McKendrick

FTDNA: B91977, BigY3: B91977, BigY2: B91977

Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > DF21/S192 > FGC3213 > ZZ1 > S3058 > S424 > S426 > S190 > FGC3215 > FGC3216 > FGC3197 > Y82590

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
B91977		BigY3
B91977		BigY2
B91977		Manual
Edits
20564591-A-G 18402705-A-G P5_Dst A+
6267716-G-A 6399675-G-A IR3_Dst A*
23544867-A-T 21382981-A-T YYA*
20516480-G-A 18354594-G-A BY212189 P5_Dst A*
20434742-C-T 18272856-C-T P5_Dst A*
14604582-G-T 12492784-G-T YYA*
19875050-A-G 17763170-A-G P5_Prx ***A*A*
19888269-G-C 17776389-G-C P5_Prx ***A*A*
19860888-C-A 17749008-C-A P5_Prx A*
10958323-C-A A*
28817231-G-C 26671084-G-C A*A*
10691273-A-T A*
10958313-C-T A*
18534191-C-A 16422311-C-A P6_Dst A*
20230120-C-A 18068234-C-A P5_Dst A*
19615179-T-C 17503299-T-C P5_Prx YA*A*
16135818-T-C 14023938-T-C P8_Dst A*
18369786-G-A 16257906-G-A P6_Prx A*
19928923-C-A 17817043-C-A P5_Prx A*
19938615-T-A 17826735-T-A P5_Prx A*
19965412-G-C 17853532-G-C P5_Prx A*
20500932-A-G 18339046-A-G P5_Dst A*
20881817-G-T 18719931-G-T P4_Dst A*
20881854-C-A 18719968-C-A P4_Dst A*
20911257-G-T 18749371-G-T P4_Dst A*
21093670-C-T 18931784-C-T Y16482FGC20766 YY+++
8018418-C-G 8150377-C-G Y85611 YY+++
8684020-T-C 8815979-T-C Y87719 YY+++
13208441-C-T 11052765-C-T BY84391 +++
16850211-A-AT 14738331-A-AT 9×T+*+
19220443-C-T 17108563-C-T Y104047 YY+++
22095584-A-G 19933698-A-G Y108376 YY+++
26170423-AAAGAAG-A 24024276-AAAGAAG-A P1_Y1 9×AAG+
3646481-A-G 3778440-A-G FT82556 +
18149562-A-AATAG 16037682-A-AATAG 7×ATAG****
22255187-A-G 20093301-A-G DYZ19 *
3331462-AAT-A 3463421-AAT-A 8×AT**
58994973-G-T 56848826-G-T **
21363090-CAAAA-C 19201204-CAAAA-C 16×A**
3508383-G-T 3640342-G-T **
4168842-G-T 4300801-G-T **
6123454-T-C 6255413-T-C **
6444846-A-T 6576805-A-T **
6929185-G-T 7061144-G-T **
7156759-C-A 7288718-C-A **
7257366-C-A 7389325-C-A **
7464019-C-A 7595978-C-A IR1_L **
7866781-TGTC-T 7998740-TGTC-T **
10652856-A-G **
10668611-C-T **
10745124-C-A **
10779299-A-G **
10799608-T-A **
10799609-C-G **
10799617-C-G **
10799630-C-T **
10799635-C-T **
10820365-G-T FT189855 **
10820388-C-G **
10857933-C-A **
10883495-C-A **
10906295-T-A **
10906297-G-C **
10906306-A-G **
10909781-C-G **
10909782-G-A **
10948297-TTTCCA-T **
10950862-G-T **
10955380-C-A **
10959454-C-A **
11018261-T-TCCACA **
11018266-T-G **
11018280-T-C **
13492805-C-A 11337129-C-A **
11649211-A-G **
11672007-AGGAATGGAGTTGAAAG-A **
14669825-C-A 12557891-C-A **
14742010-G-T 12630078-G-T **
19794094-A-AT 17682214-A-AT P5_Prx **
20617712-C-G 18455826-C-G P4_Prx **
20617738-A-AG 18455852-A-AG P4_Prx **
20762286-G-T 18600400-G-T P4_Prx **
20793457-T-TACGA 18631571-T-TACGA P4_Prx **
20793460-A-ATG 18631574-A-ATG P4_Prx **
21491229-G-T 19329343-G-T **
22801867-A-G 20639981-A-G **
23789372-C-A 21627486-C-A **
24247415-ACAC-A 22101268-ACAC-A P3_b1 **
25881897-C-A 23735750-C-A P1_Y1 **
26236655-A-AG 24090508-A-AG P1_Y1 **
27791980-GCTTCTT-G 25645833-GCTTCTT-G P1_Y2 9×CTT****
28691447-CAA-C 26545300-CAA-C 16×A**
56844531-G-A **
27432-C-A **
10629062-C-T **
13482735-T-C 11327059-T-C **
13482737-T-A 11327061-T-A **
16217902-A-T 14106022-A-T FGC3655 **
3174563-G-T 3306522-G-T **
4098769-A-G 4230728-A-G **
6146366-TA-T 6278325-TA-T IR3_Dst **
6444855-TATATACAC-T 6576814-TATATACAC-T **
17083100-A-G 14971220-A-G **
17923376-A-G 15811496-A-G **
21277661-T-C 19115775-T-C **
21498793-A-G 19336907-A-G **
22723386-C-CAA 20561500-C-CAA 17×A***
7811532-C-T 7943491-C-T Z12229 ***
25134610-G-A 22988463-G-A BY28186 g1 ***
25134613-C-T 22988466-C-T BY28187 g1 ***
25134615-G-C 22988468-G-C BY28188 g1 ***
25134616-G-C 22988469-G-C BY28189 g1 ***
25134627-T-C 22988480-T-C BY28190 g1 ***
7811508-A-G 7943467-A-G DC96Z1370 ***
19113763-C-T 17001883-C-T ***
13940936-C-G 11820230-C-G ***
13481943-G-A 11326267-G-A ***
20434723-C-A 18272837-C-A P5_Dst ***
4376142-CAAAAAA-C 4508101-CAAAAAA-C 26×A***
9218522-TTGTGTGTG-T 9380913-TTGTGTGTG-T 12×TG***
22503002-C-G 20341116-C-G DYZ19 ***
18196521-G-T 16084641-G-T ***
13832302-A-G 11711596-A-G ***
23656776-T-C 21494890-T-C ***
24105803-G-A 21959656-G-A P3_b1 ***
25052749-C-G 22906602-C-G g1 ***
25131712-C-T 22985565-C-T g1 ***
14339106-CTTTTTT-C 12218401-CTTTTTT-C 19×T***
13446606-A-AC 11290930-A-AC ***
13446608-CT-C 11290932-CT-C ***
4616749-C-A 4748708-C-A ***
4957988-CT-C 5089947-CT-C ***
5937226-CTCTCTCTCTCTCTCTCTATA-C,CTCTCTCTCTCTCTCTATATA 6069185-CTCTCTCTCTCTCTCTCTATA-C,CTCTCTCTCTCTCTCTATATA ***
6523677-G-A 6655636-G-A FT366837 ***
7166637-TATA-T,TATT 7298596-TATA-T,TATT ***
7255997-G-T 7387956-G-T ***
7311543-T-C 7443502-T-C ***
7359830-A-G 7491789-A-G ***
7664291-C-A 7796250-C-A FT167463 ***
8274069-C-A 8406028-C-A ***
9771906-G-T 9934297-G-T ***
10652618-C-A ***
10660894-C-CCATTCCATTCCACTA ***
10669417-T-TA ***
10685596-G-T ***
10747023-C-CAGGTTA ***
10851005-C-A ***
10892544-A-ATTCGGGTTGTTTGCT ***
10892561-T-C ***
10898275-C-A ***
10936776-G-T ***
10985079-T-C ***
10986736-C-A ***
13219025-C-A 11063349-C-A ***
13725050-T-C 11569374-T-C ***
11648583-G-T ***
13940928-A-G 11820222-A-G ***
14432390-C-A 12311663-C-A ***
14704286-ATATAT-A 12592352-ATATAT-A 4×TATAT***
14875621-GA-G 12763691-GA-G ***
15045722-C-A 12933812-C-A ***
16188181-CTTTT-C,CTT 14076301-CTTTT-C,CTT 16×T***
16226397-T-A 14114517-T-A ***
16938218-CTTT-C,CTT 14826338-CTTT-C,CTT 19×T***
19113759-T-G 17001879-T-G ***
21456074-T-C 19294188-T-C ***
21555222-C-T 19393336-C-T ***
21905326-T-C 19743440-T-C ***
22255186-C-A 20093300-C-A DYZ19 ***
22809997-C-A 20648111-C-A ***
22965169-G-T 20803283-G-T ***
28798928-C-A 26652781-C-A ***
56825909-CCATTCCAATC-C,CCATTCCAGTG ***
19263496-GA-G,GAA 17151616-GA-G,GAA 14×A***
5948945-C-T 6080904-C-T ***
2665141-C-CAA 2797100-C-CAA 19×A***
26500516-C-A 24354369-C-A P1_Y1 ***
2810465-A-G 2942424-A-G ***
7338335-T-C 7470294-T-C ***
7338341-A-T 7470300-A-T ***
9063177-A-G 9225568-A-G ***
9799134-CAAAA-C,CAA 9961525-CAAAA-C,CAA 24×A***
15270843-C-T 13158932-C-T ***
16401972-T-C 14290092-T-C ***
17061141-A-G 14949261-A-G ***
18147638-A-G 16035758-A-G ***
21224779-A-AT,ATT 19062893-A-AT,ATT 19×T***
22538326-A-G 20376440-A-G ***
23290190-A-G 21128304-A-G ***
24388604-T-C 22242457-T-C ***
24873582-A-G 22727435-A-G g1 ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Mutation Notes:

Kit POSITION-REF-ALT (hg19) POSITION-REF-ALT (hg38) Note
Manual23311147-T-TTTTC21149261-T-TTTTCThis is an STR which has 15 repeats of TTTC in the reference sequence. 7 reads cover the insertion and all are positive. One of them only shows that there is an insertion and not the true count.
Manual18890563-G-GGAAA16778683-G-GGAAAJust one read covers this region, but it is positive.
Manual14418140-GTATATATATATGTATATATATA-G12297437-G-.6 reads show the apparent deletion.
Manual16242632-T-TTCTA14130752-T-TTCTA85 reads total cover the region. 3 match the reference sequence, 1 poorly matches and all the rest show the insertion.
Manual16050909-CCTTTCTTT-C13939029-CCTTTCTTT-C4 reads cover the region and all show the deletion.
Manual13128633-A-C10618119-A-C3C
Manual15452508-G-A13340628-G-A3A
Manual20007955-A-G17896075-A-G4A 1G