Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > FGC11134 > A353 > Z16250 > A114 > CTS4466/S1136 > S1115 > A541 > Z21065

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
567033
BigY3
567033
20574931-G-T 18413045-G-T P5_Dst A*
19789749-G-C 17677869-G-C P5_Prx ***A*
26351838-G-A 24205691-G-A P1_Y1 A*
26303425-G-A 24157278-G-A P1_Y1 A*
13472096-G-T 11316420-G-T A*
13472071-A-T 11316395-A-T A*
5665926-T-G 5797885-T-G A*
4480161-T-C 4612120-T-C A*
13441632-G-GA 11285956-G-GA 11×AA*
26076098-G-T 23929951-G-T P1_Y1 ***A*
3185978-G-A 3317937-G-A A*
2905900-G-C 3037859-G-C FT132321 YY+
4277593-A-C 4409552-A-C FT132704 +
8897921-A-T 9029880-A-T BY76761 Y++
21160532-A-G 18998646-A-G BY130768 YY++
7834257-T-G 7966216-T-G BY68052 YY++
7911842-G-A 8043801-G-A BY68694 YY++
18960527-C-A 16848647-C-A BY125107 YY++
5708134-C-A 5840093-C-A FT133110 +
14094649-C-A 11973943-C-A BY92955 YY++
14246603-G-A 12125897-G-A BY94305 YY++
15199079-T-C 13087165-T-C BY23883 YY++
22465314-A-C 20303428-A-C BY221507 DYZ19 +**
10954632-A-T +
15254191-C-T 13142277-C-T BY100459 YY++
18616192-C-T 16504312-C-T BY122628 YY++
16421311-C-A 14309431-C-A FT134170 YY+
13902825-C-A 11782119-C-A FT133769 YY+
3131151-C-CAGATAGATAGAT 3263110-C-CAGATAGATAGAT 12×AGAT*
25511036-G-A 23364889-G-A P1_gr1 *
10830887-A-AATTCC *
9418243-T-TTG 9580634-T-TTG 17×TG*
5608178-TAC-T 5740137-TAC-T 10×AC*
19372284-TGATA-T 17260404-TGATA-T 11×GATA*
6773485-T-TTTTC 6905444-T-TTTTC 4×TTTC****
3571752-GTTTTTTTTTTTTTTTTTTTTT-G 3703711-GTTTTTTTTTTTTTTTTTTTTT-G 45×T**
16545414-CAAAAAAAAAAA-C 14433534-CAAAAAAAAAAA-C 24×A**
28070146-TAC-T 25923999-TAC-T P1_Y2 11×AC**
22319094-C-A 20157208-C-A DYZ19 *****
13476202-G-C 11320526-G-C **
2791103-A-G 2923062-A-G **
14565041-T-A 12453241-T-A **
16480350-A-G 14368470-A-G **
13466871-G-C 11311195-G-C **
28492046-G-A 26345899-G-A **
21830202-AGT-A 19668316-AGT-A **
15432917-T-C 13321037-T-C CTS4151 **
13858295-A-G 11737589-A-G **
7133986-C-G 7265945-C-G YSC0000067 **
20028014-A-G 17916134-A-G BY248ZS2905 E465 P5_Prx **
20025416-TCTCTC-T 17913536-TCTCTC-T P5_Prx **
6374419-A-T 6506378-A-T **
16710764-T-C 14598884-T-C **
3850621-C-A 3982580-C-A FGC1588 **
18159825-A-G 16047945-A-G **
4826400-TTATA-T 4958359-TTATA-T 22×TA**
58974595-G-C 56828448-G-C **
13466959-A-G 11311283-A-G ***
13466867-A-T 11311191-A-T ***
13452386-CCATTCCATTCAAATACACTCCTTGC-C,CCATTCCAGTCAAATCCACTCCATGA 11296710-CCATTCCATTCAAATACACTCCTTGC-C,CCATTCCAGTCAAATCCACTCCATGA ***
6773503-C-T 6905462-C-T ***
6773505-T-C 6905464-T-C ***
13466908-C-A 11311232-C-A ***
13489955-C-A 11334279-C-A ***
9522021-TCTATCTAT-T,TCTATCTAC 9684412-TCTATCTAT-T,TCTATCTAC ***
18195154-ATTT-A,ATT 16083274-ATTT-A,ATT 29×T***
13223165-AGAGGGAGAGGGTGAGGAAGG-A 11067489-AGAGGGAGAGGGTGAGGAAGG-A ***
21553403-CTTTTTT-C,CTTT 19391517-CTTTTTT-C,CTTT 31×T***
27525243-CTTTT-C 25379096-CTTTT-C P1_Y2 27×T***
13466922-T-G 11311246-T-G ***
7063349-T-C 7195308-T-C ***
9503748-C-T 9666139-C-T ***
9678690-CT-C 9841081-CT-C IR3_Prx ***
28796403-G-A 26650256-G-A ***
7225815-TAC-T 7357774-TAC-T 10×AC***
14795080-CTT-C,CTTT 12683151-CTT-C,CTTT 24×T***
58978606-C-A 56832459-C-A ***
59016351-C-T 56870204-C-T ***
28796408-C-T 26650261-C-T ***
22263005-C-A 20101119-C-A BY1895 DYZ19 ***
17250378-CCT-C 15138498-CCT-C ***
13463956-C-T 11308280-C-T ***
13466879-C-T 11311203-C-T ***
13734240-T-G 11578564-T-G ***
28801851-A-G 26655704-A-G ***
13734238-A-C 11578562-A-C ***
9521986-ATATCTATC-A 9684377-ATATCTATC-A 12×TATC***
22475175-G-C 20313289-G-C BY37030 DYZ19 ***
13463952-C-CCCCA 11308276-C-CCCCA ***
10010835-A-G 10173226-A-G ***
28796394-T-G 26650247-T-G ***
13849285-T-TC 11728579-T-TC ***
7414277-CA-C 7546236-CA-C 27×A***
9195474-C-A 9357865-C-A ***
7032333-ATT-A,AT 7164292-ATT-A,AT 22×T***
8842943-T-TA 8974902-T-TA 22×A***
3574203-TA-T 3706162-TA-T 10×A***
5201932-C-CA 5333891-C-CA 10×A***
3558246-TAA-T 3690205-TAA-T 16×A***
10776044-C-G ***
13457734-T-TCGGTTTGAAG 11302058-T-TCGGTTTGAAG ***
3194192-CA-C 3326151-CA-C 11×A***
26463097-CT-C 24316950-CT-C P1_Y1 36×T***
13803227-G-T 11682521-G-T ***
21261826-TAAAA-T 19099940-TAAAA-T 26×A***
23127414-CAAAAA-C 20965528-CAAAAA-C 24×A***
22485139-G-A 20323253-G-A DYZ19 ***
22431088-G-C 20269202-G-C DYZ19 ***
22315877-G-A 20153991-G-A DYZ19 ***
22309981-G-C 20148095-G-C DYZ19 ***
22249007-A-C 20087121-A-C DYZ19 ***
26235278-C-G 24089131-C-G P1_Y1 ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 5670331057551776378077710763
Kit: 5670331494015493666518313162
Used in age calculations1494015493666518313162
Counts of SNPs1213
Variant counts last updated 2020-05-04 03:27:12.



Big Tree Main Page