Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > FGC11134 > A353 > Z16250 > A114 > CTS4466/S1136 > S1115 > A541 > Z21065 > A195 > A761 > A88 > ZZ70 > Z16258 > A10727

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
274113
BigY2
27413
Manual
Edits
25994226-C-CT 23848079-C-CT P1_Y1 9×TA*
26156496-T-C 24010349-T-C P1_Y1 ***A*
25981407-G-GA 23835260-G-GA P1_Y1 9×AA*
19909884-A-G 17798004-A-G P5_Prx ***A*
19164330-A-T 17052450-A-T BY126871 Y++
23075192-G-A 20913306-G-A BY142823 YY++
19079985-T-C 16968105-T-C BY126100 YY++
14813318-G-C 12701389-G-C BY97737 YY++
14218230-C-T 12097524-C-T BY93995 YY++
9406769-G-A 9569160-G-A BY79271 YY++
8534240-T-C 8666199-T-C BY73764 YY++
7071549-T-C 7203508-T-C BY63189 YY++
11653009-C-G **
11659093-A-T **
11659438-C-A **
11670840-A-G **
11671085-T-A **
11653007-A-C **
56880331-A-T **
13888797-A-G 11768091-A-G **
11652974-G-A **
13925149-A-G 11804443-A-G **
13938395-C-A 11817689-C-A **
13939831-A-C 11819125-A-C **
13993601-C-T 11872895-C-T **
14032430-C-A 11911724-C-A **
11652994-G-T **
11652968-A-T **
11652969-G-A **
13442457-T-C 11286781-T-C **
11034191-T-G **
13196802-A-G 11041126-A-G **
13199037-C-A 11043361-C-A **
13226236-T-C 11070560-T-C **
13252868-C-A 11097192-C-A **
13289365-C-A 11133689-C-A **
13296039-A-G 11140363-A-G **
13320641-C-A 11164965-C-A **
13322515-A-G 11166839-A-G **
13358997-G-A 11203321-G-A **
13421706-C-A 11266030-C-A **
13469557-C-T 11313881-C-T **
14107014-G-C 11986308-G-C **
13486651-G-T 11330975-G-T **
13496820-T-C 11341144-T-C **
13516728-C-A 11361052-C-A **
13528902-A-G 11373226-A-G **
13544865-C-A 11389189-C-A **
13605803-T-C 11450127-T-C **
13617557-C-T 11461881-C-T **
13633840-A-G 11478164-A-G **
11648662-G-T **
11648663-G-CTGATGCATC **
11648665-A-C **
14059401-T-G 11938695-T-G **
14253128-A-G 12132422-A-G **
14107083-A-G 11986377-A-G **
15278947-C-T 13167046-C-T **
15045554-C-A 12933644-C-A **
15060719-C-T 12948811-C-T **
15098167-T-C 12986255-T-C **
15109626-C-A 12997713-C-A **
15193486-G-T 13081572-G-T **
15193489-T-C 13081575-T-C **
15193512-C-T 13081598-C-T **
15218610-G-C 13106696-G-C **
15284373-G-T 13172472-G-T **
14988834-G-A 12876900-G-A **
15332374-A-G 13220492-A-G **
15557999-A-G 13446119-A-G **
15643028-T-A 13531148-T-A **
15653424-A-T 13541544-A-T **
15686724-TG-T 13574844-TG-T **
15687814-A-T 13575934-A-T **
15699116-A-G 13587236-A-G **
15769422-T-G 13657542-T-G **
15823910-C-T 13712030-C-T **
15012733-C-A 12900821-C-A **
14933545-C-A 12821610-C-A **
14159735-T-G 12039029-T-G **
14422607-T-A 12301882-T-A **
14159774-C-T 12039068-C-T **
14225308-A-G 12104602-A-G **
14247382-A-G 12126676-A-G **
11013315-C-A **
14295272-T-C 12174566-T-C **
14295401-C-T 12174695-C-T **
14352324-C-A 12231619-C-A **
14371338-G-A 12250634-G-A **
14427178-A-T 12306453-A-T **
14908475-C-A 12796542-C-A **
14431262-T-C 12310535-T-C **
14463551-G-A 12342824-G-A **
14546781-A-G 12434982-A-G **
14584781-C-A 12472981-C-A **
14586151-G-T 12474351-G-T **
14620601-C-A 12508799-C-A **
14725235-C-A 12613303-C-A **
14786530-T-C 12674600-T-C **
14858874-A-C 12746940-A-C **
11022533-C-A **
10977865-C-A **
11001301-C-A **
9934939-A-G 10097330-A-G **
8074204-G-A 8206163-G-A **
8481330-A-G 8613289-A-G **
8481386-T-G 8613345-T-G **
8481957-C-A 8613916-C-A **
8712214-G-C 8844173-G-C **
9116869-G-T 9279260-G-T **
9499221-C-G 9661612-C-G **
9664404-C-A 9826795-C-A IR3_Prx **
9938875-C-A 10101266-C-A **
8052380-T-A 8184339-T-A **
9953050-C-G 10115441-C-G **
9987678-T-C 10150069-T-C **
10018065-T-C 10180456-T-C **
10022959-C-A 10185350-C-A **
10094307-C-A 10256698-C-A **
10651685-C-G **
10654231-C-T **
10664284-C-A **
8058341-C-A 8190300-C-A **
7991024-C-A 8122983-C-A **
10673139-C-T **
7258881-A-G 7390840-A-G **
7109503-C-A 7241462-C-A **
7110642-C-A 7242601-C-A **
7138397-C-A 7270356-C-A **
7186475-A-C 7318434-A-C **
7197427-C-G 7329386-C-G **
7235372-A-T 7367331-A-T **
7252390-AAC-A 7384349-AAC-A **
7254974-C-A 7386933-C-A **
7277490-C-A 7409449-C-A **
7897079-T-G 8029038-T-G **
7360546-C-G 7492505-C-G **
7381298-G-C 7513257-G-C **
7381354-T-A 7513313-T-A **
7420700-T-G 7552659-T-G **
7579068-C-A 7711027-C-A **
7753519-G-A 7885478-G-A FGC56171 **
7755118-C-A 7887077-C-A **
7864250-C-T 7996209-C-T **
7873868-A-AT 8005827-A-AT **
10664597-T-A **
10683429-C-A **
11000101-C-A **
10932515-C-CTTTG **
10889393-C-T **
10902276-C-G **
10912012-A-G **
10912013-C-G **
10917669-G-T **
10924231-T-A **
10926240-C-G **
10926439-T-A **
10940170-T-C **
10883821-A-C **
10943242-C-A **
10956593-C-CTT **
10956594-CAT-C **
10967753-C-A **
15842977-T-C 13731097-T-C **
10987519-C-T **
10992254-T-C **
10998421-C-A **
10998423-T-C **
10883851-A-C **
10878073-T-A **
10683711-G-A **
10773633-T-C **
10757130-C-T **
10757312-T-G **
10763087-A-ACTCAT **
10765596-C-T **
10766162-T-C **
10766166-T-G **
10766181-T-A **
10766185-C-A **
10785835-C-A **
10868812-C-G **
10789739-T-G **
10801554-C-A **
10825093-T-A **
10827604-C-A **
10835619-G-T **
10838346-A-T **
10861557-C-A **
10867172-C-A **
10867327-C-A **
15842951-A-C 13731071-A-C **
16069871-T-TAA 13957991-T-TAA 11×A**
15842989-A-C 13731109-A-C **
23439050-G-T 21277164-G-T **
22965467-T-A 20803581-T-A **
22986679-T-C 20824793-T-C **
22995280-G-A 20833394-G-A **
23098038-TG-T 20936152-TG-T **
23103100-A-G 20941214-A-G **
23350625-A-AC 21188739-A-AC **
23421015-A-C 21259129-A-C **
23439028-C-G 21277142-C-G **
23447605-A-T 21285719-A-T **
22520568-C-A 20358682-C-A **
23459899-A-T 21298013-A-T **
23570098-T-C 21408212-T-C **
23570115-C-T 21408229-C-T **
23570127-A-C 21408241-A-C **
23570128-T-C 21408242-T-C **
23570149-A-G 21408263-A-G **
23570152-G-T 21408266-G-T **
23570172-CT-C 21408286-CT-C **
22965085-C-A 20803199-C-A **
22520561-G-A 20358675-G-A **
23570183-G-A 21408297-G-A **
21836627-G-A 19674741-G-A **
21672017-T-C 19510131-T-C **
21672069-T-C 19510183-T-C **
21738623-A-G 19576737-A-G **
21738708-G-T 19576822-G-T **
21738710-T-G 19576824-T-G **
21771632-C-A 19609746-C-A **
21828547-T-C 19666661-T-C **
21836512-G-A 19674626-G-A **
21966376-G-T 19804490-G-T **
22517825-T-C 20355939-T-C **
22011297-G-A 19849411-G-A **
22011301-G-A 19849415-G-A **
22011310-G-A 19849424-G-A **
22011321-G-A 19849435-G-A **
22124213-C-A 19962327-C-A **
22130024-G-A 19968138-G-A **
22209609-A-T 20047723-A-T **
22211439-TA-T 20049553-TA-T **
22287118-T-G 20125232-T-G DYZ19 **
23570177-T-C 21408291-T-C **
23886833-TG-T 21724947-TG-T **
21534972-T-C 19373086-T-C **
28722570-C-A 26576423-C-A **
28631652-C-A 26485505-C-A **
28654123-A-C 26507976-A-C **
28654251-A-T 26508104-A-T **
28654266-G-T 26508119-G-T **
28679680-A-G 26533533-A-G **
28697781-A-G 26551634-A-G **
28697837-C-A 26551690-C-A **
28721763-G-T 26575616-G-T **
28725942-A-C 26579795-A-C F26788 **
28591304-CT-C 26445157-CT-C **
28728446-C-A 26582299-C-A **
28731046-C-T 26584899-C-T **
28779751-C-A 26633604-C-A **
28798214-T-A 26652067-T-A **
56822112-G-T **
56825729-G-A **
56835384-T-C **
56836631-C-A **
56846652-A-G **
28591831-C-T 26445684-C-T **
28560164-C-A 26414017-C-A **
24405168-C-A 22259021-C-A **
28097006-T-TG 25950859-T-TG P1_Y2 **
25029894-C-A 22883747-C-A g1 **
26328711-G-A 24182564-G-A P1_Y1 **
26354611-G-A 24208464-G-A P1_Y1 **
27603682-G-T 25457535-G-T P1_Y2 **
27958456-A-G 25812309-A-G P1_Y2 **
28008273-A-C 25862126-A-C P1_Y2 **
28008311-T-C 25862164-T-C P1_Y2 **
28008347-A-C 25862200-A-C P1_Y2 **
28401927-T-G 26255780-T-G P1_gr2 **
28547349-C-T 26401202-C-T **
28481170-C-A 26335023-C-A **
28499370-G-A 26353223-G-A **
28510040-C-A 26363893-C-A **
28518922-T-G 26372775-T-G **
28520523-T-G 26374376-T-G **
28520582-A-G 26374435-A-G **
28521867-C-A 26375720-C-A **
28537103-T-A 26390956-T-A **
28546518-G-T 26400371-G-T **
21671986-C-A 19510100-C-A **
21462553-T-A 19300667-T-A **
15843003-A-C 13731123-A-C **
17038979-A-G 14927099-A-G Z36126 **
16551110-C-A 14439230-C-A **
16662620-G-C 14550740-G-C **
16704835-G-A 14592955-G-A **
16707901-T-A 14596021-T-A **
16904658-TG-T 14792778-TG-T **
16972385-G-C 14860505-G-C **
16989271-C-A 14877391-C-A **
17036790-T-G 14924910-T-G **
17066152-A-C 14954272-A-C **
16467528-C-A 14355648-C-A A15579 **
17159419-C-A 15047539-C-A **
17200108-C-T 15088228-C-T **
17200113-C-T 15088233-C-T **
17244399-G-T 15132519-G-T **
17372383-C-A 15260503-C-A **
17440674-C-A 15328794-C-A **
17466641-G-T 15354761-G-T **
17481464-C-A 15369584-C-A **
16540319-C-T 14428439-C-T **
16466904-G-A 14355024-G-A **
17492071-T-C 15380191-T-C **
16240974-A-C 14129094-A-C **
15919682-G-C 13807802-G-C **
16021526-G-C 13909646-G-C **
16046955-T-G 13935075-T-G **
16055991-C-A 13944111-C-A **
7030928-T-G 7162887-T-G **
16091110-C-A 13979230-C-A **
16148184-T-C 14036304-T-C P8_Dst **
16240924-C-T 14129044-C-T **
16241039-C-T 14129159-C-T **
16465013-T-C 14353133-T-C **
16241060-G-C 14129180-G-C **
16244844-C-T 14132964-C-T **
16270612-C-A 14158732-C-A **
16271828-G-GC 14159948-G-GC **
16395099-C-A 14283219-C-A **
16424653-G-A 14312773-G-A **
16428105-CT-C 14316225-CT-C **
16429069-G-T 14317189-G-T **
16430135-CA-C 14318255-CA-C **
17481470-A-T 15369590-A-T **
17502538-C-A 15390658-C-A **
21417073-G-C 19255187-G-C **
20432886-A-G 18271000-A-G P5_Dst **
19244634-C-A 17132754-C-A **
19394149-G-A 17282269-G-A **
19509926-T-C 17398046-T-C **
19754861-C-T 17642981-C-T P5_Prx **
19873471-G-A 17761591-G-A P5_Prx **
19950182-A-ATGCTGTGTG 17838302-A-ATGCTGTGTG P5_Prx 18×TG**
20004085-T-A 17892205-T-A P5_Prx **
20252944-T-C 18091058-T-C P5_Dst **
21072645-A-C 18910759-A-C **
19187612-G-A 17075732-G-A **
21141224-T-C 18979338-T-C **
21146236-T-C 18984350-T-C **
21152299-C-A 18990413-C-A **
21155098-T-G 18993212-T-G **
21221065-C-T 19059179-C-T **
21240551-C-A 19078665-C-A **
21353070-C-G 19191184-C-G **
21379806-G-C 19217920-G-C **
21409805-G-C 19247919-G-C **
19187644-A-G 17075764-A-G **
19187603-C-T 17075723-C-T **
17535308-C-A 15423428-C-A **
18749256-A-G 16637376-A-G **
17600648-T-C 15488768-T-C **
17605312-G-A 15493432-G-A **
17605390-C-A 15493510-C-A **
17616850-C-A 15504970-C-A **
18042845-C-A 15930965-C-A **
18158552-C-T 16046672-C-T **
18185292-G-A 16073412-G-A **
18398007-AT-A 16286127-AT-A P6_Gap **
18750104-A-G 16638224-A-G **
19187588-G-A 17075708-G-A **
18848668-G-T 16736788-G-T **
18874060-G-C 16762180-G-C **
18926881-A-T 16815001-A-T **
19055667-A-T 16943787-A-T **
19075160-C-T 16963280-C-T **
19075323-C-T 16963443-C-T **
19081413-C-A 16969533-C-A **
19121823-T-C 17009943-T-C **
19137708-T-C 17025828-T-C **
7042663-C-A 7174622-C-A **
7186313-T-C 7318272-T-C **
7013524-A-G 7145483-A-G **
10654755-A-C **
22011484-C-A 19849598-C-A **
28518822-G-T 26372675-G-T **
10971172-TTCCAC-T **
10766152-C-T **
13252851-C-A 11097175-C-A **
2974374-C-A 3106333-C-A **
10780529-C-A **
22011638-C-A 19849752-C-A **
19146602-C-G 17034722-C-G **
10011087-G-T 10173478-G-T **
14490912-C-A 12370181-C-A Y66803 **
10930064-C-T **
10930106-C-A **
13938423-C-A 11817717-C-A **
7100987-G-T 7232946-G-T **
4271273-C-A 4403232-C-A **
23570112-C-A 21408226-C-A **
9507982-CTTTTT-C 9670373-CTTTTT-C 34×T**
22439789-G-C 20277903-G-C DYZ19 **
10830734-C-A **
17115154-ATT-A 15003274-ATT-A 14×T**
10830675-T-TC **
10830684-C-A **
10830686-A-T **
10830719-A-C **
10830720-CTTTCT-C **
10830730-T-A **
10830738-C-T **
20434788-T-G 18272902-T-G P5_Dst **
10830745-T-C **
10830746-G-A **
10684259-T-G **
10684196-T-C **
23007080-T-A 20845194-T-A **
10907666-C-G **
10827525-CATTTCATTTT-C **
18147509-CTT-C 16035629-CTT-C 28×T**
9962391-C-A 10124782-C-A **
10780505-C-T **
13485667-C-A 11329991-C-A **
3889608-C-A 4021567-C-A **
24518265-CA-C 22372118-CA-C **
5937208-A-ATC 6069167-A-ATC 17×TC**
19059744-ATTC-A 16947864-ATTC-A **
7154881-C-A 7286840-C-A **
10988169-C-A **
9962084-C-A 10124475-C-A **
27902197-CTTTTT-C 25756050-CTTTTT-C P1_Y2 34×T**
23802082-CAAA-C 21640196-CAAA-C 24×A**
23035980-G-GA 20874094-G-GA 9×A**
10980072-C-T **
13909304-CAAAA-C 11788598-CAAAA-C 18×A**
5449992-G-T 5581951-G-T **
26355477-C-A 24209330-C-A P1_Y1 **
56847288-C-A **
7095128-T-G 7227087-T-G **
5212742-C-A 5344701-C-A **
11020885-C-T **
14786535-G-A 12674605-G-A **
6465537-CTT-C 6597496-CTT-C 11×T**
10780520-T-A **
3229176-A-G 3361135-A-G **
10780533-C-G **
10780551-C-G **
16039053-C-A 13927173-C-A **
13971609-G-GAGGAAA 11850903-G-GAGGAAA **
18855623-A-T 16743743-A-T **
11653023-C-A **
13217364-T-C 11061688-T-C **
10666916-T-A **
7013515-T-G 7145474-T-G **
11024774-G-A **
22995376-GTT-G 20833490-GTT-G 21×T**
10838331-T-C **
10838333-C-G **
7334019-C-A 7465978-C-A **
10918309-G-T **
16271827-G-A 14159947-G-A **
8734349-C-A 8866308-C-A **
10780588-G-A **
10895765-C-A **
11034117-C-G **
10684266-C-A **
21248567-G-A 19086681-G-A ****
23415308-GTATGTATA-G 21253422-GTATGTATA-G **
8723746-GA-G 8855705-GA-G 14×A**
28742512-A-ATT 26596365-A-ATT 14×T**
14648743-C-T 12536808-C-T S7128 **
10684247-T-A **
10684258-C-T **
10684282-T-G **
13457781-G-C 11302105-G-C **
10684286-T-C **
13705506-G-T 11549830-G-T **
21858259-T-TAA 19696373-T-TAA 14×A**
22011308-T-C 19849422-T-C **
16118600-T-G 14006720-T-G P8_Prx **
11021334-C-A **
17200099-C-T 15088219-C-T **
17200118-A-T 15088238-A-T **
19187600-C-T 17075720-C-T **
13971609-G-A 11850903-G-A **
16656658-CTTT-C 14544778-CTTT-C 14×T**
17081268-A-T 14969388-A-T 9×AT**
13469506-A-G 11313830-A-G **
14858924-A-C 12746990-A-C **
19537954-C-A 17426074-C-A **
5221058-C-T 5353017-C-T **
6419046-A-ATG 6551005-A-ATG 18×TG**
10065044-T-C 10227435-T-C **
10065094-A-T 10227485-A-T **
17081288-AAT-A 14969408-AAT-A 11×AT**
20778781-TTG-T 18616895-TTG-T P4_Prx 18×TG**
17385413-T-A 15273533-T-A **
22215217-C-CTT 20053331-C-CTT 17×T**
13215433-G-A 11059757-G-A **
21054409-C-A 18892523-C-A **
8987706-A-G 9150097-A-G M10738 **
13989061-G-A 11868355-G-A **
3461791-C-A 3593750-C-A **
27499305-T-C 25353158-T-C P1_Y2 **
10937434-C-G **
17212300-T-TA 15100420-T-TA 12×A**
19187624-G-A 17075744-G-A **
9125447-CTTTTTT-C **
11020809-C-A **
11020852-TGCCAC-T **
11020871-A-T **
6040608-CA-C 6172567-CA-C 10×A**
10780587-A-C **
10995800-A-T **
4002431-C-A 4134390-C-A **
13229703-C-A 11074027-C-A **
19300729-C-A 17188849-C-A **
11020459-A-T **
23434314-C-A 21272428-C-A **
6239-T-C **
21836574-C-G 19674688-C-G **
10944211-C-A **
10802392-A-G **
19187607-C-T 17075727-C-T **
19187619-C-T 17075739-C-T **
11020807-T-C **
26204665-A-C 24058518-A-C P1_Y1 **
3252964-C-A 3384923-C-A **
10763057-A-C **
8556313-GTTTT-G 8688272-GTTTT-G 17×T**
13962070-TG-T 11841364-TG-T **
13726114-AGGAAT-A 11570438-AGGAAT-A **
13962075-C-A 11841369-C-A **
23633393-G-T 21471507-G-T **
11020879-T-C **
10677248-A-G **
10763065-C-G **
15397251-G-T 13285371-G-T **
10767471-C-A **
13512918-T-G 11357242-T-G **
4909107-CTT-C 5041066-CTT-C 12×T**
17737891-G-GA 15626011-G-GA 10×A**
10838355-T-A **
5191256-G-T 5323215-G-T **
11025553-C-A **
11025559-C-A **
22253232-G-A 20091346-G-A DYZ19 **
11024780-C-G **
10802400-C-A **
4580422-G-A 4712381-G-A **
4444976-G-T 4576935-G-T **
4523698-C-A 4655657-C-A **
4523808-C-G 4655767-C-G **
4533293-T-A 4665252-T-A **
4540703-C-A 4672662-C-A **
4558081-A-G 4690040-A-G **
4561974-G-T 4693933-G-T **
4670666-T-C 4802625-T-C **
4366499-C-A 4498458-C-A **
4670789-G-A 4802748-G-A **
4672277-C-A 4804236-C-A **
4688865-A-T 4820824-A-T **
4733291-C-A 4865250-C-A **
4756026-C-A 4887985-C-A **
4901474-A-G 5033433-A-G **
4918913-C-T 5050872-C-T **
4926277-T-C 5058236-T-C **
4388632-C-T 4520591-C-T **
23819050-C-A 21657164-C-A **
4968412-T-G 5100371-T-G **
3880849-C-A 4012808-C-A **
3596513-T-G 3728472-T-G **
3627899-G-A 3759858-G-A **
3759514-G-A 3891473-G-A **
3759528-A-G 3891487-A-G **
3790405-C-A 3922364-C-A **
3815146-G-T 3947105-G-T **
3818136-T-C 3950095-T-C **
3851553-T-A 3983512-T-A **
3950775-A-G 4082734-A-G **
4164878-G-T 4296837-G-T **
3950778-A-G 4082737-A-G **
3965115-T-A 4097074-T-A **
4015200-C-A 4147159-C-A **
4048961-C-A 4180920-C-A **
4051267-G-T 4183226-G-T **
4059867-C-A 4191826-C-A **
4133415-T-C 4265374-T-C **
4136361-A-G 4268320-A-G **
4968154-C-A 5100113-C-A **
5113765-A-G 5245724-A-G **
3229163-A-G 3361122-A-G **
6441135-C-A 6573094-C-A **
6072590-C-A 6204549-C-A **
6072630-T-C 6204589-T-C **
6091287-C-T 6223246-C-T **
6096286-G-A 6228245-G-A **
6224874-C-A 6356833-C-A IR3_Dst **
6330132-A-G 6462091-A-G IR3_Dst **
6368023-C-A 6499982-C-A **
6405972-C-A 6537931-C-A **
6461646-A-G 6593605-A-G **
6003156-G-T 6135115-G-T **
6490608-A-T 6622567-A-T **
6516841-C-A 6648800-C-A **
6540940-C-A 6672899-C-A **
6614790-G-T 6746749-G-T **
6666256-C-G 6798215-C-G **
6671697-C-A 6803656-C-A **
6874686-A-T 7006645-A-T **
6891987-G-A 7023946-G-A **
6039825-A-G 6171784-A-G **
5968315-C-A 6100274-C-A **
5126426-G-T 5258385-G-T **
5687492-C-A 5819451-C-A **
5171560-A-G 5303519-A-G **
5309581-G-A 5441540-G-A **
5407822-C-A 5539781-C-A **
5419680-T-C 5551639-T-C **
5443270-A-G 5575229-A-G **
5526109-C-A 5658068-C-A **
5537394-C-A 5669353-C-A **
5678561-C-A 5810520-C-A **
5688404-A-G 5820363-A-G **
5910180-C-A 6042139-C-A **
5698687-T-C 5830646-T-C **
5809131-T-A 5941090-T-A **
5817836-G-C 5949795-G-C **
5873563-G-T 6005522-G-T **
5873590-A-G 6005549-A-G **
5882544-G-T 6014503-G-T **
5882689-T-C 6014648-T-C **
5887640-G-A 6019599-G-A **
3287565-CT-C 3419524-CT-C **
4353936-T-A 4485895-T-A **
3165175-G-T 3297134-G-T Y81836 **
18443627-G-T 16331747-G-T P6_Dst **
28716265-C-A 26570118-C-A **
20409511-G-T 18247625-G-T P5_Dst **
8481397-A-G 8613356-A-G **
11000329-G-T **
22489654-C-G 20327768-C-G DYZ19 **
28780223-A-G 26634076-A-G **
23439038-C-T 21277152-C-T **
22011296-T-C 19849410-T-C Y12179 **
7335713-CAAAA-C 7467672-CAAAA-C 15×A**
14531070-C-A 12419271-C-A **
15193490-G-A 13081576-G-A **
9123256-G-T **
13642281-C-A 11486605-C-A **
21677088-C-A 19515202-C-A **
28610260-C-A 26464113-C-A **
13442087-C-A 11286411-C-A **
22340038-A-T 20178152-A-T DYZ19 **
4847447-T-TA 4979406-T-TA 11×A**
4133334-C-A 4265293-C-A **
10883916-C-A **
22483900-C-A 20322014-C-A DYZ19 **
19252926-G-T 17141046-G-T **
19071152-C-A 16959272-C-A **
10773650-C-A **
17056753-G-A 14944873-G-A **
10676932-G-T **
13963332-A-G 11842626-A-G **
14803090-T-C 12691161-T-C **
3272794-C-A 3404753-C-A **
3147315-C-G 3279274-C-G **
7428333-T-C 7560292-T-C **
10998408-T-C **
13196514-C-A 11040838-C-A **
10765016-TATTCC-T **
2649679-T-A 2781638-T-A **
3116488-T-A 3248447-T-A **
3094413-C-A 3226372-C-A **
3048231-T-A 3180190-T-A **
3015590-A-G 3147549-A-G **
3007322-A-G 3139281-A-G **
10821877-C-T **
2917309-A-G 3049268-A-G **
2860074-A-G 2992033-A-G **
2795607-C-G 2927566-C-G **
2773180-T-A 2905139-T-A **
2745791-G-C 2877750-G-C **
2708558-C-G 2840517-C-G **
22991217-C-A 20829331-C-A **
10683692-C-T **
11001153-C-A **
10821899-C-CGCTAA **
7861209-C-A 7993168-C-A **
56843738-G-T **
10925611-T-C **
6277750-C-G 6409709-C-G IR3_Dst **
6355676-G-T 6487635-G-T **
13457972-A-G 11302296-A-G ******
27862574-G-A 25716427-G-A P1_Y2 ***
22285254-G-A 20123368-G-A DYZ19 ***
25279176-A-T 23133029-A-T P2_r1 ***
58976635-C-T 56830488-C-T ***
58975582-C-T 56829435-C-T ***
24278183-C-CAAGAAAGAAAGA 22132036-C-CAAGAAAGAAAGA P3_b1 22×AAGA***
56830607-C-T ***
2665267-CTT-C 2797226-CTT-C 12×T***
15430612-T-C 13318732-T-C ***
56830525-TATTCCATTGCATTCTGCTGA-T,TATTCCATTGCATTCCATTGC ***
24470052-T-G 22323905-T-G ***
58976645-A-G 56830498-A-G ***
58976664-T-C 56830517-T-C ***
7142197-C-A 7274156-C-A ***
6712476-G-T 6844435-G-T ***
6915796-ATT-A,AT 7047755-ATT-A,AT 22×T***
14213636-GAGGA-G 12092930-GAGGA-G 7×AGGA***
23808115-T-C 21646229-T-C ***
10799508-A-C,G ***
18699739-CCT-C 16587859-CCT-C 8×CT***
13208774-GAAGA-G ***
15179151-T-C 13067237-T-C ***
15612233-C-CAT 13500353-C-CAT ***
18959298-TAA-T 16847418-TAA-T 23×A***
58980009-CTCCAATCCAT-C 56833862-CTCCAATCCAT-C ***
18039415-A-T 15927535-A-T ***
8377909-TAC-T 8509868-TAC-T 16×AC***
13466157-C-A 11310481-C-A ***
13858557-A-ATCTTC 11737851-A-ATCTTC ***
26206233-C-T 24060086-C-T P1_Y1 ***
21200848-G-A 19038962-G-A ***
2777828-TAA-T,TA 2909787-TAA-T,TA 15×A***
10763081-C-T ***
21584215-C-T 19422329-C-T ***
56832509-CTCCAC-C,CTCCAA ***
16779280-C-T 14667400-C-T ***
10973659-T-C ***
10994643-C-A ***
10883574-A-T ***
10796683-A-G,T ***
16090225-C-A 13978345-C-A ***
10821757-C-A ***
3790866-G-A 3922825-G-A ***
13236580-T-C 11080904-T-C ***
2960075-A-T 3092034-A-T ***
13471978-G-C 11316302-G-C ***
10944584-C-A ***
10764551-A-G ***
13488626-TT-C,TC 11332950-TT-C,TC ***
11013734-A-C ***
16430404-A-T 14318524-A-T ***
8216406-CTTTT-C,CT 8348365-CTTTT-C,CT 16×T***
58976458-G-GCCATTCCATTCCACT 56830311-G-GCCATTCCATTCCACT ***
24421126-G-C 22274979-G-C ***
24001384-C-A 21855237-C-A ***
10673828-C-A ***
4063965-C-A 4195924-C-A ***
8725374-C-A 8857333-C-A ***
9354128-T-C 9516519-T-C ***
15490662-A-AT 13378782-A-AT 10×T***
5742802-C-A 5874761-C-A ***
9678327-T-C 9840718-T-C IR3_Prx ***
7217162-CTTT-C 7349121-CTTT-C 14×T***
10799466-CGA-G ***
10764569-C-CCGTAT ***
10878320-A-G ***
10878321-C-T ***
13858545-G-C 11737839-G-C ***
13858541-A-C 11737835-A-C ***
22849491-CTTTT-C,CTTTTT 20687605-CTTTT-C,CTTTTT 20×T***
22625051-CT-C 20463165-CT-C ***
13227903-G-A 11072227-G-A ***
15557124-AATATATATAT-A 13445244-AATATATATAT-A 19×AT***
25705290-A-ACT 23559143-A-ACT P1_b3 18×CT***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Mutation Notes:

Kit POSITION-REF-ALT (hg19) POSITION-REF-ALT (hg38) Note
Manual16354918-T-A14243038-T-ANigel McCarthy: Low number of reads but all positive.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 2741131091701579416918025199
Kit: 274131000344781212047990241
Used in age calculations1091701579416918025199
Counts of SNPs87
Variant counts last updated 2018-07-20 18:09:46.



Big Tree Main Page