Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > DF21/S192 > FGC3213 > ZZ1 > S3058 > S424 > S426 > S190 > FGC3215 > FGC3216 > FGC3197 > Y82590

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19)	POS-REF-ALT (hg38)	Blocks	Names	Region	McDonald BED	combBED	STR	FTDNA B91977	BigY3 B91977	BigY2 B91977	Manual Edits
20564591-A-G	18402705-A-G			P5_Dst					A+
6267716-G-A	6399675-G-A			IR3_Dst						A*
	10958323-C-A									A*
20911257-G-T	18749371-G-T			P4_Dst						A*
	10691273-A-T								A*
20881817-G-T	18719931-G-T			P4_Dst						A*
20500932-A-G	18339046-A-G			P5_Dst						A*
19965412-G-C	17853532-G-C			P5_Prx						A*
19860888-C-A	17749008-C-A			P5_Prx						A*
28817231-G-C	26671084-G-C								A*	A*
19938615-T-A	17826735-T-A			P5_Prx						A*
19928923-C-A	17817043-C-A			P5_Prx						A*
19888269-G-C	17776389-G-C			P5_Prx				***	A*	A*
19875050-A-G	17763170-A-G			P5_Prx				***	A*	A*
16135818-T-C	14023938-T-C			P8_Dst						A*
18369786-G-A	16257906-G-A			P6_Prx						A*
14604582-G-T	12492784-G-T				Y	Y				A*
20434742-C-T	18272856-C-T			P5_Dst						A*
23544867-A-T	21382981-A-T				Y	Y				A*
20230120-C-A	18068234-C-A			P5_Dst						A*
18534191-C-A	16422311-C-A			P6_Dst						A*
	10958313-C-T									A*
20516480-G-A	18354594-G-A		BY212189	P5_Dst					A*
20881854-C-A	18719968-C-A			P4_Dst						A*
19615179-T-C	17503299-T-C			P5_Prx	Y				A*	A*
8018418-C-G	8150377-C-G		Y85611		Y	Y		+	+	+
8684020-T-C	8815979-T-C		Y87719		Y	Y		+	+	+
13208441-C-T	11052765-C-T		BY84391					+	+	+
16850211-A-AT	14738331-A-AT						9×T	+	*	+
19220443-C-T	17108563-C-T		Y104047		Y	Y		+	+	+
26170423-AAAGAAG-A	24024276-AAAGAAG-A			P1_Y1			9×AAG			+
21093670-C-T	18931784-C-T	Y16482	FGC20766		Y	Y		+	+	+
22095584-A-G	19933698-A-G		Y108376		Y	Y		+	+	+
3646481-A-G	3778440-A-G		FT82556						+
22255187-A-G	20093301-A-G			DYZ19						*
18149562-A-AATAG	16037682-A-AATAG						7×ATAG		*	***
	10820388-C-G									**
	10950862-G-T									**
	10948297-TTTCCA-T									**
	10857933-C-A									**
	10906306-A-G									**
	10883495-C-A									**
	10909782-G-A									**
	10955380-C-A									**
	10906297-G-C									**
	10906295-T-A									**
	10909781-C-G									**
	10629062-C-T								**
13492805-C-A	11337129-C-A									**
	10959454-C-A									**
26236655-A-AG	24090508-A-AG			P1_Y1						**
21491229-G-T	19329343-G-T									**
20793460-A-ATG	18631574-A-ATG			P4_Prx						**
20793457-T-TACGA	18631571-T-TACGA			P4_Prx						**
20762286-G-T	18600400-G-T			P4_Prx						**
20617738-A-AG	18455852-A-AG			P4_Prx						**
20617712-C-G	18455826-C-G			P4_Prx						**
19794094-A-AT	17682214-A-AT			P5_Prx						**
23789372-C-A	21627486-C-A									**
24247415-ACAC-A	22101268-ACAC-A			P3_b1						**
25881897-C-A	23735750-C-A			P1_Y1						**
14742010-G-T	12630078-G-T									**
	27432-C-A									**
27791980-GCTTCTT-G	25645833-GCTTCTT-G			P1_Y2			9×CTT		**	**
14669825-C-A	12557891-C-A									**
28691447-CAA-C	26545300-CAA-C						16×A			**
	11672007-AGGAATGGAGTTGAAAG-A									**
	11649211-A-G									**
	10799635-C-T									**
	56844531-G-A									**
	11018280-T-C									**
	11018266-T-G									**
	11018261-T-TCCACA									**
	10820365-G-T		FT189855							**
13482735-T-C	11327059-T-C								**
	10799630-C-T									**
6146366-TA-T	6278325-TA-T			IR3_Dst					**
16217902-A-T	14106022-A-T		FGC3655						**
4168842-G-T	4300801-G-T									**
3508383-G-T	3640342-G-T									**
3174563-G-T	3306522-G-T								**
21363090-CAAAA-C	19201204-CAAAA-C						16×A			**
	10799617-C-G									**
6444855-TATATACAC-T	6576814-TATATACAC-T								**
6444846-A-T	6576805-A-T									**
58994973-G-T	56848826-G-T									**
17083100-A-G	14971220-A-G								**
17923376-A-G	15811496-A-G								**
3331462-AAT-A	3463421-AAT-A						8×AT		**
21277661-T-C	19115775-T-C								**
21498793-A-G	19336907-A-G								**
6123454-T-C	6255413-T-C									**
4098769-A-G	4230728-A-G								**
6929185-G-T	7061144-G-T									**
	10668611-C-T									**
	10799609-C-G									**
	10799608-T-A									**
	10779299-A-G									**
	10745124-C-A									**
7156759-C-A	7288718-C-A									**
22801867-A-G	20639981-A-G									**
	10652856-A-G									**
7464019-C-A	7595978-C-A			IR1_L						**
13482737-T-A	11327061-T-A								**
7866781-TGTC-T	7998740-TGTC-T									**
7257366-C-A	7389325-C-A									**
22809997-C-A	20648111-C-A									***
24388604-T-C	22242457-T-C								***
22965169-G-T	20803283-G-T									***
23290190-A-G	21128304-A-G								***
22538326-A-G	20376440-A-G								***
19263496-GA-G,GAA	17151616-GA-G,GAA						14×A		***
21224779-A-AT,ATT	19062893-A-AT,ATT						19×T		***
18147638-A-G	16035758-A-G								***
5948945-C-T	6080904-C-T								***
2810465-A-G	2942424-A-G								***
	56825909-CCATTCCAATC-C,CCATTCCAGTG									***
2665141-C-CAA	2797100-C-CAA						19×A		***
17061141-A-G	14949261-A-G								***
16401972-T-C	14290092-T-C								***
9799134-CAAAA-C,CAA	9961525-CAAAA-C,CAA						24×A		***
9063177-A-G	9225568-A-G								***
7338341-A-T	7470300-A-T								***
28798928-C-A	26652781-C-A									***
7338335-T-C	7470294-T-C								***
26500516-C-A	24354369-C-A			P1_Y1					***
15270843-C-T	13158932-C-T								***
	10985079-T-C									***
22255186-C-A	20093300-C-A			DYZ19						***
18196521-G-T	16084641-G-T									***
7166637-TATA-T,TATT	7298596-TATA-T,TATT									***
6523677-G-A	6655636-G-A		FT366837							***
5937226-CTCTCTCTCTCTCTCTCTATA-C,CTCTCTCTCTCTCTCTATATA	6069185-CTCTCTCTCTCTCTCTCTATA-C,CTCTCTCTCTCTCTCTATATA									***
4957988-CT-C	5089947-CT-C									***
4616749-C-A	4748708-C-A									***
13446608-CT-C	11290932-CT-C									***
13446606-A-AC	11290930-A-AC									***
14339106-CTTTTTT-C	12218401-CTTTTTT-C						19×T		***
25131712-C-T	22985565-C-T			g1				***
25052749-C-G	22906602-C-G			g1				***
24105803-G-A	21959656-G-A			P3_b1				***
23656776-T-C	21494890-T-C							***
13832302-A-G	11711596-A-G							***
22503002-C-G	20341116-C-G			DYZ19				***
7311543-T-C	7443502-T-C									***
9218522-TTGTGTGTG-T	9380913-TTGTGTGTG-T						12×TG	***
4376142-CAAAAAA-C	4508101-CAAAAAA-C						26×A		***
20434723-C-A	18272837-C-A			P5_Dst						***
13481943-G-A	11326267-G-A							***
13940936-C-G	11820230-C-G									***
19113763-C-T	17001883-C-T									***
7811508-A-G	7943467-A-G	DC96	Z1370					***
25134627-T-C	22988480-T-C		BY28190	g1				***
25134616-G-C	22988469-G-C		BY28189	g1				***
25134615-G-C	22988468-G-C		BY28188	g1				***
25134613-C-T	22988466-C-T		BY28187	g1				***
25134610-G-A	22988463-G-A		BY28186	g1				***
7811532-C-T	7943491-C-T		Z12229					***
7255997-G-T	7387956-G-T									***
7359830-A-G	7491789-A-G									***
21905326-T-C	19743440-T-C									***
13219025-C-A	11063349-C-A									***
21555222-C-T	19393336-C-T									***
21456074-T-C	19294188-T-C									***
19113759-T-G	17001879-T-G									***
16938218-CTTT-C,CTT	14826338-CTTT-C,CTT						19×T			***
16226397-T-A	14114517-T-A									***
16188181-CTTTT-C,CTT	14076301-CTTTT-C,CTT						16×T			***
15045722-C-A	12933812-C-A									***
14875621-GA-G	12763691-GA-G									***
14704286-ATATAT-A	12592352-ATATAT-A						4×TATAT			***
14432390-C-A	12311663-C-A									***
13940928-A-G	11820222-A-G									***
	11648583-G-T									***
13725050-T-C	11569374-T-C									***
	10986736-C-A									***
7664291-C-A	7796250-C-A		FT167463							***
22723386-C-CAA	20561500-C-CAA						17×A		***
	10936776-G-T									***
	10898275-C-A									***
	10892561-T-C									***
	10892544-A-ATTCGGGTTGTTTGCT									***
	10851005-C-A									***
	10747023-C-CAGGTTA									***
	10685596-G-T									***
	10669417-T-TA									***
	10660894-C-CCATTCCATTCCACTA									***
	10652618-C-A									***
9771906-G-T	9934297-G-T									***
8274069-C-A	8406028-C-A									***
24873582-A-G	22727435-A-G			g1					***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Mutation Notes:

Kit	POSITION-REF-ALT (hg19)	POSITION-REF-ALT (hg38)	Note
Manual	23311147-T-TTTTC	21149261-T-TTTTC	This is an STR which has 15 repeats of TTTC in the reference sequence. 7 reads cover the insertion and all are positive. One of them only shows that there is an insertion and not the true count.
Manual	18890563-G-GGAAA	16778683-G-GGAAA	Just one read covers this region, but it is positive.
Manual	14418140-GTATATATATATGTATATATATA-G	12297437-G-.	6 reads show the apparent deletion.
Manual	16242632-T-TTCTA	14130752-T-TTCTA	85 reads total cover the region. 3 match the reference sequence, 1 poorly matches and all the rest show the insertion.
Manual	16050909-CCTTTCTTT-C	13939029-CCTTTCTTT-C	4 reads cover the region and all show the deletion.
Manual	13128633-A-C	10618119-A-C	3C
Manual	15452508-G-A	13340628-G-A	3A
Manual	20007955-A-G	17896075-A-G	4A 1G

Haplotype Progression

The data below reveals the progression of changes in the haplotype. The bottom row is the haplotype for this man and above him are the inferred ancestral haplotypes for various upstream blocks. These inferred haplotypes are very much a work in progress, and any suggested modifications are appreciated. I think we can use our vast collection of haplotype data to refine these haplotypes. Mutations made from each upstream block are shown in sequence. The cell color is determined by the block in which the mutation took place.

	DYS393	DYS390	DYS19	DYS391	DYS385	DYS426	DYS388	DYS439	DYS389i	DYS392	DYS389ii	DYS458	DYS459	DYS455	DYS454	DYS447	DYS437	DYS448	DYS449	DYS464	DYS460	Y-GATA-H4	YCAII	DYS456	DYS607	DYS576	DYS570	CDY	DYS442	DYS438	DYS531	DYS578	DYF395S1	DYS590	DYS537	DYS641	DYS472	DYF406S1	DYS511	DYS425	DYS413	DYS557	DYS594	DYS436	DYS490	DYS534	DYS450	DYS444	DYS481	DYS520	DYS446	DYS617	DYS568	DYS487	DYS572	DYS640	DYS492	DYS565	DYS710	DYS485	DYS632	DYS495	DYS540	DYS714	DYS716	DYS717	DYS505	DYS556	DYS549	DYS589	DYS522	DYS494	DYS533	DYS636	DYS575	DYS638	DYS462	DYS452	DYS445	Y-GATA-A10	DYS463	DYS441	Y-GGAAT-1B07	DYS525	DYS712	DYS593	DYS650	DYS532	DYS715	DYS504	DYS513	DYS561	DYS552	DYS726	DYS635	DYS587	DYS643	DYS497	DYS510	DYS434	DYS461	DYS435	FTY371	FTY303	FTY10	FTY284	FTY219	FTY324	FTY327	FTY394	DYS538	FTY220	FTY254	FTY19	FTY4	DYS577	FTY24	FTY346	FTY160	FTY62	FTY400	FTY114	FTY246	FTY26	FTY368	FTY173	FTY209	FTY337	FTY81	FTY387	FTY361	FTY330	FTY65	FTY168	FTY171	FTY136	FTY53	FTY40	FTY386	FTY100	FTY152	FTY55	FTY297	FTY370	FTY103	FTY64	FTY174	FTY313	FTY362	FTY342	FTY161	FTY374	FTY316	FTY101	FTY204	DYS477	FTY192	DYS502	FTY341	DYS493	FTY1	FTY227	DYS499	FTY391	FTY353	FTY332	FTY163	DYS483	FTY172	FTY180	DYS581	FTY179	FTY188	FTY369	FTY70	FTY63	DYS508	FTY347	FTY83	FTY277	FTY276	FTY195	FTY109	FTY356	FTY215	FTY105	FTY123	FTY242	FTY214	FTY132	FTY262	FTY333	FTY208	DYF398B	FTY43	FTY166	FTY13	FTY11	DYS584	DYS608	FTY95	FTY151	FTY388	FTY256	DYS580	FTY234	FTY268	FTY139	FTY27	FTY75	DYS512	FTY329	FTY320	FTY7	FTY247	FTY211	DYS474	FTY39	FTY376	FTY37	FTY373	DYS475	FTY138	FTY288	FTY264	FTY93	FTY380	FTY18	FTY115	DYS569	FTY390	FTY46	FTY243	FTY322	FTY281	FTY153	FTY181	FTY184	FTY359	FTY121	FTY74	FTY279	DYS530	FTY45	DYS573	DYS542	FTY36	FTY304	FTY203	FTY291	FTY142	FTY191	FTY183	FTY141	FTY299	FTY193	FTY124	FTY16	FTY236	FTY185	FTY378	FTY225	FTY397	FTY3	FTY67	FTY182	FTY334	DYS623	FTY348	FTY357	FTY275	FTY306	FTY383	FTY253	FTY285	DYS645	FTY17	FTY85	DYS598	FTY375	FTY325	FTY12	FTY365	FTY35	FTY237	FTY238	FTY305	FTY56	FTY129	FTY352	FTY292	FTY154	DYS539	FTY301	FTY366	FTY231	DYS618	FTY216	FTY82	FTY393	FTY155	FTY68	FTY32	FTY265	FTY300	FTY143	FTY201	FTY199	FTY86	FTY98	FTY144	DYS541	DYS507	FTY20	FTY116	FTY308	FTY177	FTY89	FTY158	FTY22	FTY84	FTY186	FTY396	FTY91	FTY29	FTY78	FTY229	FTY260	FTY250	FTY364	DYS476	FTY221	FTY57	FTY377	FTY384	DYS466	FTY363	FTY137	FTY69	FTY72	FTY251	FTY2	FTY217	FTY257	FTY120	FTY25	FTY252	FTY33	FTY42	FTY54	FTY372	DYS480	FTY176	FTY76	FTY66	FTY197	FTY385	FTY270	FTY298	FTY198	FTY117	DYS544	FTY159	FTY232	FTY156	FTY343	FTY296	FTY311	FTY344	FTY178	FTY367	FTY73	FTY112	FTY295	DYS616	FTY338	FTY196	FTY157	FTY162	DYS551	FTY148	FTY94	FTY52	FTY131	FTY9	FTY194	FTY8	FTY318	FTY317	FTY99	FTY289	FTY169	FTY51	FTY345	FTY398	FTY111	FTY273	FTY382	FTY47	FTY30	FTY147	DYS615	FTY302	FTY354	FTY326	FTY88	FTY248	FTY267	FTY170	FTY60	DYS453	FTY249	FTY167	DYS624	FTY134	FTY235	FTY145	FTY14	FTY80	FTY50	DYS514	FTY340	DYS585	DYS516	FTY293	FTY207	FTY278	FTY210	DYS523	FTY269	FTY530	FTY1156	FTY1070	FTY906	FTY1004	FTY331	FTY31	FTY226	FTY335	DYS583	FTY339	FTY113	FTY280	FTY255	FTY59	DYS620	FTY349	FTY130	FTY119	DYF398A	FTY58	FTY127	FTY321	FTY92	FTY392	DYF392	FTY290	FTY312	FTY135	FTY150	FTY294	FTY244	FTY48	FTY282	DYS489	FTY272	FTY239	FTY258	FTY49	DYS574	FTY41	FTY905	FTY1103	FTY502	FTY743	FTY443	FTY670	FTY883	DYS631	FTY1042	FTY510	DYS389B	FTY512	FTY837	DYS642	FTY407	FTY935	FTY563	FTY1016	FTY1091	FTY1049	FTY1155	DYS602	FTY587	FTY635	FTY904	DYS543	FTY1148	FTY861	FTY742	FTY433	FTY1039	FTY71	FTY259	FTY108	FTY336	FTY44	FTY233	FTY274	FTY34	FTY942	FTY1068	FTY945	FTY1051	FTY658	FTY625	FTY800	FTY818	FTY971	FTY509	FTY1025	FTY835	FTY984	DYS637	FTY832	FTY689	FTY998	FTY520	FTY445	FTY809	FTY428	FTY562	FTY897	FTY1064	FTY1088	FTY1052	DYF405	FTY310	FTY189	DYS488	FTY283	FTY28	FTY578	DYS484	FTY858	FTY596	FTY915	FTY446	FTY452	FTY1006	FTY612	FTY507	FTY614	FTY824	FTY1055	FTY690	FTY2318	FTY981	FTY946	FTY1040	DYS718	FTY15	FTY2025	DYS685u1	DYS596u5	FTY1511	FTY769	FTY923	FTY1167	FTY415	FTY505	FTY241	FTY2263	FTY517	FTY2180	FTY775	DYS567	FTY444	FTY691	FTY1120	FTY223	DYF393u3	FTY1850	FTY645	FTY696	FTY1166	FTY991	FTY912	DYS551u4	FTY447	DYS518u3	FTY875	DYS536u1	FTY585	FTY896	FTY731	FTY401	FTY2011	FTY665	FTY814	FTY2050	DYS626u3	FTY750	FTY471	FTY985	FTY589	FTY420	FTY921	FTY457	FTY657	FTY1110	FTY485	FTY315	FTY1852	FTY1107	FTY489	FTY522	FTY654	FTY110	FTY881	DYS470	FTY534	FTY1101	FTY1933	FTY936	FTY772	FTY1047	FTY2351	FTY680	FTY2254	FTY1030	FTY2083	FTY287	FTY797	FTY2366	FTY951	FTY774	FTY1116	DYS621	FTY885	FTY1012	DYF394u1	FTY888	FTY648	FTY725	FTY643	FTY927	FTY1022	DYS559	FTY933	FTY633	FTY900	FTY1848	FTY478	FTY533	FTY467	FTY1900	FTY421	DYS612u5	DYS595	FTY668	FTY1028	DYS579	FTY646	FTY1026	FTY801	FTY432	FTY2301	FTY466	FTY531	FTY1083	FTY997	FTY1114	FTY830	FTY655	FTY910	FTY1143	FTY572	DYS506	DYS558u2	FTY1127	FTY712	FTY634	FTY499	FTY1094	FTY724	FTY535	FTY552	FTY430	FTY588	DYS609	FTY961	FTY813	FTY656	FTY839	FTY882	FTY789	FTY459	FTY1037	FTY435	FTY1157	FTY1546	FTY2242	FTY720	DYS614u10	FTY887	FTY473	FTY816	FTY1060	FTY472	FTY943	FTY1482	FTY565	DYS629	FTY891	FTY438	DYS582	FTY468	FTY649	FTY606	FTY792	FTY1087	FTY895	DYS614u3	FTY574	FTY1556	FTY560	FTY694	FTY1097	DYS518u6	FTY876	FTY2443	FTY990	FTY934	FTY465	FTY1046	FTY1312	FTY751	FTY1915	FTY678	FTY419	FTY958	FTY456	DYS592u1	FTY1172	FTY416	FTY650	FTY808	FTY1542	DYS721u1	FTY746	FTY2233	FTY892	FTY845	FTY1034	FTY498	DYF382u1	FTY637	DYS588	FTY947	DYS543u3	FTY644	DYS703	DYS649	FTY212	FTY781	FTY1106	FTY592	FTY848	FTY940	FTY903	FTY1081	FTY952	DYS706u2	FTY1084	FTY700	FTY482	DYS625u7	FTY960	FTY586	FTY1330	FTY1119	FTY1762	FTY1010	FTY417	FTY716	DYS627u3	FTY1942	FTY1067	FTY841	FTY1031	FTY1082	FTY1023	FTY475	FTY222	FTY962	FTY423	FTY664	DYS517u1	FTY1076	FTY1557	FTY1154	DYS681	FTY1002	DYS706u1	FTY1174	FTY986	FTY651	FTY886	FTY1078	DYS546u4	FTY1092	FTY2471	FTY1111	FTY461	FTY323	FTY1013	FTY506	FTY550	FTY767	FTY721	DYS548	FTY559	DYS705	FTY640	FTY613	FTY402	FTY2426	FTY755
P312/S116	13	24	14	11	11-14	12	12	12	13	13	29	17	9-10	11	11	25	15	19	29	15-15-17-17	11	11	19-23	16	15	18	17	36-38	12	12	11	9	15-16	8	10	10	8	10	10	12	23-23	16	10	12	12	15	8	12	22	20	13	12	11	13	11	11	12	12	33	15	9	16	12	26	26	19	12	11	13	12	10	9	12	12	10	11	11	30	12	13	24	13	10	10	20	15	19	13	24	17	12	15	24	12	23	18	10	14	17	9	12	11
L21/S145	13	24	14	11	11-14	12	12	12	13	13	29	17	9-10	11	11	25	15	19	29	15-15-17-17	11	11	19-23	16	15	18	17	36-38	12	12	11	9	15-16	8	10	10	8	10	10	12	23-23	16	10	12	12	15	8	12	22	20	13	12	11	13	11	11	12	12	35	15	9	16	12	25	26	19	12	11	13	12	11	9	12	12	10	11	11	30	12	13	24	13	10	10	20	15	19	13	24	17	12	15	24	12	23	18	10	14	17	9	12	11
DF21/S192	13	24	14	11	11-14	12	12	12	13	13	29	17	9-10	11	11	25	15	19	29	15-15-17-17	11	11	19-23	16	15	18	18	36-38	12	12	11	9	15-16	8	10	10	8	10	10	12	23-23	16	10	12	12	15	8	12	22	20	13	12	11	13	11	11	12	12	35	15	9	16	12	25	26	19	12	11	13	12	11	9	12	12	10	11	11	30	12	13	24	13	10	10	20	15	19	13	24	17	12	15	24	12	23	18	10	14	17	9	12	11
S3058	13	24	14	10	11-14	12	12	12	13	13	29	17	9-10	11	11	25	15	19	29	15-15-17-17	11	11	19-23	16	15	18	18	36-38	12	12	11	9	15-16	8	10	10	8	10	10	12	23-23	16	10	12	12	15	8	12	22	20	13	12	11	13	11	11	12	12	35	15	9	16	12	25	26	19	12	11	12	12	11	9	12	12	10	11	11	30	12	13	24	13	10	10	20	15	19	13	24	17	12	15	24	12	23	18	10	14	17	9	12	11
S426	13	24	14	10	11-14	12	12	12	13	13	29	17	9-10	11	11	25	15	19	30	15-15-17-17	11	10	19-23	16	15	18	18	38-38	12	12	11	9	15-16	9	10	10	8	10	10	12	22-23	16	10	12	12	15	8	11	22	20	14	12	11	13	11	11	12	12	31	15	9	15	12	25	26	19	13	11	12	12	11	9	12	12	10	11	11	30	12	13	24	13	10	10	20	15	19	13	23	17	12	15	24	12	23	18	10	14	17	9	12	11
S190	13	24	14	10	11-14	12	12	12	13	13	29	17	9-10	11	11	25	15	19	30	13-15-17-17	11	10	19-23	16	15	18	18	38-38	12	12	11	9	15-16	9	10	10	8	10	10	12	22-23	16	10	12	12	15	8	11	22	20	14	12	11	13	11	11	12	12	31	15	9	15	12	25	26	20	13	11	12	12	11	9	12	12	10	11	11	30	12	13	24	13	10	10	20	15	19	13	23	17	12	15	24	12	23	18	10	14	17	9	12	11
FGC3215	13	24	14	10	11-14	12	12	12	13	13	29	18	9-10	11	11	25	15	19	30	13-15-17-17	11	10	19-23	16	15	18	18	38-38	12	12	11	9	15-16	9	10	10	8	10	10	12	22-23	16	10	12	12	15	8	11	22	20	14	12	11	13	11	11	12	12	31	15	9	15	12	25	26	20	13	11	12	12	11	9	12	12	10	11	11	30	12	13	24	13	10	10	20	15	19	13	23	17	12	15	24	12	23	18	10	14	17	9	12	11
FGC3197	13	24	14	10	11-14	12	12	12	13	13	29	18	9-10	11	11	25	15	19	30	13-15-17-17	11	10	19-23	16	15	18	18	38-38	12	12	11	9	15-16	9	10	10	8	10	10	12	22-23	16	10	12	12	15	8	11	22	20	14	12	11	13	11	11	12	12	31	15	9	15	12	25	26	20	13	11	12	12	11	9	13	12	10	11	11	30	12	13	24	13	10	10	20	15	19	14	23	17	12	15	24	12	23	18	10	14	17	9	12	11
McKendrick	13	24	14	11	11-14	12	12	12	13	13	29	18	9-10	11	11	26	15	19	30	13-15-16-16	11	10	19-23	16	15	18	18	38-38	12	12	11	9	15-16	9	11	10	8	10	10	12	22-23	16	10	12	12	15	8	11	22	20	14	12	11	13	11	11	12	12	31	15	9	15	12	26	26	20	13	11	13	12	11	9	13	12	10	11	11	30	12	12	24	13	10	10	19	15	19	14	23	16	12	15	24	12	23	18	10	14	17	9	12	11

Age Analysis Information (work in progress)

	All	McDonald	YFull
Kit: B91977	10805771	7847747	7938558
Kit: B91977	9901985	8021629	7895840
Kit: B91977	14871318	9323064	8269461
Used in age calculations	14871318	9323064	8269461
Counts of SNPs		8	7

Variant counts last updated 2023-01-24 03:20:36.

---

Big Tree Main Page