Tree Position

R-P312/S116 > Z40481 > ZZ11 > DF27/S250 > Z195/S355 > Z198 > CTS4188 > S14445 > BY3254

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
598872
BigY2
598872
20751863-G-A 18589977-G-A P4_Prx ***A*
6264904-C-T 6396863-C-T IR3_Dst ***A*
19786367-G-A 17674487-G-A P5_Prx ***A*
13688296-G-A 11532620-G-A A*
24297600-C-CTGGA 22151453-C-CTGGA P3_t1 +A*
18321209-G-A 16209329-G-A P6_Prx ***A*
28816609-G-T 26670462-G-T A*
13689954-T-C 11534278-T-C BY211001 A*
6241782-C-T 6373741-C-T IR3_Dst ***A*
21541425-G-T 19379539-G-T FGC64985 YY++
22467479-G-A 20305593-G-A BY27738 DYZ19 ++
22464999-C-G 20303113-C-G FGC64987 DYZ19 ++
22457772-G-A 20295886-G-A FGC64986 DYZ19 ++
22335091-G-T 20173205-G-T FGC63987 DYZ19 ***+
2798132-G-A 2930091-G-A FGC64972 YY++
2800630-T-A 2932589-T-A BY27674 YY++
7017489-T-C 7149448-T-C BY27677 Y++
6769635-C-G 6901594-C-G FGC64973 YY++
23349856-C-A 21187970-C-A FGC64989 YY++
8726940-C-T 8858899-C-T FGC64975 YY++
9017568-C-T 9179959-C-T FGC64976 Y++
9649787-A-C 9812178-A-C FGC64977 IR3_Prx ++
13670781-C-G 11515105-C-G FGC64978 ++
14036721-C-T 11916015-C-T YY++
15582146-T-C 13470266-T-C FGC64979 YY++
16476800-CTTG-C 14364920-CTTG-C ++
16767668-G-GT 14655788-G-GT ++
17644561-T-C 15532681-T-C FGC64981 YY++
18777387-T-C 16665507-T-C FGC64982 YY++
18954749-A-G 16842869-A-G FGC64983 YY++
19188658-C-T 17076778-C-T FGC64984 YY++
23336228-G-A 21174342-G-A YP1313 YY++
14855957-AT-A 12744023-AT-A ++
23747279-G-A 21585393-G-A FGC64990 Y++
28745673-A-G 26599526-A-G FGC64991 Y++
15952215-A-T 13840335-A-T Z3000/S951Z16268 YY++
23884509-CA-C 21722623-CA-C +
23232832-A-G 21070946-A-G FGC64988 Y++
24868465-C-G 22722318-C-G BY31391 P3_b2 **+
22437512-T-C 20275626-T-C DYZ19 ****
11676048-A-C **
10997328-A-G **
13855601-G-A 11734895-G-A **
10978758-C-T **
10978778-C-G **
10979921-G-T **
10979979-C-T **
10988646-ATTCTAC-A **
10990094-T-A **
10990150-C-A **
10995828-C-T **
14031781-C-T 11911075-C-T **
10995830-A-ACCCCT **
14025632-A-T 11904926-A-T **
11030375-C-T **
11021364-T-C **
13860500-G-A 11739794-G-A **
11031439-T-G **
14008892-G-C 11888186-G-C **
13421700-A-C 11266024-A-C **
13571132-A-G 11415456-A-G **
13621559-A-G 11465883-A-G **
11646155-T-A **
13846744-G-T 11726038-G-T **
11649233-T-A FT48511 **
13909804-T-C 11789098-T-C **
11676044-C-T **
13884101-A-G 11763395-A-G **
13872015-T-G 11751309-T-G **
13256133-A-G 11100457-A-G **
16615-T-C **
14050042-T-A 11929336-T-A **
15451524-G-T 13339644-G-T **
15193722-G-A 13081808-G-A **
15208150-A-G 13096236-A-G **
15230960-A-G 13119046-A-G **
15320808-C-A 13208926-C-A **
15354973-A-C 13243092-A-C **
15362024-C-A 13250144-C-A **
15386408-C-G 13274528-C-G **
15406911-G-A 13295031-G-A **
15433636-T-G 13321756-T-G **
15455007-A-G 13343127-A-G **
15102972-T-G 12991060-T-G **
15486045-G-A 13374165-G-A **
15541715-AT-A 13429835-AT-A **
15689117-A-G 13577237-A-G **
15725876-T-C 13613996-T-C **
15770138-T-C 13658258-T-C **
15777124-C-A 13665244-C-A Y94755 **
15842707-C-A 13730827-C-A **
15987347-T-C 13875467-T-C **
16052030-C-A 13940150-C-A **
15168866-C-G 13056952-C-G **
14953591-A-T 12841665-A-T **
10956489-C-G **
14539488-G-A 12427689-G-A **
14203391-A-T 12082685-A-T **
14263367-C-A 12142661-C-A **
14344985-G-A 12224280-G-A **
14371627-T-A 12250923-T-A **
14398201-T-C 12277497-T-C **
14452189-C-A 12331462-C-A **
14475813-C-A 12355082-C-A **
14529091-T-C 12417292-T-C **
14529212-T-C 12417413-T-C **
14585776-C-T 12473976-C-T **
14919442-G-A 12807507-G-A **
14585810-T-C 12474010-T-C **
14721620-C-A 12609688-C-A **
14741933-T-G 12630001-T-G **
14776990-A-C 12665059-A-C **
14779617-T-G 12667687-T-G **
14779631-C-G 12667701-C-G **
14784744-C-G 12672814-C-G **
14802986-G-C 12691057-G-C **
14879894-T-A 12767964-T-A **
10972403-C-G **
10646625-A-G **
10949945-C-G **
7721212-A-G 7853171-A-G **
7224261-T-A 7356220-T-A **
7338939-G-T 7470898-G-T **
7392267-T-C 7524226-T-C **
7417545-T-A 7549504-T-A **
7534561-A-T 7666520-A-T **
7621190-G-A 7753149-G-A **
7710295-G-T 7842254-G-T **
7753081-T-C 7885040-T-C **
7203818-G-A 7335777-G-A **
7970398-G-T 8102357-G-T **
7996970-G-A 8128929-G-A **
8080658-C-A 8212617-C-A **
8280770-T-A 8412729-T-A **
8296958-T-A 8428917-T-A **
8731017-G-T 8862976-G-T **
8746444-T-A 8878403-T-A **
7208132-G-A 7340091-G-A **
7199488-A-T 7331447-A-T **
9110354-T-G **
6619644-T-G 6751603-T-G **
6191625-C-T 6323584-C-T IR3_Dst **
6359672-A-T 6491631-A-T **
6458266-C-T 6590225-C-T **
6464882-G-T 6596841-G-T **
6464998-T-A 6596957-T-A **
6465005-A-T 6596964-A-T **
6582731-A-C 6714690-A-C **
6752042-G-A 6884001-G-A **
7199475-T-C 7331434-T-C **
6757752-T-G 6889711-T-G **
6757771-A-T 6889730-A-T **
6757794-C-A 6889753-C-A **
6848044-C-T 6980003-C-T FGC64974 **
7013353-A-T 7145312-A-T **
7052989-G-T 7184948-G-T **
7162387-T-G 7294346-T-G **
7181776-A-G 7313735-A-G **
8842342-A-C 8974301-A-C **
8984443-G-T 9146834-G-T **
10921040-CCA-C **
10823190-A-G **
10646653-A-C **
10646668-A-G **
10661601-C-G **
10780220-T-A **
10780239-G-T **
10814340-A-G **
10819033-A-C **
10827306-T-A **
10646619-C-G **
10837188-T-C **
10846589-CCCACT-C **
10859972-A-G **
10860624-T-C **
10866235-TCC-T **
10877241-T-C **
10900968-C-A **
16180449-A-G 14068569-A-G **
10646544-T-A **
9015663-A-T 9178054-A-T **
9735649-C-G 9898040-C-G IR3_Prx **
9068929-TC-T 9231320-TC-T **
9070031-A-T 9232422-A-T **
9076620-G-T 9239011-G-T **
9398056-A-AAC 9560447-A-AAC **
9417038-A-G 9579429-A-G **
9508398-C-A 9670789-C-A **
9508403-A-C 9670794-A-C **
9875012-C-A 10037403-C-A **
10029420-A-T 10191811-A-T **
9877269-T-C 10039660-T-C **
9937757-G-T 10100148-G-T **
9986324-C-A 10148715-C-A **
9990936-TGG-T 10153327-TGG-T **
10026320-T-A 10188711-T-A **
10029297-T-C 10191688-T-C **
10029342-A-G 10191733-A-G **
10029349-T-C 10191740-T-C **
16180342-G-A 14068462-G-A **
16904730-G-C 14792850-G-C **
16233385-A-C 14121505-A-C **
23093669-C-A 20931783-C-A **
22598646-T-C 20436760-T-C **
22625021-G-A 20463135-G-A FT31464 **
22649392-C-A 20487506-C-A **
22658244-CTGG-C 20496358-CTGG-C **
22836621-C-T 20674735-C-T **
22849625-TG-T 20687739-TG-T **
22971785-C-A 20809899-C-A **
23185791-T-C 21023905-T-C **
22536833-T-A 20374947-T-A **
23272382-C-CTT 21110496-C-CTT 9×T**
23339806-C-A 21177920-C-A **
23341997-T-A 21180111-T-A **
23421093-G-C 21259207-G-C **
23455095-G-A 21293209-G-A **
23513003-C-A 21351117-C-A **
23599952-A-C 21438066-A-C **
22536866-TA-T 20374980-TA-T **
22536825-G-A 20374939-G-A **
23807012-TTATTAA-T 21645126-TTATTAA-T **
21531504-G-A 19369618-G-A **
21285078-G-A 19123192-G-A **
21306542-G-T 19144656-G-T **
21321954-C-A 19160068-C-A **
21367236-C-T 19205350-C-T **
21387319-G-C 19225433-G-C **
21476927-T-G 19315041-T-G **
21528232-A-G 19366346-A-G **
21827933-A-G 19666047-A-G **
22536814-T-A 20374928-T-A **
21890935-T-A 19729049-T-A **
21895485-C-T 19733599-C-T **
21902050-A-C 19740164-A-C **
21923975-G-T 19762089-G-T **
21926573-A-T 19764687-A-T **
21974044-C-G 19812158-C-G **
22204277-A-T 20042391-A-T **
22362029-C-A 20200143-C-A DYZ19 **
23741856-C-T 21579970-C-T **
23810693-A-T 21648807-A-T **
21206946-T-C 19045060-T-C **
28548670-A-G 26402523-A-G **
27918685-G-A 25772538-G-A P1_Y2 **
28033071-T-A 25886924-T-A P1_Y2 **
28033079-G-T 25886932-G-T P1_Y2 **
28475317-C-A 26329170-C-A **
28499923-A-C 26353776-A-C **
28517279-G-C 26371132-G-C **
28517290-A-T 26371143-A-T **
28568107-C-T 26421960-C-T **
27918673-T-A 25772526-T-A P1_Y2 **
28596418-G-T 26450271-G-T **
28645784-G-A 26499637-G-A **
28653795-G-A 26507648-G-A **
28655529-T-G 26509382-T-G **
28703334-T-G 26557187-T-G **
28768634-A-T 26622487-A-T **
28798727-A-G 26652580-A-G **
27918676-G-A 25772529-G-A P1_Y2 **
27918661-A-T 25772514-A-T P1_Y2 **
23818986-C-G 21657100-C-G **
26206342-G-A 24060195-G-A P1_Y1 **
23825577-C-A 21663691-C-A **
23848451-T-G 21686565-T-G **
21750589-G-T **
21754636-T-G **
23961274-C-A 21815127-C-A **
24206172-A-G 22060025-A-G P3_b1 **
24877528-AG-A 22731381-AG-A g1 **
26248346-A-T 24102199-A-T P1_Y1 **
27810411-T-G 25664264-T-G P1_Y2 **
26834703-G-A 24688556-G-A P1_g2 **
27423592-G-T 25277445-G-T P1_g3 **
27424017-T-C 25277870-T-C P1_g3 **
27745804-T-C 25599657-T-C P1_Y2 **
27745819-G-T 25599672-G-T P1_Y2 **
27745828-C-T 25599681-C-T P1_Y2 **
27745842-A-G 25599695-A-G P1_Y2 **
27745862-G-T 25599715-G-T P1_Y2 **
21245510-G-T 19083624-G-T **
21153338-T-A 18991452-T-A **
16233415-A-T 14121535-A-T **
17676445-G-T 15564565-G-T **
17313680-T-G 15201800-T-G **
17380736-C-A 15268856-C-A **
17426915-A-G 15315035-A-G **
17492364-C-A 15380484-C-A **
17515431-C-A 15403551-C-A **
17576239-T-C 15464359-T-C **
17648241-G-T 15536361-G-T **
17702607-T-C 15590727-T-C **
17083121-C-A 14971241-C-A **
17871728-A-G 15759848-A-G **
17915852-A-G 15803972-A-G **
18256187-G-T 16144307-G-T **
18621571-T-A 16509691-T-A **
18636587-C-G 16524707-C-G **
18654851-A-G 16542971-A-G **
18695907-A-G 16584027-A-G **
17211251-G-C 15099371-G-C **
16936124-A-C 14824244-A-C **
18703813-T-C 16591933-T-C **
16395616-C-T 14283736-C-T **
16311913-G-A 14200033-G-A **
16319575-C-T 14207695-C-T **
16320129-G-C 14208249-G-C **
16345004-C-A 14233124-C-A **
16351517-C-A 14239637-C-A **
16351545-A-C 14239665-A-C **
16363936-C-A 14252056-C-A **
16430164-T-C 14318284-T-C **
5929713-TATAAGGA-T 6061672-TATAAGGA-T **
16476280-A-T 14364400-A-T **
16506836-G-T 14394956-G-T **
16520871-T-A 14408991-T-A **
16545410-TCACC-T 14433530-TCACC-T **
16656647-C-A 14544767-C-A **
16710436-C-T 14598556-C-T **
16719489-G-T 14607609-G-T **
16719504-T-C 14607624-T-C **
18703765-T-A 16591885-T-A **
18708100-C-A 16596220-C-A **
20875166-C-T 18713280-C-T P4_Dst **
19924685-G-A 17812805-G-A P5_Prx **
19775460-T-A 17663580-T-A P5_Prx **
19775470-G-A 17663590-G-A P5_Prx **
19775487-C-G 17663607-C-G P5_Prx **
19775502-C-T 17663622-C-T P5_Prx **
19775511-C-T 17663631-C-T P5_Prx **
19775525-A-G 17663645-A-G P5_Prx **
19839522-G-A 17727642-G-A P5_Prx **
19924689-C-A 17812809-C-A P5_Prx **
19663211-A-C 17551331-A-C P5_Prx **
19924697-C-T 17812817-C-T P5_Prx **
19967462-T-TTA 17855582-T-TTA P5_Prx **
20024209-T-TG 17912329-T-TG P5_Prx **
20424922-C-A 18263036-C-A P5_Dst **
20458442-G-T 18296556-G-T P5_Dst **
20690188-T-C 18528302-T-C P4_Prx **
20875154-T-TG 18713268-T-TG P4_Dst **
19739316-A-G 17627436-A-G P5_Prx **
19544631-G-A 17432751-G-A **
18853580-T-C 16741700-T-C **
19059805-A-G 16947925-A-G **
18853588-G-T 16741708-G-T **
18853592-T-C 16741712-T-C **
18890579-A-G 16778699-A-G **
18895611-G-C 16783731-G-C **
18928794-G-T 16816914-G-T **
18947915-G-A 16836035-G-A **
18994533-C-A 16882653-C-A **
19060044-A-C 16948164-A-C **
19524686-T-G 17412806-T-G **
19272030-GT-G 17160150-GT-G **
19296823-G-T 17184943-G-T **
19351443-A-C 17239563-A-C **
19358102-T-C 17246222-T-C **
19429055-A-G 17317175-A-G **
19429071-T-A 17317191-T-A **
19501651-C-A 17389771-C-A **
19524635-A-G 17412755-A-G **
6147654-G-A 6279613-G-A IR3_Dst **
5059605-A-G 5191564-A-G **
5848396-T-G 5980355-T-G **
9735657-G-T 9898048-G-T IR3_Prx **
9403521-G-T 9565912-G-T 21×T**
27916411-G-GA 25770264-G-GA P1_Y2 **
5426472-A-T 5558431-A-T **
19745015-A-C 17633135-A-C P5_Prx **
17130495-C-A 15018615-C-A **
9403520-A-G 9565911-A-G **
7341560-C-A 7473519-C-A **
17146532-C-A 15034652-C-A **
10992340-C-G **
14344929-C-A 12224224-C-A **
10995838-C-G **
7621970-C-A 7753929-C-A **
26834710-T-A 24688563-T-A P1_g2 **
26153568-T-TC 24007421-T-TC P1_Y1 **
15863155-TAAAAA-T 13751275-TAAAAA-T 17×A**
27424012-T-A 25277865-T-A P1_g3 **
24877532-G-T 22731385-G-T g1 **
24244631-C-T 22098484-C-T P3_b1 **
14784737-A-C 12672807-A-C **
28724795-A-T 26578648-A-T **
15742498-C-A 13630618-C-A **
19839527-T-A 17727647-T-A P5_Prx **
10023670-C-A 10186061-C-A **
10938389-A-G **
20645889-C-T 18484003-C-T P4_Prx **
21515855-T-A 19353969-T-A **
10861171-C-A **
4114669-C-T 4246628-C-T **
24877545-G-T 22731398-G-T g1 **
21858244-G-A 19696358-G-A **
6359677-G-T 6491636-G-T **
23421043-ATTTTT-A 21259157-ATTTTT-A 22×T**
10661588-G-A **
27423575-A-T 25277428-A-T P1_g3 **
15406924-G-A 13295044-G-A **
27944007-T-C 25797860-T-C P1_Y2 **
4114668-T-A 4246627-T-A **
17925378-ATT-A 15813498-ATT-A 11×T**
14596029-C-A 12484229-C-A **
28033130-A-AG 25886983-A-AG P1_Y2 **
9962177-G-C 10124568-G-C **
21839966-A-T 19678080-A-T FGC23448 **
15320579-G-A 13208685-G-A **
15320577-G-A 13208683-G-A **
24290683-TAA-T 22144536-TAA-T P3_t1 11×A**
56839428-T-G **
23264293-C-A 21102407-C-A **
3545497-G-T 3677456-G-T **
5587195-T-G 5719154-T-G **
13705489-T-C 11549813-T-C **
21116982-T-G 18955096-T-G **
10037858-C-A 10200249-C-A **
10938404-T-C **
13461123-T-G 11305447-T-G **
56839438-T-A **
9928156-C-A 10090547-C-A **
10978772-G-C **
16432601-C-A 14320721-C-A **
18853573-C-T 16741693-C-T **
28664979-ATG-A 26518832-ATG-A **
19849260-C-A 17737380-C-A P5_Prx **
22167289-C-A 20005403-C-A Y108559 **
23427002-C-T 21265116-C-T **
19739347-A-AACG 17627467-A-AACG P5_Prx **
10012833-C-A 10175224-C-A **
16102016-G-TTT 13990136-G-TTT P8_Prx **
10937995-A-C **
24450517-C-A 22304370-C-A **
11015855-A-AC **
11015851-A-G **
11015848-T-A **
11015847-C-A **
23633400-A-G 21471514-A-G **
13446699-T-TCATTCCATTCCATTC 11291023-T-TCATTCCATTCCATTC **
13255973-C-A 11100297-C-A **
10971948-A-G **
6359669-G-T 6491628-G-T **
13855360-C-A 11734654-C-A **
10925471-T-A **
10938002-T-A **
10665871-T-C **
15315451-G-A 13203556-G-A **
7201611-A-C 7333570-A-C **
28800378-G-A 26654231-G-A **
9735652-A-T 9898043-A-T IR3_Prx **
19187413-TG-T 17075533-TG-T **
27792016-A-T 25645869-A-T P1_Y2 **
59006570-C-T 56860423-C-T **
23808158-C-A 21646272-C-A **
28800409-T-A 26654262-T-A **
4396279-T-C 4528238-T-C **
22229801-C-T 20067915-C-T Z7823 DYZ19 **
9131177-C-T 9293568-C-T **
18539082-C-T 16427202-C-T Z328S1746 Z332 ****
28798994-T-G 26652847-T-G **
13846734-A-G 11726028-A-G **
17561370-C-A 15449490-C-A **
7990309-A-G 8122268-A-G **
16743001-C-A 14631121-C-A **
16904584-T-A 14792704-T-A **
10830686-A-T **
10830684-C-A **
10830675-T-TC **
23062183-C-A 20900297-C-A **
3012679-C-A 3144638-C-A **
15320576-G-A 13208682-G-A **
10971947-C-T **
24244632-T-C 22098485-T-C P3_b1 **
10669420-TC-T **
10669417-T-TC **
10860033-A-C **
10860011-A-G **
10949972-C-A **
20434787-G-A 18272901-G-A P5_Dst **
20137187-CA-C 18025307-CA-C P5_Dst 9×A**
20645885-C-T 18483999-C-T P4_Prx **
18611647-A-T 16499767-A-T **
25524740-A-C 23378593-A-C P1_gr1 **
10842582-C-T **
10842581-A-C **
10842556-A-T **
7562143-C-A 7694102-C-A **
16506748-C-A 14394868-C-A **
10860031-A-C **
15982149-C-A 13870269-C-A **
27943970-CCACA-C 25797823-CCACA-C P1_Y2 14×CA**
13476195-G-C 11320519-G-C **
9735655-G-T 9898046-G-T IR3_Prx **
10672606-T-C **
4114685-A-ATT 4246644-A-ATT 15×T**
10972223-G-C **
22536822-T-A 20374936-T-A **
4701368-G-T 4833327-G-T **
20850634-GGT-G 18688748-GGT-G P4_Dst 8×GT**
3226867-A-G 3358826-A-G **
3226613-G-T 3358572-G-T **
4665424-C-A 4797383-C-A **
3165108-A-G 3297067-A-G **
2970806-A-T 3102765-A-T **
2885750-C-T 3017709-C-T **
2701377-A-T 2833336-A-T **
7218351-G-T 7350310-G-T **
14985193-C-A 12873261-C-A **
17210959-C-A 15099079-C-A **
4114673-T-A 4246632-T-A **
15423458-G-A 13311578-G-A **
4685060-ATT-A 4817019-ATT-A **
3250847-T-C 3382806-T-C **
19924661-A-ATC 17812781-A-ATC P5_Prx 20×T**
7288211-C-A 7420170-C-A **
23272498-C-T 21110612-C-T **
15242529-C-A 13130615-C-A **
4879616-G-T 5011575-G-T **
17576233-T-C 15464353-T-C **
16053468-A-G 13941588-A-G **
4932121-G-A 5064080-G-A **
23316101-C-A 21154215-C-A **
11009821-G-T **
19575967-C-T 17464087-C-T P5_Prx **
28517293-T-C 26371146-T-C **
8025017-C-A 8156976-C-A **
3240736-C-A 3372695-C-A **
3389726-T-C 3521685-T-C **
3815047-A-T 3947006-A-T **
4139779-G-T 4271738-G-T **
4653229-C-T 4785188-C-T **
4653228-A-G 4785187-A-G **
4653213-C-G 4785172-C-G **
4653207-T-C 4785166-T-C **
4653181-A-T 4785140-A-T **
4653153-A-C 4785112-A-C **
4653109-TA-T 4785068-TA-T **
4504796-A-C 4636755-A-C **
4470396-A-G 4602355-A-G **
4201557-T-A 4333516-T-A **
4188151-C-A 4320110-C-A **
4139852-A-T 4271811-A-T **
4139816-G-T 4271775-G-T **
4136623-C-A 4268582-C-A **
10926747-C-T **
4133408-A-G 4265367-A-G **
4114677-T-C 4246636-T-C **
3992129-C-A 4124088-C-A **
3990804-A-T 4122763-A-T **
3990784-A-T 4122743-A-T **
3990782-G-T 4122741-G-T **
4653278-T-C 4785237-T-C **
3956099-A-G 4088058-A-G **
3831012-C-A 3962971-C-A **
3711336-T-A 3843295-T-A **
3711319-C-A 3843278-C-A **
3534059-T-A 3666018-T-A **
3501096-C-T 3633055-C-T **
10029366-G-A 10191757-G-A **
10808061-C-A **
26114478-A-G 23968331-A-G P1_Y1 **
17440818-C-A 15328938-C-A **
5178188-T-A 5310147-T-A **
10978008-A-T **
23045345-C-A 20883459-C-A **
16409012-GC-G 14297132-GC-G **
23397188-C-A 21235302-C-A **
15168355-C-A 13056441-C-A **
24877543-C-T 22731396-C-T g1 **
5178193-T-A 5310152-T-A **
16233359-C-A 14121479-C-A **
13944616-C-A 11823910-C-A **
23633393-GA-G 21471507-GA-G **
28656914-C-A 26510767-C-A **
56839456-T-A **
8279981-C-A 8411940-C-A **
7110451-A-T 7242410-A-T **
5220998-C-T 5352957-C-T **
14216503-C-A 12095797-C-A **
27918648-T-TC 25772501-T-TC P1_Y2 **
19330243-G-T 17218363-G-T **
18625606-G-T 16513726-G-T **
13860046-A-T 11739340-A-T **
5281434-C-A 5413393-C-A **
5387834-A-T 5519793-A-T **
8479420-G-T 8611379-G-T **
10926752-C-A **
56839452-T-G **
24877542-T-C 22731395-T-C g1 **
9421361-C-A 9583752-C-A **
14344995-C-A 12224290-C-A **
15410632-TCAAA-T 13298752-TCAAA-T **
21472273-G-T 19310387-G-T **
15793435-C-A 13681555-C-A **
7216602-A-C 7348561-A-C **
28614233-C-A 26468086-C-A **
13860047-C-A 11739341-C-A **
9735644-A-C 9898035-A-C IR3_Prx **
13705512-A-T 11549836-A-T **
13705506-G-A 11549830-G-A **
7140941-C-A 7272900-C-A **
17382340-C-A 15270460-C-A **
5178185-T-G 5310144-T-G **
27585952-A-T 25439805-A-T P1_Y2 **
24163463-G-A 22017316-G-A P3_b1 ***
9843220-C-A 10005611-C-A 8×A***
19586695-ATTTTTTT-A 17474815-ATTTTTTT-A P5_Prx 22×T***
22254606-A-T 20092720-A-T DYZ19 ***
22245485-GT-G 20083599-GT-G DYZ19 ***
13195047-C-A 11039371-C-A ***
22261720-C-T 20099834-C-T DYZ19 ***
14356907-TG-T 12236202-TG-T ***
58979023-T-C 56832876-T-C ***
8088164-T-A 8220123-T-A ***
22312869-T-G 20150983-T-G DYZ19 ***
22312897-T-G 20151011-T-G DYZ19 ***
16908477-G-A 14796597-G-A ***
13450531-C-A,T 11294855-C-A,T ***
22429713-G-A 20267827-G-A DYZ19 ***
13841932-C-G 11721226-C-G ***
22429718-G-C 20267832-G-C DYZ19 ***
22448024-TT-G 20286138-TT-G DYZ19 ***
24179554-A-C 22033407-A-C P3_b1 ***
22243663-A-G 20081777-A-G DYZ19 ***
7938177-G-A 8070136-G-A ***
8656020-C-CA 8787979-C-CA BY32362 10×A***
13684374-G-T 11528698-G-T ***
6752611-T-G 6884570-T-G ***
22312912-A-C 20151026-A-C DYZ19 ***
27937705-C-A 25791558-C-A P1_Y2 ***
15171226-CTTTTT-C 13059312-CTTTTT-C 19×T***
13851001-G-C 11730295-G-C ***
13857538-A-G 11736832-A-G ***
9941736-T-C 10104127-T-C PF371 ***
13867971-T-A 11747265-T-A ***
22894187-G-T 20732301-G-T ***
9967988-C-G 10130379-C-G ***
13195046-C-A 11039370-C-A ***
22312905-A-C 20151019-A-C BY25063 DYZ19 ***
9860900-G-GA 10023291-G-GA 11×A***
22278231-G-T 20116345-G-T DYZ19 ***
13473884-T-A,C 11318208-T-A,C ***
58978364-T-C 56832217-T-C ***
13846303-T-A 11725597-T-A ***
22278209-G-C 20116323-G-C DYZ19 ***
7476840-G-C 7608799-G-C IR1_L ***
13684420-A-ATTGAAATGGT 11528744-A-ATTGAAATGGT ***
18643392-GACAC-G 16531512-GACAC-G 16×AC***
23395657-A-G 21233771-A-G ***
25184511-G-A 23038364-G-A g1 ***
20770543-CA-C 18608657-CA-C P4_Prx ***
24950603-G-A 22804456-G-A g1 ***
19492833-G-T 17380953-G-T ***
25260388-T-C 23114241-T-C P2_r1 ***
15412771-CTTT-C,CT 13300891-CTTT-C,CT 15×T***
21087399-CAAAA-C 18925513-CAAAA-C 14×A***
24634080-CA-C 22487933-CA-C P3_t2 18×A***
16642090-G-A 14530210-G-A ***
4136651-C-A 4268610-C-A ***
10866478-A-ATTGTG ***
10987905-A-T ***
3165033-G-T 3296992-G-T ***
13448785-ACACCACTCCACTCCG-A,ACTCCACTCCATTCCACTCCACTCCAGTCCG 11293109-ACACCACTCCACTCCG-A,ACTCCACTCCATTCCACTCCACTCCAGTCCG ***
16015564-C-A 13903684-C-A ***
56833348-T-A ***
15558226-T-C 13446346-T-C ***
35498-C-A ***
13446689-C-T 11291013-C-T ***
8216406-CTTTTT-C,CTTT 8348365-CTTTTT-C,CTTT 16×T***
15369035-A-T 13257155-A-T ***
13463134-C-A 11307458-C-A ***
18908016-G-GCA 16796136-G-GCA ***
56835547-C-A ***
15076180-CTTTTTT-C,CTTT 12964270-CTTTTTT-C,CTTT 16×T***
28766419-C-A 26620272-C-A ***
13489821-G-T 11334145-G-T ***
13467813-A-G 11312137-A-G ***
14610736-C-A 12498938-C-A ***
13503515-A-G 11347839-A-G FGC33904 ***
14191071-C-A 12070365-C-A ***
14526990-C-A 12415191-C-A ***
10657292-T-G ***
21651801-C-A 19489915-C-A ***
26218381-TG-T 24072234-TG-T P1_Y1 ***
10988617-C-T ***
26418384-G-T 24272237-G-T P1_Y1 ***
28793155-G-A 26647008-G-A ***
19186975-CT-C 17075095-CT-C 10×T***
6768885-CTTTTTT-C,CTTTTTTTT 6900844-CTTTTTT-C,CTTTTTTTT 17×T***
18082950-G-T 15971070-G-T ***
13611021-AT-A 11455345-AT-A 8×T***
4581748-T-G 4713707-T-G ***
7208100-G-A 7340059-G-A ***
56827547-CTTTCC-CATGCG,G ***
8760547-A-G 8892506-A-G ***
16423709-C-A 14311829-C-A ***
22023223-A-T 19861337-A-T ***
8109743-T-C 8241702-T-C BY70035 ***
56826439-A-G ***
8182223-AC-A,C 8314182-AC-A,C ***
10673901-T-G ***
8385181-T-A 8517140-T-A ***
8843557-TTTG-T 8975516-TTTG-T ***
56837325-A-G ***
56837335-T-G ***
19239036-C-A 17127156-C-A ***
10987911-C-T ***
19003003-C-G 16891123-C-G BY125421 ***
9166850-C-A 9329241-C-A ***
9973853-T-C 10136244-T-C ***
23037237-ATTTTT-A 20875351-ATTTTT-A 20×T***
10024100-A-T 10186491-A-T ***
13143762-T-C 10633248-T-C ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 5988721046010775380087611136
Kit: 598872936585976503317563966
Used in age calculations1046010776503317611136
Counts of SNPs1617
Variant counts last updated 2019-09-10 00:13:53.



Big Tree Main Page