A-G **
24264534-A-T 22118387-A-T P3_b1 **
14050002-C-A 11929296-C-A **
7241107-C-A 7373066-C-A **
15336017-C-T 13224135-C-T **
16001036-G-A 13889156-G-A **
23633414-A-C 21471528-A-C **
19447566-C-A 17335686-C-A **
21138769-GA-G 18976883-GA-G 9×A**
23807577-T-C 21645691-T-C **
16689757-C-A 14577877-C-A **
25918857-T-TA 23772710-T-TA P1_Y1 **
2649802-C-T 2781761-C-T 24×A**
2665460-C-A 2797419-C-A **
2684722-A-G 2816681-A-G **
2778589-T-G 2910548-T-G **
2799585-A-C 2931544-A-C **
2888868-CTCA-C 3020827-CTCA-C **
2960259-A-C 3092218-A-C **
2975515-C-G 3107474-C-G **
2975550-T-C 3107509-T-C **
3218324-C-G 3350283-C-G **
3309334-A-G 3441293-A-G **
3334321-G-T 3466280-G-T **
3407497-T-A 3539456-T-A **
3500162-T-G 3632121-T-G **
3554300-C-T 3686259-C-T **
3602636-G-C 3734595-G-C **
3602744-T-G 3734703-T-G **
3606360-C-A 3738319-C-A **
3626309-G-T 3758268-G-T **
3626976-T-G 3758935-T-G **
3709918-A-G 3841877-A-G **
3828981-G-T 3960940-G-T **
3829061-A-G 3961020-A-G **
3849212-C-A 3981171-C-A **
3922863-A-G 4054822-A-G **
3956549-C-A 4088508-C-A **
3998788-C-A 4130747-C-A **
3998819-A-G 4130778-A-G **
3998833-A-G 4130792-A-G **
4078451-T-G 4210410-T-G **
4240294-T-G 4372253-T-G **
4389397-T-A 4521356-T-A **
4397935-A-G 4529894-A-G **
4578272-A-C 4710231-A-C **
4578321-A-C 4710280-A-C **
4626759-A-C 4758718-A-C **
4752164-C-T 4884123-C-T **
4872510-T-A 5004469-T-A **
4898604-C-T 5030563-C-T **
4918270-G-A 5050229-G-A **
4918320-T-A 5050279-T-A **
4918368-A-G 5050327-A-G **
4919576-A-T 5051535-A-T **
4936548-T-A 5068507-T-A **
5063497-C-A 5195456-C-A **
5189716-T-C 5321675-T-C **
5200825-T-C 5332784-T-C FTB54857 **
5200830-C-T 5332789-C-T **
5304964-T-G 5436923-T-G **
5304997-T-C 5436956-T-C **
5426165-T-G 5558124-T-G **
5426390-C-TG 5558349-C-TG 17×T**
5495236-A-T 5627195-A-T **
5662299-G-T 5794258-G-T FT404788 **
5684733-C-A 5816692-C-A **
5708892-A-C 5840851-A-C **
5782334-A-C 5914293-A-C **
5927310-T-G 6059269-T-G **
5961842-C-CA 6093801-C-CA 10×A**
6010185-A-G 6142144-A-G **
6096277-A-C 6228236-A-C **
6102336-C-A 6234295-C-A **
6147529-C-A 6279488-C-A IR3_Dst **
6183108-G-T 6315067-G-T IR3_Dst **
6368394-G-C 6500353-G-C **
6434587-A-C 6566546-A-C **
6441420-C-T 6573379-C-T **
6454441-T-C 6586400-T-C **
6634251-T-C 6766210-T-C FT28741 **
6690263-C-G 6822222-C-G **
6757801-A-T 6889760-A-T **
6765634-T-G 6897593-T-G **
6769788-A-C 6901747-A-C **
6769839-A-T 6901798-A-T **
6954859-A-C 7086818-A-C **
6976435-C-A 7108394-C-A **
6983732-A-T 7115691-A-T **
7038696-T-A 7170655-T-A **
7042638-A-G 7174597-A-G **
7042687-A-G 7174646-A-G **
7080178-G-C 7212137-G-C **
7105192-G-T 7237151-G-T **
7123635-C-A 7255594-C-A **
7148483-A-G 7280442-A-G FT2751 **
7166838-A-C 7298797-A-C **
7166844-T-A 7298803-T-A **
7166865-C-G 7298824-C-G **
7200014-C-A 7331973-C-A **
7236509-T-G 7368468-T-G **
7236533-C-G 7368492-C-G **
7237108-C-A 7369067-C-A **
7253679-A-C 7385638-A-C **
7270334-A-G 7402293-A-G **
7282376-C-A 7414335-C-A **
7299355-G-T 7431314-G-T **
7311761-A-C 7443720-A-C **
7311901-T-A 7443860-T-A **
7311931-T-A 7443890-T-A **
7318633-T-C 7450592-T-C **
7334034-A-T 7465993-A-T **
7334050-C-T 7466009-C-T FT362042 **
7341579-T-C 7473538-T-C **
7362476-G-C 7494435-G-C **
7362499-T-A 7494458-T-A **
7397620-C-A 7529579-C-A **
7409708-G-A 7541667-G-A **
7418701-C-T 7550660-C-T **
7470119-T-A 7602078-T-A IR1_L **
7502027-G-T 7633986-G-T IR1_L **
7502454-C-T 7634413-C-T IR1_L **
7541427-T-A 7673386-T-A **
7573545-A-T 7705504-A-T **
7573559-C-T 7705518-C-T **
7664157-A-G 7796116-A-G **
7699356-C-A 7831315-C-A **
7717667-T-A 7849626-T-A **
7755236-G-A 7887195-G-A **
7860089-C-T 7992048-C-T **
7935753-C-A 8067712-C-A **
8036040-T-G 8167999-T-G **
8067464-T-A 8199423-T-A **
8094533-C-A 8226492-C-A **
8159705-G-A 8291664-G-A **
8159749-C-G 8291708-C-G **
8171950-A-G 8303909-A-G **
8172772-C-T 8304731-C-T **
8237501-C-A 8369460-C-A **
8296967-C-G 8428926-C-G **
8351592-T-A 8483551-T-A **
8482033-C-A 8613992-C-A **
8669948-T-C 8801907-T-C **
8672065-C-A 8804024-C-A **
8705858-A-T 8837817-A-T **
8705942-C-T 8837901-C-T **
8713026-T-G 8844985-T-G **
8840588-T-A 8972547-T-A **
8987647-C-A 9150038-C-A **
9040354-G-C 9202745-G-C **
9356917-G-A 9519308-G-A **
9507948-T-A 9670339-T-A **
9513624-A-G 9676015-A-G **
9513693-A-C 9676084-A-C **
9618148-A-G 9780539-A-G IR3_Prx **
9697043-C-A 9859434-C-A IR3_Prx **
9936458-C-A 10098849-C-A **
9952162-T-G 10114553-T-G **
9952174-T-C 10114565-T-C **
9968365-T-A 10130756-T-A **
9993373-C-A 10155764-C-A **
9996265-G-A 10158656-G-A **
10032207-T-C 10194598-T-C **
10652168-T-A **
10654358-T-C **
10657631-C-T **
10658232-C-A **
10664809-C-T **
10668590-C-A **
10686812-G-C **
10686902-A-C **
10686906-T-A **
10686914-T-A **
10686918-C-T **
10686928-C-T **
10686940-T-C **
10686948-C-CACTCT **
10692845-T-C **
10692902-C-A **
10694139-C-A **
10755338-A-ATTTTG **
10759929-A-G **
10759945-C-T **
10759980-C-CACTGT **
10763252-T-G **
10765530-CT-C **
10781020-A-T **
10781265-A-ACTACG **
10781284-T-A **
10781286-T-C **
10781293-C-G **
10781305-A-G **
10781309-C-T **
10781318-C-T **
10787418-TCTATTCC-T **
10788004-C-T **
10791361-C-A **
10792049-C-A **
10792720-C-A **
10793539-T-C **
10796585-T-C **
10819414-T-G **
10821874-C-CTCGAT **
10821933-A-G **
10823689-C-T **
10824026-C-A **
10828961-T-C **
10831088-A-T **
10831113-A-C **
10863452-A-C **
10878289-C-T **
10880029-G-T **
10919062-A-C **
10926681-T-A **
10926691-T-G **
10926709-A-ACTCGACTCCACTC **
10932102-C-A **
10958427-A-G **
10962946-T-C **
10967330-T-G **
10971099-C-A **
10971176-A-C **
10973618-G-C **
10973638-G-A **
10973639-T-C **
10973657-C-A **
10986889-C-A **
10988626-A-C **
10993918-C-G **
10993952-C-A **
10994118-T-C **
10994125-C-A **
10994832-T-C **
10995637-G-C **
10997580-T-C **
10997864-C-T **
11000416-T-A **
11004701-A-G **
11004761-T-G **
11009659-A-T **
11026960-T-C **
11033966-C-A **
13196051-TC-T 11040375-TC-T **
13213910-A-G 11058234-A-G **
13213912-T-G 11058236-T-G **
13213923-T-G 11058247-T-G **
13225629-A-C 11069953-A-C **
13226855-G-T 11071179-G-T **
13233532-C-A 11077856-C-A **
13242965-C-A 11087289-C-A **
13296855-C-A 11141179-C-A F18127 **
13313644-G-C 11157968-G-C **
13325366-C-A 11169690-C-A **
13422186-T-A 11266510-T-A **
13422330-A-G 11266654-A-G **
13485405-G-C 11329729-G-C **
13485460-G-A 11329784-G-A **
13485464-A-T 11329788-A-T **
13485473-T-A 11329797-T-A **
13485492-C-G 11329816-C-G **
13485496-G-T 11329820-G-T **
13485517-T-A 11329841-T-A **
13522032-C-T 11366356-C-T **
13522051-G-C 11366375-G-C **
13523488-T-A 11367812-T-A **
13604355-C-A 11448679-C-A **
13632013-T-G 11476337-T-G **
13643552-T-A 11487876-T-A **
13671500-C-A 11515824-C-A **
13705399-T-G 11549723-T-G **
13708978-T-G 11553302-T-G **
13709315-C-A 11553639-C-A **
13859476-A-C 11738770-A-C **
13859591-A-T 11738885-A-T **
13861037-A-G 11740331-A-G **
13896889-A-G 11776183-A-G **
13935526-T-C 11814820-T-C **
13935536-T-A 11814830-T-A **
13935540-A-T 11814834-A-T **
13935545-TG-T 11814839-TG-T **
13960508-G-A 11839802-G-A **
13975934-A-G 11855228-A-G **
13975935-T-A 11855229-T-A **
13976452-G-A 11855746-G-A **
14046523-T-A 11925817-T-A **
14048441-T-A 11927735-T-A **
14143935-A-G 12023229-A-G **
14160268-G-T 12039562-G-T **
14175052-C-G 12054346-C-G **
14181103-C-A 12060397-C-A **
14226485-A-C 12105779-A-C **
14247613-A-T 12126907-A-T **
14253090-C-A 12132384-C-A **
14286161-C-A 12165455-C-A **
14295679-C-A 12174973-C-A **
14300566-C-A 12179860-C-A **
14300883-A-G 12180177-A-G **
14359914-C-A 12239209-C-A **
14366287-A-T 12245582-A-T **
14366341-C-T 12245636-C-T **
14420229-G-T 12299504-G-T **
14420275-T-G 12299550-T-G **
14448353-G-A 12327626-G-A **
14470656-G-A 12349925-G-A **
12379318-T-G **
12379323-T-G **
14512493-T-G 12400698-T-G **
14518457-C-A 12406658-C-A **
14529136-C-A 12417337-C-A **
14582405-G-C 12470605-G-C **
14588985-G-T 12477185-G-T **
14593719-A-G 12481919-A-G **
14626218-A-T 12514286-A-T **
14715730-A-C 12603797-A-C **
14776936-A-C 12665005-A-C **
14831908-A-C 12719975-A-C **
14919398-A-G 12807463-A-G **
14993842-ATT-A 12881927-ATT-A 13×T**
15157887-T-A 13045973-T-A **
15168005-T-G 13056091-T-G **
15219087-C-G 13107173-C-G **
15315436-T-C 13203541-T-C **
15366418-C-A 13254538-C-A **
15388398-G-T 13276518-G-T **
15403555-C-A 13291675-C-A **
15403596-T-A 13291716-T-A **
15404324-G-C 13292444-G-C **
15447169-G-A 13335289-G-A **
15532355-A-C 13420475-A-C **
15619542-C-A 13507662-C-A **
15653641-T-G 13541761-T-G **
15653666-G-C 13541786-G-C **
15653683-T-G 13541803-T-G **
15653707-T-A 13541827-T-A **
15701101-A-G 13589221-A-G **
15731404-T-G 13619524-T-G **
15732085-G-C 13620205-G-C **
15732915-C-A 13621035-C-A **
15742317-G-C 13630437-G-C **
15743793-G-C 13631913-G-C **
15745631-A-G 13633751-A-G **
15762100-G-T 13650220-G-T **
15786164-A-G 13674284-A-G **
15792714-T-G 13680834-T-G **
15792721-A-T 13680841-A-T **
15843109-G-A 13731229-G-A **
15917538-A-G 13805658-A-G **
15917539-C-A 13805659-C-A **
15922317-A-G 13810437-A-G **
15922334-C-G 13810454-C-G Y137934 **
15932438-C-G 13820558-C-G **
15940287-G-A 13828407-G-A **
15963873-A-C 13851993-A-C **
16000959-A-C 13889079-A-C **
16000966-T-A 13889086-T-A **
16003191-TG-T 13891311-TG-T **
16019135-A-C 13907255-A-C **
16021419-C-T 13909539-C-T **
16021590-G-T 13909710-G-T **
16038815-T-C 13926935-T-C **
16038823-C-G 13926943-C-G **
16045721-C-A 13933841-C-A **
16056005-C-A 13944125-C-A **
16060057-A-T 13948177-A-T **
16060653-A-G 13948773-A-G **
16063421-T-A 13951541-T-A **
16084301-G-A 13972421-G-A **
16121685-A-AC 14009805-A-AC P8_Prx **
16146490-A-AGAAC 14034610-A-AGAAC P8_Dst **
16176638-C-G 14064758-C-G **
16229981-T-C 14118101-T-C **
16233477-T-A 14121597-T-A **
16272020-A-T 14160140-A-T **
16413658-A-T 14301778-A-T **
16424992-G-T 14313112-G-T **
16463417-C-T 14351537-C-T **
16471628-A-C 14359748-A-C **
16486807-G-T 14374927-G-T **
16488061-C-G 14376181-C-G **
16506142-C-A 14394262-C-A **
16533752-A-G 14421872-A-G **
16538874-C-T 14426994-C-T **
16539726-C-G 14427846-C-G **
16553928-G-A 14442048-G-A **
16553930-G-A 14442050-G-A **
16553936-T-G 14442056-T-G **
16583303-T-A 14471423-T-A **
16583360-G-A 14471480-G-A **
16625900-A-C 14514020-A-C **
16629304-T-C 14517424-T-C **
16652659-C-A 14540779-C-A **
16652726-A-G 14540846-A-G **
16689801-T-A 14577921-T-A **
16784304-C-A 14672424-C-A **
16828806-A-T 14716926-A-T **
16941638-C-A 14829758-C-A **
17066042-A-C 14954162-A-C **
17066195-A-C 14954315-A-C **
17066207-A-T 14954327-A-T **
17115173-A-G 15003293-A-G **
17115178-G-A 15003298-G-A **
17115183-T-C 15003303-T-C **
17115185-A-C 15003305-A-C **
17115194-C-T 15003314-C-T **
17115199-G-A 15003319-G-A **
17151396-A-G 15039516-A-G **
17151416-T-G 15039536-T-G **
17157646-C-G 15045766-C-G **
17244400-T-G 15132520-T-G **
17318921-T-A 15207041-T-A **
17343769-A-G 15231889-A-G **
17343785-C-A 15231905-C-A **
17367574-A-G 15255694-A-G **
17367583-A-C 15255703-A-C **
17372285-C-A 15260405-C-A **
17375709-A-C 15263829-A-C **
17375718-T-C 15263838-T-C **
17375744-G-T 15263864-G-T **
17380585-A-T 15268705-A-T **
17385264-T-C 15273384-T-C **
17434023-A-C 15322143-A-C **
17575536-T-C 15463656-T-C **
17597849-G-T 15485969-G-T **
17597972-C-A 15486092-C-A **
17633711-G-T 15521831-G-T **
17648566-G-A 15536686-G-A **
17648576-T-C 15536696-T-C **
17648581-A-C 15536701-A-C **
17714041-A-C 15602161-A-C **
17886407-T-G 15774527-T-G **
17886414-C-A 15774534-C-A **
17915889-C-T 15804009-C-T **
17915892-C-A 15804012-C-A **
17915899-G-C 15804019-G-C **
17915904-A-C 15804024-A-C **
17915909-T-C 15804029-T-C **
17915928-A-C 15804048-A-C **
17915951-G-T 15804071-G-T **
17915955-T-C 15804075-T-C **
17915986-A-T 15804106-A-T **
17916550-T-C 15804670-T-C **
17929144-G-T 15817264-G-T **
17955954-T-A 15844074-T-A **
17963711-G-T 15851831-G-T **
17965906-C-G 15854026-C-G **
18037964-A-T 15926084-A-T **
18077995-C-T 15966115-C-T **
18127783-C-T 16015903-C-T **
18197905-C-A 16086025-C-A **
18201245-A-G 16089365-A-G **
18212555-A-C 16100675-A-C **
18274839-T-A 16162959-T-A P6_Prx **
18284651-C-A 16172771-C-A P6_Prx **
18284684-G-T 16172804-G-T P6_Prx **
18284705-G-A 16172825-G-A P6_Prx **
18340381-G-T 16228501-G-T P6_Prx **
18345893-G-C 16234013-G-C P6_Prx **
18345897-C-T 16234017-C-T P6_Prx **
18345907-A-C 16234027-A-C P6_Prx **
18345919-C-T 16234039-C-T P6_Prx **
18345932-T-C 16234052-T-C P6_Prx **
18345954-A-T 16234074-A-T P6_Prx **
18573506-G-T 16461626-G-T **
18585588-C-G 16473708-C-G **
18615961-AGA-T 16504081-AGA-T **
18615971-T-C 16504091-T-C **
18723081-T-A 16611201-T-A **
18738636-AAT-A 16626756-AAT-A **
18738658-G-A 16626778-G-A **
18738661-A-T 16626781-A-T **
18740733-G-T 16628853-G-T **
18740761-A-T 16628881-A-T **
18740778-A-T 16628898-A-T **
18752921-C-T 16641041-C-T **
18768363-A-T 16656483-A-T **
18768431-G-A 16656551-G-A **
18812167-T-G 16700287-T-G **
18841130-T-G 16729250-T-G **
18895599-T-G 16783719-T-G **
18923966-C-A 16812086-C-A **
18948168-A-C 16836288-A-C **
18948180-T-A 16836300-T-A **
18948188-A-C 16836308-A-C **
18994546-C-A 16882666-C-A **
18994555-A-G 16882675-A-G **
19075021-A-T 16963141-A-T **
19126400-C-A 17014520-C-A **
19128680-G-A 17016800-G-A **
19247061-G-T 17135181-G-T **
19253377-C-A 17141497-C-A **
19271247-C-A 17159367-C-A **
19301424-C-T 17189544-C-T **
19412879-C-A 17300999-C-A **
19412904-G-C 17301024-G-C **
19417234-A-G 17305354-A-G **
19424879-T-G 17312999-T-G **
19429628-T-C 17317748-T-C **
19460475-T-G 17348595-T-G **
19460493-T-G 17348613-T-G **
19460524-G-T 17348644-G-T **
19463430-G-C 17351550-G-C **
19463435-A-C 17351555-A-C **
19476692-A-G 17364812-A-G **
19479905-C-G 17368025-C-G **
19504145-C-A 17392265-C-A **
19508175-A-C 17396295-A-C **
19523294-C-T 17411414-C-T **
19531430-G-C 17419550-G-C **
19532788-G-C 17420908-G-C **
19532795-T-C 17420915-T-C **
19535524-C-A 17423644-C-A **
19535758-T-G 17423878-T-G **
19537869-C-A 17425989-C-A **
19567859-A-G 17455979-A-G P5_Prx **
19575975-G-T 17464095-G-T P5_Prx **
19600439-G-GTC 17488559-G-GTC P5_Prx **
19669231-A-AG 17557351-A-AG P5_Prx **
19669243-A-G 17557363-A-G P5_Prx **
19669353-G-C 17557473-G-C P5_Prx **
19677912-A-G 17566032-A-G P5_Prx **
19684987-T-C 17573107-T-C P5_Prx **
19684997-A-C 17573117-A-C P5_Prx **
19685010-T-C 17573130-T-C P5_Prx **
19685011-C-T 17573131-C-T P5_Prx **
19685019-T-C 17573139-T-C P5_Prx **
19685022-G-A 17573142-G-A P5_Prx **
19685024-T-C 17573144-T-C P5_Prx **
19685043-T-A 17573163-T-A P5_Prx **
19685054-A-C 17573174-A-C P5_Prx **
19685058-G-A 17573178-G-A P5_Prx **
19687580-T-C 17575700-T-C P5_Prx **
19687591-T-G 17575711-T-G P5_Prx **
19687609-T-A 17575729-T-A P5_Prx **
19687627-C-T 17575747-C-T P5_Prx **
19739345-A-ACAC 17627465-A-ACAC P5_Prx **
20611309-T-A 18449423-T-A P5_Dst **
20629812-T-TG 18467926-T-TG P4_Prx **
20652727-T-A 18490841-T-A P4_Prx **
20655166-T-G 18493280-T-G P4_Prx **
20739798-A-G 18577912-A-G P4_Prx **
20739802-G-C 18577916-G-C P4_Prx **
20751848-T-G 18589962-T-G P4_Prx **
20775809-T-C 18613923-T-C P4_Prx **
20778257-A-T 18616371-A-T P4_Prx **
20778260-A-G 18616374-A-G P4_Prx **
20778265-G-C 18616379-G-C P4_Prx **
20778273-T-G 18616387-T-G P4_Prx **
20778279-A-G 18616393-A-G P4_Prx **
20778287-C-T 18616401-C-T P4_Prx **
20778289-A-T 18616403-A-T P4_Prx **
20778298-T-C 18616412-T-C P4_Prx **
20778303-T-G 18616417-T-G P4_Prx **
20778312-G-T 18616426-G-T P4_Prx **
20778314-T-C 18616428-T-C P4_Prx **
20778333-T-G 18616447-T-G P4_Prx **
20778769-A-T 18616883-A-T P4_Prx **
20809863-C-A 18647977-C-A P4_Gap **
20980010-T-A 18818124-T-A P4_Dst **
20980014-A-C 18818128-A-C P4_Dst **
20980028-T-C 18818142-T-C P4_Dst **
20980045-T-A 18818159-T-A P4_Dst **
20980051-G-C 18818165-G-C P4_Dst **
20980060-G-C 18818174-G-C P4_Dst **
20980078-T-G 18818192-T-G P4_Dst **
20980099-T-A 18818213-T-A P4_Dst **
20980101-C-T 18818215-C-T P4_Dst **
20980110-C-A 18818224-C-A P4_Dst **
20980115-A-T 18818229-A-T P4_Dst **
20980134-C-T 18818248-C-T P4_Dst **
20980145-T-G 18818259-T-G P4_Dst **
21006510-A-AAC 18844624-A-AAC P4_Dst **
21087178-A-G 18925292-A-G **
21146446-T-A 18984560-T-A **
21148580-A-G 18986694-A-G **
21148581-G-A 18986695-G-A **
21148587-C-A 18986701-C-A **
21203741-A-T 19041855-A-T **
21221051-A-G 19059165-A-G **
21306471-T-G 19144585-T-G **
21324099-C-A 19162213-C-A **
21324100-A-C 19162214-A-C **
21444607-G-C 19282721-G-C **
21511114-A-C 19349228-A-C **
21511126-C-A 19349240-C-A **
21518333-T-C 19356447-T-C **
21545372-T-A 19383486-T-A **
21555367-C-A 19393481-C-A **
21603940-T-A 19442054-T-A **
21617746-T-C 19455860-T-C **
21617753-T-G 19455867-T-G **
21670561-G-A 19508675-G-A **
21884750-C-A 19722864-C-A **
21935130-A-C 19773244-A-C **
21935136-A-G 19773250-A-G **
21935142-A-G 19773256-A-G **
21935149-G-C 19773263-G-C **
21935159-C-G 19773273-C-G **
21935163-C-T 19773277-C-T **
21935171-C-G 19773285-C-G **
21935185-T-C 19773299-T-C **
21935195-A-T 19773309-A-T **
21963667-A-G 19801781-A-G **
21983993-A-T 19822107-A-T **
21984078-A-T 19822192-A-T **
21984089-A-C 19822203-A-C **
22013270-A-T 19851384-A-T **
22073951-T-C 19912065-T-C **
22076977-G-T 19915091-G-T **
22091131-T-G 19929245-T-G **
22122217-G-T 19960331-G-T **
22146354-C-A 19984468-C-A **
22149770-A-C 19987884-A-C **
22166593-G-A 20004707-G-A **
22181842-A-T 20019956-A-T **
22269689-C-A 20107803-C-A DYZ19 **
22286715-T-A 20124829-T-A DYZ19 **
22296461-A-T 20134575-A-T DYZ19 **
22296481-G-A 20134595-G-A DYZ19 **
22296484-C-T 20134598-C-T DYZ19 **
22296493-T-C 20134607-T-C DYZ19 **
22296494-T-C 20134608-T-C DYZ19 **
22296496-C-G 20134610-C-G DYZ19 **
22296517-C-T 20134631-C-T DYZ19 **
22296528-C-T 20134642-C-T DYZ19 **
22296532-T-A 20134646-T-A DYZ19 **
22541023-G-C 20379137-G-C **
22550002-G-C 20388116-G-C **
22732754-C-A 20570868-C-A **
22732771-A-C 20570885-A-C **
22810072-C-A 20648186-C-A **
22829603-C-A 20667717-C-A **
22893331-T-G 20731445-T-G **
22901927-A-C 20740041-A-C **
22954594-A-G 20792708-A-G **
23036828-C-A 20874942-C-A **
23046079-C-G 20884193-C-G **
23058561-T-C 20896675-T-C **
23104061-T-C 20942175-T-C **
23145892-T-G 20984006-T-G **
23255213-G-C 21093327-G-C **
23255913-G-A 21094027-G-A **
23255937-A-C 21094051-A-C **
23261574-T-A 21099688-T-A **
23269452-C-A 21107566-C-A **
23305945-T-C 21144059-T-C **
23305952-A-T 21144066-A-T **
23398212-T-A 21236326-T-A **
23419219-T-A 21257333-T-A **
23442806-C-A 21280920-C-A **
23465889-G-T 21304003-G-T **
23723522-A-T 21561636-A-T **
23881765-G-T 21719879-G-T **
24017409-T-TG 21871262-T-TG **
24134179-C-T 21988032-C-T P3_b1 **
24206035-A-C 22059888-A-C P3_b1 **
24344108-G-A 22197961-G-A P3_t1 **
24517981-A-G 22371834-A-G **
24517983-A-G 22371836-A-G **
24517984-A-T 22371837-A-T **
24627828-TG-T 22481681-TG-T P3_t2 **
24673237-T-G 22527090-T-G P3_b2 **
24870055-A-T 22723908-A-T IR1_R **
25042963-T-G 22896816-T-G g1 **
25096452-A-G 22950305-A-G g1 **
25883632-T-TA 23737485-T-TA P1_Y1 **
25886978-C-G 23740831-C-G P1_Y1 **
25886995-C-A 23740848-C-A P1_Y1 **
25887014-T-G 23740867-T-G P1_Y1 **
25887016-T-A 23740869-T-A P1_Y1 **
25887025-T-A 23740878-T-A P1_Y1 **
25887029-C-G 23740882-C-G P1_Y1 **
25887039-C-A 23740892-C-A P1_Y1 **
25887041-T-G 23740894-T-G P1_Y1 **
25887055-A-C 23740908-A-C P1_Y1 **
25918949-A-C 23772802-A-C P1_Y1 **
25931441-C-G 23785294-C-G P1_Y1 **
25934552-T-G 23788405-T-G P1_Y1 **
25934554-C-T 23788407-C-T P1_Y1 **
25934557-C-T 23788410-C-T P1_Y1 **
25934562-C-T 23788415-C-T P1_Y1 **
25934567-A-T 23788420-A-T P1_Y1 **
25934577-T-C 23788430-T-C P1_Y1 **
25934585-T-TA 23788438-T-TA P1_Y1 **
25936920-G-A 23790773-G-A P1_Y1 **
25936933-A-G 23790786-A-G P1_Y1 **
25936937-A-C 23790790-A-C P1_Y1 **
25936939-G-C 23790792-G-C P1_Y1 **
25936950-G-C 23790803-G-C P1_Y1 **
25936962-G-C 23790815-G-C P1_Y1 **
25936972-C-T 23790825-C-T P1_Y1 **
25936975-G-T 23790828-G-T P1_Y1 **
25936994-G-T 23790847-G-T P1_Y1 **
25937004-T-C 23790857-T-C P1_Y1 **
25937013-G-C 23790866-G-C P1_Y1 **
25937014-T-A 23790867-T-A P1_Y1 **
25937020-C-T 23790873-C-T P1_Y1 **
25937027-G-C 23790880-G-C P1_Y1 **
25937029-A-C 23790882-A-C P1_Y1 **
25937048-A-T 23790901-A-T P1_Y1 **
25972278-A-T 23826131-A-T P1_Y1 **
26043744-A-AG 23897597-A-AG P1_Y1 **
26043803-A-G 23897656-A-G P1_Y1 **
26043814-G-A 23897667-G-A P1_Y1 **
26117879-A-G 23971732-A-G P1_Y1 **
26134324-C-G 23988177-C-G P1_Y1 **
26134367-C-T 23988220-C-T P1_Y1 **
26222512-T-TA 24076365-T-TA P1_Y1 **
26228671-T-G 24082524-T-G P1_Y1 **
26228678-T-C 24082531-T-C P1_Y1 **
26234157-A-ACCCCCCCCC 24088010-A-ACCCCCCCCC P1_Y1 **
26234157-AAAAATGATG-A 24088010-AAAAATGATG-A P1_Y1 **
26328697-C-A 24182550-C-A P1_Y1 **
26400449-T-C 24254302-T-C P1_Y1 **
26453056-T-A 24306909-T-A P1_Y1 **
26453063-T-A 24306916-T-A P1_Y1 **
26453066-T-G 24306919-T-G P1_Y1 **
26453070-T-C 24306923-T-C P1_Y1 **
26453076-T-TC 24306929-T-TC P1_Y1 **
26453095-T-C 24306948-T-C P1_Y1 **
26453099-G-T 24306952-G-T P1_Y1 **
27022375-G-C 24876228-G-C P1_r4 **
27607701-T-G 25461554-T-G P1_Y2 **
27641451-T-G 25495304-T-G P1_Y2 **
27837790-TCC-T 25691643-TCC-T P1_Y2 **
27837794-TCC-T 25691647-TCC-T P1_Y2 **
27837800-C-G 25691653-C-G P1_Y2 **
27861860-G-T 25715713-G-T P1_Y2 **
27904476-CTTT-C 25758329-CTTT-C P1_Y2 11×T**
27904494-C-A 25758347-C-A P1_Y2 **
28029150-A-G 25883003-A-G P1_Y2 **
28029171-T-A 25883024-T-A P1_Y2 **
28029180-C-G 25883033-C-G P1_Y2 **
28029185-T-G 25883038-T-G P1_Y2 **
28029194-T-A 25883047-T-A P1_Y2 **
28029196-C-A 25883049-C-A P1_Y2 **
28029204-A-T 25883057-A-T P1_Y2 **
28029218-T-A 25883071-T-A P1_Y2 **
28029223-A-G 25883076-A-G P1_Y2 **
28029226-T-G 25883079-T-G P1_Y2 **
28029236-T-A 25883089-T-A P1_Y2 **
28029241-G-A 25883094-G-A P1_Y2 **
28031772-A-G 25885625-A-G P1_Y2 **
28390744-C-T 26244597-C-T P1_gr2 **
28461986-G-A 26315839-G-A **
28497983-C-T 26351836-C-T **
28516404-G-T 26370257-G-T **
28518964-A-T 26372817-A-T **
28534356-A-C 26388209-A-C **
28551613-G-C 26405466-G-C **
28632782-T-A 26486635-T-A **
28656181-T-A 26510034-T-A **
28670199-A-T 26524052-A-T **
28673098-C-A 26526951-C-A **
28674803-C-A 26528656-C-A **
28711538-A-G 26565391-A-G **
28732082-G-T 26585935-G-T **
28765513-C-A 26619366-C-A **
28808576-A-T 26662429-A-T **
56734802-C-T **
56841838-A-G **
56851619-A-T **
56861700-G-T **
13447314-TTCCACTCCACTCCAC-T,TTCCACTCCACTCCACTCCAC 11291638-TTCCACTCCACTCCAC-T,TTCCACTCCACTCCACTCCAC 8×TCCAC***
9945863-G-A 10108254-G-A 16×A***
9954392-C-T 10116783-C-T ***
17196647-AAG-A 15084767-AAG-A ***
13706529-A-G 11550853-A-G ***
26905489-C-A 24759342-C-A P1_r3 ***
9952220-A-C 10114611-A-C ***
22427448-G-T 20265562-G-T DYZ19 ***
22441818-TG-T 20279932-TG-T DYZ19 ***
24146914-A-G 22000767-A-G P3_b1 ***
24208366-G-A 22062219-G-A P3_b1 ***
24968790-C-T 22822643-C-T g1 ***
25262637-G-A 23116490-G-A P2_r1 ***
25394270-CTCT-C 23248123-CTCT-C P2_r2 ***
7233297-TAAAA-T 7365256-TAAAA-T 17×A***
14402383-C-A 12281680-C-A ***
56832700-A-ACTGCACTCCT ***
15604353-TC-T 13492473-TC-T ***
22189263-C-A 20027377-C-A ***
15750522-G-T 13638642-G-T ***
3790878-GTATA-G,GTA 3922837-GTATA-G,GTA 21×TA***
3790949-G-T 3922908-G-T ***
4781002-G-T 4912961-G-T ***
5059696-G-T 5191655-G-T ***
6028521-C-A 6160480-C-A ***
6445018-G-A 6576977-G-A ***
6744408-C-A 6876367-C-A ***
6922760-T-C 7054719-T-C ***
7315310-C-A 7447269-C-A ***
8399137-G-C 8531096-G-C ***
8399148-C-A 8531107-C-A ***
9798062-A-T 9960453-A-T ***
9926374-C-G 10088765-C-G ***
9945861-C-A 10108252-C-A ***
10754930-TCCTC-T,TCCAC ***
10796806-C-A ***
10888002-C-T ***
10999875-AT-A ***
13463752-T-A 11308076-T-A ***
13485609-T-C 11329933-T-C ***
11650940-T-A ***
11650949-A-G ***
14566770-C-A 12454970-C-A 13×A***
14780796-C-A 12668866-C-A ***
14825147-A-T 12713214-A-T ***
15982142-T-C 13870262-T-C ***
16282397-TC-T 14170517-TC-T ***
17547728-C-T 15435848-C-T ***
18165126-CAAA-C 16053246-CAAA-C 13×A***
18961611-TA-T 16849731-TA-T ***
19330390-A-C 17218510-A-C ***
21240485-C-A 19078599-C-A ***
21267677-G-C 19105791-G-C ***
21642856-ATG-A,ATGTG 19480970-ATG-A,ATGTG 16×TG***
21663262-TAA-T,TA 19501376-TAA-T,TA 15×A***
22023229-A-T 19861343-A-T ***
22189262-T-C 20027376-T-C ***
22200355-CAAAA-C 20038469-CAAAA-C 13×A***
22775192-T-C 20613306-T-C ***
26565651-C-A 24419504-C-A P1_g2 ***
28657118-C-A 26510971-C-A ***
28798706-A-C 26652559-A-C ***
56826580-TTCTATTCCATTCGATTCTATTCCATTCAATTCTATTCCATTCGAT-T,TTCTGTCCCATTCGATTCCATTCCATTCGATTACATTCCATTCGAG ***
56832154-GT-G ***
56837197-G-T ***
56850811-G-T ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.