Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > FGC11134 > FGC12055 > A353 > Z3026 > Z16250 > A114 > CTS4466/S1136 > S1115 > Z3023 > FGC84010 > A541 > S1121 > Z16251 > Z18170 > FGC29280 > S1126 > S1129 > FGC36625

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
273871
BigY2
273871
25970590-T-G 23824443-T-G P1_Y1 ***A*
19698566-T-TA 17586686-T-TA FGC12993 P5_Prx 9×AA*
19831118-T-TA 17719238-T-TA P5_Prx 9×AA*
13695097-G-C 11539421-G-C A*
8601423-T-C 8733382-T-C FGC36621 YY++
8695324-T-C 8827283-T-C FGC36622 YY++
8697266-C-T 8829225-C-T FGC36623 YY++
9439282-A-G 9601673-A-G FGC36624 YY++
17114747-T-C 15002867-T-C BY112401 YY++
22294285-C-A 20132399-C-A DYZ19 ++
22992232-A-G 20830346-A-G FGC36626 YY++
13869546-AC-A 11748840-AC-A **
13869553-T-C 11748847-T-C **
13869568-T-A 11748862-T-A **
20045279-AAAG-A 17933399-AAAG-A P5_Prx **
21990400-T-TATA 19828514-T-TATA 6×ATA**
6757682-G-A 6889641-G-A CTS448 ****
15740447-C-A 13628567-C-A ****
22168598-G-T 20006712-G-T ****
28731904-G-T 26585757-G-T ****
13457901-T-TATTCC 11302225-T-TATTCC 7×ATTCC**
22333866-A-T 20171980-A-T DYZ19 **
17661330-G-T 15549450-G-T **
3995607-C-T 4127566-C-T **
13441533-C-T 11285857-C-T **
14986679-GCT-G 12874747-GCT-G **
21389813-G-T 19227927-G-T Y106322 **
7641956-C-A 7773915-C-A Y84536 **
13446694-CCATTT-C 11291018-CCATTT-C **
13836862-C-T 11716156-C-T FT328629 **
22427739-G-C 20265853-G-C DYZ19 **
23438848-T-C 21276962-T-C **
6822569-C-A 6954528-C-A **
14880439-G-T 12768509-G-T **
15682754-C-A 13570874-C-A **
8293882-C-A 8425841-C-A **
25376577-G-C 23230430-G-C P2_r2 **
22962036-G-T 20800150-G-T **
5179539-TATAC-T 5311498-TATAC-T **
6444973-T-C 6576932-T-C FT100897 **
6664053-T-G 6796012-T-G **
10763024-T-A **
28755037-C-A 26608890-C-A **
17159020-A-C 15047140-A-C **
56832789-T-TACTCCACTCC **
17802153-G-A 15690273-G-A **
18094316-G-T 15982436-G-T **
21104437-T-TAAA 18942551-T-TAAA 22×A**
7183088-C-A 7315047-C-A **
17063746-A-G 14951866-A-G **
10828826-ACCATT-A **
4442961-C-A 4574920-C-A **
4538469-C-A 4670428-C-A **
28658592-C-A 26512445-C-A **
19475155-C-A 17363275-C-A **
18174717-C-A 16062837-C-A **
10895769-T-A **
10895794-T-C **
10895812-T-C **
10895827-A-G **
10895828-TTCCA-T **
10895836-CA-C **
6816733-G-A 6948692-G-A **
15834330-G-T 13722450-G-T **
56877732-T-C **
14430340-C-A 12309613-C-A **
10801702-C-G **
7349182-C-A 7481141-C-A **
3048128-C-A 3180087-C-A **
7989284-C-A 8121243-C-A **
25937802-C-A 23791655-C-A P1_Y1 **
23898736-T-TG 21736850-T-TG **
10924828-C-A **
6996578-C-A 7128537-C-A **
13483271-G-C 11327595-G-C **
10763013-T-C **
8644324-C-A 8776283-C-A BY74877 32×A**
5606688-C-A 5738647-C-A **
10762973-C-A **
10994124-C-A **
23475483-C-A 21313597-C-A **
28469562-A-G 26323415-A-G **
7656864-G-T 7788823-G-T **
10763010-C-A **
28376023-C-A 26229876-C-A P1_gr2 **
10807219-A-T **
17537953-C-A 15426073-C-A **
10801722-C-T **
22078341-G-T 19916455-G-T **
13488783-G-T 11333107-G-T **
10817422-C-A **
5687613-TA-T 5819572-TA-T 8×A**
10693197-C-T **
13932912-C-A 11812206-C-A **
28777235-C-A 26631088-C-A **
2744804-C-A 2876763-C-A **
14549165-C-A 12437366-C-A **
2877985-C-A 3009944-C-A **
10667024-C-GGATTA **
23262525-C-A 21100639-C-A **
6756887-T-G 6888846-T-G **
10693205-T-A **
8737985-C-A 8869944-C-A **
21405894-C-A 19244008-C-A **
26228717-G-TT 24082570-G-TT P1_Y1 **
23009871-G-T 20847985-G-T **
3622366-C-A 3754325-C-A **
22965083-C-A 20803197-C-A FTB67499 **
13478245-C-A 11322569-C-A **
10956498-T-C **
10774769-G-T **
7311033-T-A 7442992-T-A **
10659736-C-A **
16054117-C-A 13942237-C-A **
18465586-G-T 16353706-G-T P6_Dst **
13866183-C-A 11745477-C-A **
10661410-G-T **
7418664-G-T 7550623-G-T **
7368879-C-A 7500838-C-A **
18247381-C-A 16135501-C-A **
22345997-C-TGG 20184111-C-TGG DYZ19 **
10838646-A-T **
14995734-C-T 12883819-C-T **
14630458-C-A 12518527-C-A **
9181023-G-T 9343414-G-T **
20434784-T-TG 18272898-T-TG P5_Dst **
22995982-C-A 20834096-C-A **
14474630-C-A 12353899-C-A **
17257313-A-C 15145433-A-C **
28727832-C-A 26581685-C-A **
4863363-G-T 4995322-G-T **
2928822-C-A 3060781-C-A **
18959087-C-A 16847207-C-A **
22333862-A-G 20171976-A-G DYZ19 **
18015259-A-AG 15903379-A-AG P7_Dst **
5459852-C-A 5591811-C-A **
15060465-C-A 12948557-C-A **
15109881-G-T 12997968-G-T **
56826005-G-T **
2649802-CAAAAAAA-C 2781761-CAAAAAAA-C 24×A**
14030866-C-A 11910160-C-A **
18589744-C-A 16477864-C-A **
10958434-C-A **
10750840-G-T **
17300647-C-A 15188767-C-A **
18309164-T-TC 16197284-T-TC P6_Prx **
23848058-G-T 21686172-G-T **
14089952-C-A 11969246-C-A **
19258937-C-A 17147057-C-A **
24244499-G-T 22098352-G-T P3_b1 **
10667038-C-T **
10826973-G-T **
15682780-C-A 13570900-C-A **
19356462-C-A 17244582-C-A **
18856262-C-A 16744382-C-A **
6946048-C-A 7078007-C-A **
28479156-T-G 26333009-T-G **
5443904-C-A 5575863-C-A **
7451331-A-G 7583290-A-G IR1_L **
9461105-C-A 9623496-C-A **
3876955-G-T 4008914-G-T **
17605031-C-A 15493151-C-A **
28465270-C-A 26319123-C-A **
28544450-C-A 26398303-C-A **
16050439-A-G 13938559-A-G **
24884189-G-TT 22738042-G-TT g1 **
6767888-T-C 6899847-T-C **
14043787-C-A 11923081-C-A **
21895600-TAA-T 19733714-TAA-T 12×A**
14286165-G-A 12165459-G-A **
6132558-C-A 6264517-C-A **
17543894-C-A 15432014-C-A **
10828857-C-A **
11671420-C-A **
6732411-C-A 6864370-C-A **
14080100-G-T 11959394-G-T **
10868251-C-T FT91916 **
19949609-T-TG 17837729-T-TG P5_Prx **
14429351-C-A 12308626-C-A **
16677186-C-A 14565306-C-A **
28581026-C-A 26434879-C-A **
22662133-C-A 20500247-C-A **
16575-C-A **
10971031-A-G **
10999075-T-C **
19563073-C-A 17451193-C-A **
16720642-G-T 14608762-G-T **
56839382-G-T **
2809615-C-A 2941574-C-A **
19720734-AG-A 17608854-AG-A P5_Prx **
17100490-C-T 14988610-C-T **
24587849-G-A 22441702-G-A P3_t2 **
2845221-C-A 2977180-C-A 38×A**
21320025-C-A 19158139-C-A **
21125683-C-A 18963797-C-A **
10847088-C-A **
28581238-C-A 26435091-C-A **
13226965-C-A 11071289-C-A **
17117454-C-A 15005574-C-A **
5712641-G-T 5844600-G-T **
10780290-C-A **
6085417-C-A 6217376-C-A **
5335387-G-T 5467346-G-T **
15276383-G-T 13164472-G-T **
20987031-C-A 18825145-C-A P4_Dst **
6474672-T-G 6606631-T-G **
10820921-C-A **
15157540-C-A 13045627-C-A **
9231747-C-G 9394138-C-G **
28761528-C-A 26615381-C-A **
6944942-T-A 7076901-T-A **
10972266-C-A **
11028190-C-A **
10658160-T-G **
14294159-G-A 12173453-G-A **
21495612-C-A 19333726-C-A **
10758100-C-A **
9034499-C-A 9196890-C-A **
16931599-G-T 14819719-G-T **
4538477-C-A 4670436-C-A **
7063919-C-A 7195878-C-A **
14884586-C-A 12772652-C-A **
24406253-G-T 22260106-G-T **
6368230-C-A 6500189-C-A **
14540613-T-C 12428814-T-C **
7298806-G-T 7430765-G-T **
14749086-C-A 12637155-C-A **
10752903-G-T **
26064225-A-G 23918078-A-G P1_Y1 **
10750783-C-T FT429588 **
21795260-G-T 19633374-G-T **
13195825-C-A 11040149-C-A **
5402384-T-G 5534343-T-G **
6244487-AC-A 6376446-AC-A IR3_Dst **
10931023-C-A **
20216471-A-ATG 18054585-A-ATG P5_Dst **
14561878-T-G 12450079-T-G **
9931363-G-GT 10093754-G-GT 9×T**
14689113-C-A 12577179-C-A **
4241781-C-A 4373740-C-A **
7366433-C-A 7498392-C-A **
10050237-C-A 10212628-C-A **
6465439-C-A 6597398-C-A **
4241776-C-A 4373735-C-A **
17346442-C-A 15234562-C-A **
9926838-C-A 10089229-C-A **
14568211-C-A 12456411-C-A **
6956431-C-A 7088390-C-A **
56833347-A-T **
16000068-G-T 13888188-G-T **
18626133-G-T 16514253-G-T **
23834752-C-A 21672866-C-A **
21220313-C-A 19058427-C-A **
17318763-C-A 15206883-C-A **
21993842-A-C 19831956-A-C **
2680997-T-G 2812956-T-G **
2689674-G-T 2821633-G-T **
2740660-G-C 2872619-G-C **
2745920-C-A 2877879-C-A **
2772921-G-C 2904880-G-C **
2784384-C-A 2916343-C-A **
2785193-C-T 2917152-C-T **
2795659-A-G 2927618-A-G **
2847283-G-T 2979242-G-T **
2856503-A-C 2988462-A-C **
2892613-C-A 3024572-C-A **
2906586-C-A 3038545-C-A **
2916728-G-T 3048687-G-T **
2949030-A-T 3080989-A-T **
2981388-A-C 3113347-A-C **
3013838-G-T 3145797-G-T **
3015748-G-T 3147707-G-T **
3048923-C-A 3180882-C-A **
3061144-C-A 3193103-C-A **
3094469-G-T 3226428-G-T **
3121236-A-AT 3253195-A-AT 10×T**
3123156-G-T 3255115-G-T **
3123226-A-G 3255185-A-G **
3133253-G-A 3265212-G-A **
3143114-G-T 3275073-G-T **
3181043-G-T 3313002-G-T **
3181137-GA-G 3313096-GA-G 8×A**
3205203-G-T 3337162-G-T **
3227404-G-T 3359363-G-T **
3229556-T-A 3361515-T-A **
3264916-T-C 3396875-T-C **
3271189-C-A 3403148-C-A **
3274767-T-C 3406726-T-C **
3274777-A-C 3406736-A-C **
3276153-T-C 3408112-T-C **
3285154-G-C 3417113-G-C **
3285155-A-C 3417114-A-C **
3298083-T-C 3430042-T-C **
3327928-A-G 3459887-A-G **
3343062-T-G 3475021-T-G **
3382070-C-A 3514029-C-A **
3575571-A-C 3707530-A-C **
3619634-G-T 3751593-G-T **
3630826-T-G 3762785-T-G **
3648561-A-G 3780520-A-G **
3678971-C-A 3810930-C-A **
3703424-C-A 3835383-C-A **
3770049-C-A 3902008-C-A **
3851629-T-G 3983588-T-G **
3852297-T-C 3984256-T-C **
3910202-A-C 4042161-A-C **
3922806-T-G 4054765-T-G **
3947484-G-T 4079443-G-T **
3950844-T-G 4082803-T-G **
3995658-C-A 4127617-C-A **
3995786-T-C 4127745-T-C **
3996478-G-A 4128437-G-A **
4012019-C-A 4143978-C-A **
4063129-C-T 4195088-C-T **
4070703-C-A 4202662-C-A **
4081574-A-C 4213533-A-C **
4082996-C-A 4214955-C-A **
4171889-C-T 4303848-C-T **
4190018-C-A 4321977-C-A **
4192947-G-T 4324906-G-T **
4201940-A-G 4333899-A-G **
4208196-G-A 4340155-G-A **
4215493-G-T 4347452-G-T **
4230126-C-A 4362085-C-A **
4241541-C-A 4373500-C-A **
4245020-T-C 4376979-T-C **
4257509-G-T 4389468-G-T **
4270770-T-C 4402729-T-C **
4302132-C-G 4434091-C-G **
4356172-C-A 4488131-C-A **
4412187-T-C 4544146-T-C **
4412357-A-C 4544316-A-C **
4418276-A-G 4550235-A-G **
4441018-A-C 4572977-A-C **
4441023-A-C 4572982-A-C **
4472506-C-A 4604465-C-A **
4504629-G-T 4636588-G-T **
4538440-A-C 4670399-A-C **
4538483-A-C 4670442-A-C **
4547864-C-A 4679823-C-A **
4664675-A-G 4796634-A-G **
4718976-C-A 4850935-C-A **
4756786-A-C 4888745-A-C **
4767333-G-T 4899292-G-T **
4785275-G-T 4917234-G-T **
4792348-G-T 4924307-G-T **
4836981-C-A 4968940-C-A **
4898071-T-G 5030030-T-G **
4900077-C-A 5032036-C-A **
4901501-G-T 5033460-G-T **
4901502-G-T 5033461-G-T **
4901507-G-T 5033466-G-T **
4916497-A-G 5048456-A-G **
4916532-T-C 5048491-T-C **
4921124-C-A 5053083-C-A **
4960546-G-T 5092505-G-T **
4968777-T-C 5100736-T-C **
5059616-T-A 5191575-T-A **
5090251-A-G 5222210-A-G **
5144014-G-T 5275973-G-T **
5150502-G-T 5282461-G-T **
5179514-A-G 5311473-A-G **
5194322-G-T 5326281-G-T **
5200285-T-G 5332244-T-G **
5275584-A-C 5407543-A-C **
5275604-C-A 5407563-C-A **
5313380-G-T 5445339-G-T **
5319681-C-A 5451640-C-A **
5320063-G-T 5452022-G-T **
5374359-T-G 5506318-T-G **
5374374-T-G 5506333-T-G **
5402456-C-T 5534415-C-T **
5413148-C-G 5545107-C-G **
5427915-A-G 5559874-A-G **
5443970-C-A 5575929-C-A **
5446961-G-C 5578920-G-C **
5489094-G-T 5621053-G-T **
5558301-A-T 5690260-A-T **
5597611-G-T 5729570-G-T FT145423 **
5597877-G-T 5729836-G-T **
5620731-T-G 5752690-T-G **
5644680-T-G 5776639-T-G **
5686307-C-A 5818266-C-A **
5709113-G-T 5841072-G-T **
5721101-T-A 5853060-T-A **
5770303-G-T 5902262-G-T **
5774435-G-T 5906394-G-T **
5774536-C-A 5906495-C-A **
5795484-G-A 5927443-G-A **
5858583-T-G 5990542-T-G **
5866837-G-T 5998796-G-T **
5867415-A-G 5999374-A-G **
5867504-T-C 5999463-T-C **
5886689-C-G 6018648-C-G **
5970235-T-C 6102194-T-C **
5973846-T-C 6105805-T-C **
6022916-G-T 6154875-G-T **
6029772-G-T 6161731-G-T **
6073351-C-A 6205310-C-A **
6114170-A-G 6246129-A-G **
6117954-C-A 6249913-C-A **
6180974-T-C 6312933-T-C IR3_Dst **
6225280-C-A 6357239-C-A IR3_Dst **
6360661-G-T 6492620-G-T **
6422553-C-A 6554512-C-A **
6429581-C-T 6561540-C-T **
6444871-T-G 6576830-T-G **
6444876-A-G 6576835-A-G **
6465438-A-C 6597397-A-C **
6474678-T-G 6606637-T-G **
6497946-A-C 6629905-A-C **
6505288-A-G 6637247-A-G **
6582369-G-T 6714328-G-T **
6593670-C-A 6725629-C-A **
6634184-C-A 6766143-C-A **
6640056-C-A 6772015-C-A **
6648659-T-G 6780618-T-G **
6664037-A-G 6795996-A-G **
6664039-T-G 6795998-T-G **
6667458-C-A 6799417-C-A **
6697245-C-A 6829204-C-A **
6721942-C-A 6853901-C-A **
6736404-G-T 6868363-G-T **
6770721-A-C 6902680-A-C **
6784634-C-G 6916593-C-G **
6786669-T-A 6918628-T-A **
6827087-G-T 6959046-G-T **
6831167-C-A 6963126-C-A **
6878834-G-T 7010793-G-T **
6899746-A-T 7031705-A-T **
6911107-C-A 7043066-C-A **
6929343-C-A 7061302-C-A **
6929598-C-A 7061557-C-A **
6948535-G-T 7080494-G-T **
6982385-C-T 7114344-C-T **
7019294-C-A 7151253-C-A **
7020266-G-T 7152225-G-T **
7020536-C-A 7152495-C-A **
7033600-C-T 7165559-C-T **
7038384-C-A 7170343-C-A A2609 **
7040549-C-T 7172508-C-T **
7041926-TTCTCA-T 7173885-TTCTCA-T **
7042805-C-A 7174764-C-A **
7091289-C-T 7223248-C-T **
7098753-C-G 7230712-C-G **
7101507-T-G 7233466-T-G **
7123616-A-G 7255575-A-G **
7134065-C-T 7266024-C-T **
7138944-G-A 7270903-G-A **
7141019-G-T 7272978-G-T **
7162923-C-A 7294882-C-A **
7202045-C-A 7334004-C-A **
7202231-A-C 7334190-A-C **
7233169-C-A 7365128-C-A **
7257948-G-T 7389907-G-T **
7263766-C-A 7395725-C-A **
7277620-A-G 7409579-A-G **
7288004-T-C 7419963-T-C **
7303869-T-G 7435828-T-G **
7338236-A-C 7470195-A-C **
7343173-T-G 7475132-T-G **
7360421-A-G 7492380-A-G **
7389995-CG-C 7521954-CG-C **
7390008-G-T 7521967-G-T **
7436132-C-T 7568091-C-T **
7437486-G-T 7569445-G-T **
7524613-C-A 7656572-C-A **
7568809-G-T 7700768-G-T **
7579107-C-A 7711066-C-A **
7590497-G-T 7722456-G-T **
7608375-C-A 7740334-C-A **
7613858-A-G 7745817-A-G **
7621509-G-T 7753468-G-T **
7670671-A-C 7802630-A-C **
7690052-T-G 7822011-T-G **
7701929-C-A 7833888-C-A **
7711534-A-G 7843493-A-G **
7713330-G-T 7845289-G-T **
7755054-C-A 7887013-C-A **
7974682-A-G 8106641-A-G **
8138082-A-T 8270041-A-T **
8138086-T-A 8270045-T-A **
8138111-T-C 8270070-T-C **
8138112-G-T 8270071-G-T **
8214942-C-T 8346901-C-T **
8214950-C-A 8346909-C-A **
8264495-C-A 8396454-C-A BY71278 **
8297001-C-A 8428960-C-A **
8345113-G-T 8477072-G-T **
8379705-G-T 8511664-G-T **
8379716-C-G 8511675-C-G **
8385776-T-G 8517735-T-G **
8697399-A-C 8829358-A-C **
8749173-G-T 8881132-G-T **
8761389-C-A 8893348-C-A **
8761601-T-G 8893560-T-G **
8766419-G-T 8898378-G-T **
8825325-T-C 8957284-T-C **
8850120-G-T 8982079-G-T **
9125407-A-C **
9125413-G-C **
8987183-C-A 9149574-C-A **
9028360-C-A 9190751-C-A **
9089004-T-G 9251395-T-G **
9172819-C-A 9335210-C-A **
9211562-G-C 9373953-G-C **
9437302-C-A 9599693-C-A **
9438123-TTTTTTTG-T 9600514-TTTTTTTG-T **
9461113-C-A 9623504-C-A **
9499666-C-A 9662057-C-A **
9615080-A-G 9777471-A-G IR3_Prx **
9730345-A-C 9892736-A-C IR3_Prx **
9730353-A-C 9892744-A-C IR3_Prx **
9730361-A-C 9892752-A-C IR3_Prx **
9800310-G-A 9962701-G-A **
9847398-C-A 10009789-C-A **
9885196-A-C 10047587-A-C **
9891182-G-T 10053573-G-T **
9899585-A-G 10061976-A-G **
9910877-AAAGG-A 10073268-AAAGG-A **
9921072-G-T 10083463-G-T **
9927241-C-A 10089632-C-A **
9931555-T-G 10093946-T-G **
9937539-A-C 10099930-A-C **
9961400-C-A 10123791-C-A **
9963348-G-T 10125739-G-T **
9966140-C-A 10128531-C-A **
9982576-C-A 10144967-C-A **
9993520-C-A 10155911-C-A **
9993547-C-A 10155938-C-A **
10018407-G-T 10180798-G-T **
10026909-C-A 10189300-C-A **
10033477-C-A 10195868-C-A **
10048654-C-T 10211045-C-T **
10059443-T-G 10221834-T-G **
10080366-G-T 10242757-G-T **
10648736-G-T **
10662866-C-A **
10664705-C-T **
10685702-C-T **
10685726-C-T **
10693200-AT-A **
10693206-C-A **
10749286-C-T **
10752884-T-G **
10761870-C-A **
10762968-C-CACCTT **
10763040-CCATTA-C **
10763064-TCC-T **
10763067-ACTC-A **
10770464-G-T **
10776254-C-A **
10786181-T-C **
10792128-A-T **
10796672-CA-T **
10807322-TC-T **
10820777-T-G **
10838636-C-T **
10838651-C-T **
10838656-C-T **
10842024-C-A **
10847468-G-T **
10858990-C-A **
10868243-G-C **
10868244-A-C **
10868250-G-A FT434782 **
10879299-A-G **
10925564-C-A **
10956501-T-C **
10967732-C-A **
10990596-A-T **
11031160-G-T **
13196742-G-T 11041066-G-T **
13249190-C-G 11093514-C-G **
13298043-C-A 11142367-C-A **
13313083-C-T 11157407-C-T **
13324165-T-G 11168489-T-G **
13330912-A-C 11175236-A-C **
13351134-C-A 11195458-C-A **
13353256-C-A 11197580-C-A **
13404473-T-A 11248797-T-A **
13441500-G-T 11285824-G-T **
13441511-A-G 11285835-A-G **
13441537-G-T 11285861-G-T **
13445979-G-T 11290303-G-T **
13466368-G-T 11310692-G-T **
13469042-C-A 11313366-C-A **
13469061-C-A 11313385-C-A **
13478224-C-T 11322548-C-T **
13483741-G-C 11328065-G-C **
13484041-A-T 11328365-A-T **
13484045-G-C 11328369-G-C **
13510893-G-T 11355217-G-T **
13512938-G-T 11357262-G-T **
13514367-C-A 11358691-C-A **
13550757-C-A 11395081-C-A **
13653144-C-A 11497468-C-A **
13671419-T-G 11515743-T-G **
13705483-A-C 11549807-A-C **
13705493-A-ATTTAG 11549817-A-ATTTAG **
11653286-G-T **
11653621-C-G **
11655796-G-A FT450516 **
11663425-C-A **
11668399-A-C **
11672577-G-T **
11675136-C-A **
11677265-T-A **
13828499-A-G 11707793-A-G **
13856096-A-T 11735390-A-T **
13865621-A-C 11744915-A-C **
13866111-AAAAGAATG-A 11745405-AAAAGAATG-A **
13875715-C-A 11755009-C-A **
13937993-G-C 11817287-G-C **
13975852-C-G 11855146-C-G **
14012558-G-T 11891852-G-T **
14012573-T-G 11891867-T-G **
14021091-C-A 11900385-C-A **
14029480-C-G 11908774-C-G **
14035251-T-G 11914545-T-G **
14038320-C-G 11917614-C-G **
14052790-C-A 11932084-C-A **
14109370-C-A 11988664-C-A **
14118237-T-A 11997531-T-A **
14118302-A-G 11997596-A-G **
14175568-T-A 12054862-T-A **
14177833-T-C 12057127-T-C **
14183460-G-T 12062754-G-T Y49099 **
14225730-G-T 12105024-G-T **
14238498-A-G 12117792-A-G **
14253394-C-A 12132688-C-A **
14313620-C-A 12192914-C-A **
14332646-C-A 12211940-C-A **
14347917-T-G 12227212-T-G **
14348095-C-T 12227390-C-T **
14368528-G-T 12247824-G-T **
14373510-A-C 12252806-A-C **
14392071-C-A 12271367-C-A **
14397480-G-C 12276776-G-C **
14405781-G-A 12285078-G-A **
14422753-G-A 12302028-G-A **
14425609-A-G 12304884-A-G **
14427014-C-A 12306289-C-A **
14451231-T-C 12330504-T-C **
14451874-T-G 12331147-T-G **
14458099-C-A 12337372-C-A **
14470341-T-C 12349610-T-C **
14470350-T-C 12349619-T-C **
14470762-T-G 12350031-T-G **
14479567-C-A 12358836-C-A **
14491004-C-A 12370273-C-A **
12370566-C-A **
14505554-G-C 12393759-G-C **
14517209-T-G 12405410-T-G **
14528379-G-C 12416580-G-C **
14546369-G-C 12434570-G-C **
14548177-A-C 12436378-A-C **
14548178-C-A 12436379-C-A **
14550110-C-A 12438311-C-A **
14561884-T-G 12450085-T-G **
14563444-T-G 12451644-T-G **
14563986-G-T 12452186-G-T **
14568152-C-A 12456352-C-A **
14593517-T-G 12481717-T-G **
14594707-T-G 12482907-T-G **
14626256-T-G 12514324-T-G **
14674656-T-C 12562722-T-C **
14688635-G-T 12576701-G-T **
14689178-C-A 12577244-C-A **
14700627-C-A 12588693-C-A **
14711923-C-A 12599990-C-A **
14760038-C-A 12648107-C-A **
14771202-C-A 12659271-C-A **
14786406-C-A 12674476-C-A **
14798139-CT-C 12686210-CT-C **
14832045-A-G 12720112-A-G **
14859945-C-A 12748011-C-A **
14888157-C-A 12776223-C-A **
14943006-A-C 12831080-A-C **
14986616-TTCTCTCTCTCTCTC-T 12874684-TTCTCTCTCTCTCTC-T 17×TC**
14990118-C-A 12878203-C-A **
14992403-A-C 12880488-A-C **
15068986-C-A 12957077-C-A **
15091802-C-A 12979891-C-A **
15109886-A-G 12997973-A-G **
15157348-A-C 13045435-A-C **
15157493-A-T 13045580-A-T **
15220875-A-C 13108961-A-C **
15260765-C-A 13148849-C-A **
15290000-C-A 13178099-C-A **
15290225-C-A 13178324-C-A **
15374516-C-T 13262636-C-T **
15396958-T-G 13285078-T-G **
15397000-G-T 13285120-G-T **
15397077-T-C 13285197-T-C **
15405197-T-C 13293317-T-C **
15406792-C-A 13294912-C-A **
15420255-T-G 13308375-T-G **
15497383-T-C 13385503-T-C **
15584947-C-A 13473067-C-A **
15595085-A-C 13483205-A-C **
15653755-A-G 13541875-A-G **
15669730-C-A 13557850-C-A **
15676860-T-G 13564980-T-G **
15698681-G-T 13586801-G-T **
15743624-T-C 13631744-T-C **
15755217-C-A 13643337-C-A **
15756686-C-G 13644806-C-G **
15775845-C-A 13663965-C-A **
15776732-C-A 13664852-C-A **
15790490-C-G 13678610-C-G **
15842711-C-T 13730831-C-T **
15844647-C-A 13732767-C-A **
15878356-G-T 13766476-G-T ZS5670 **
15923891-C-A 13812011-C-A **
15927036-C-A 13815156-C-A **
15932422-G-T 13820542-G-T **
15960603-G-T 13848723-G-T **
15962655-C-T 13850775-C-T **
16001146-T-C 13889266-T-C **
16050443-A-G 13938563-A-G **
16050457-G-T 13938577-G-T **
16057023-G-T 13945143-G-T **
16078409-A-T 13966529-A-T **
16146568-C-A 14034688-C-A P8_Dst **
16196106-C-A 14084226-C-A **
16232548-C-A 14120668-C-A **
16279517-C-A 14167637-C-A **
16305752-C-A 14193872-C-A **
16309389-G-T 14197509-G-T **
16319816-C-A 14207936-C-A **
16353207-GA-G 14241327-GA-G **
16355084-G-T 14243204-G-T **
16410146-C-A 14298266-C-A **
16427772-G-T 14315892-G-T **
16431113-C-A 14319233-C-A **
16450178-C-A 14338298-C-A **
16465498-A-C 14353618-A-C **
16490085-A-G 14378205-A-G **
16498029-A-C 14386149-A-C **
16498089-A-C 14386209-A-C **
16498092-C-A 14386212-C-A **
16501908-C-A 14390028-C-A **
16560033-G-T 14448153-G-T **
16577649-C-A 14465769-C-A **
16608003-G-T 14496123-G-T **
16608031-C-A 14496151-C-A FT330039 **
16612480-C-A 14500600-C-A **
16710046-G-T 14598166-G-T **
16717311-C-A 14605431-C-A **
16734287-C-A 14622407-C-A **
16843066-C-A 14731186-C-A **
16866083-T-G 14754203-T-G **
16882693-G-T 14770813-G-T **
16897643-CAAAAAAAAAAA-C 14785763-CAAAAAAAAAAA-C 23×A**
16905814-T-A 14793934-T-A **
16930867-C-A 14818987-C-A **
16933289-T-G 14821409-T-G **
17046710-A-G 14934830-A-G **
17153405-GC-G 15041525-GC-G **
17153409-T-C 15041529-T-C **
17153414-G-A 15041534-G-A **
17153420-C-T 15041540-C-T **
17153429-A-T 15041549-A-T **
17153434-C-T 15041554-C-T **
17153435-C-G 15041555-C-G **
17257305-A-T 15145425-A-T **
17262965-T-C 15151085-T-C **
17307374-A-T 15195494-A-T **
17307379-C-A 15195499-C-A **
17307382-A-C 15195502-A-C **
17310013-G-T 15198133-G-T **
17313736-T-G 15201856-T-G **
17360932-C-A 15249052-C-A FT46464 **
17385337-G-T 15273457-G-T **
17385339-A-G 15273459-A-G **
17408381-G-T 15296501-G-T **
17413348-G-T 15301468-G-T **
17464718-A-C 15352838-A-C **
17464726-G-T 15352846-G-T **
17489835-C-A 15377955-C-A **
17502652-G-T 15390772-G-T **
17504052-C-A 15392172-C-A **
17513863-A-C 15401983-A-C **
17538734-C-A 15426854-C-A **
17546315-G-T 15434435-G-T **
17581668-A-C 15469788-A-C **
17596565-C-A 15484685-C-A **
17604388-C-A 15492508-C-A **
17644470-C-G 15532590-C-G **
17684495-A-T 15572615-A-T **
17684518-C-T 15572638-C-T **
17697011-A-C 15585131-A-C **
17739210-C-A 15627330-C-A **
17779538-T-C 15667658-T-C **
17779539-T-C 15667659-T-C **
17779541-A-C 15667661-A-C **
17831003-T-G 15719123-T-G **
17831253-G-T 15719373-G-T **
17856110-G-T 15744230-G-T **
17860229-G-T 15748349-G-T **
17860659-C-A 15748779-C-A **
17862735-C-A 15750855-C-A **
17862736-A-G 15750856-A-G **
17885075-G-T 15773195-G-T **
17913123-A-G 15801243-A-G **
17920786-C-A 15808906-C-A **
17927475-C-A 15815595-C-A **
17934203-TAAA-T 15822323-TAAA-T 13×A**
17947019-G-A 15835139-G-A **
17951743-G-T 15839863-G-T **
17962793-T-G 15850913-T-G **
18003236-G-T 15891356-G-T P7_Gap **
18006587-C-A 15894707-C-A P7_Gap **
18036558-C-A 15924678-C-A **
18037887-A-C 15926007-A-C **
18050102-C-A 15938222-C-A **
18059803-A-G 15947923-A-G **
18060290-GTACATA-G 15948410-GTACATA-G **
18092919-A-C 15981039-A-C **
18136158-G-T 16024278-G-T **
18136200-G-T 16024320-G-T FGC62690 **
18165914-C-A 16054034-C-A **
18165969-G-T 16054089-G-T **
18185180-C-A 16073300-C-A FTB56754 **
18253416-T-C 16141536-T-C **
18263866-A-C 16151986-A-C **
18308810-C-A 16196930-C-A P6_Prx **
18411253-C-A 16299373-C-A P6_Gap **
18540567-C-A 16428687-C-A **
18546307-C-A 16434427-C-A **
18580544-G-A 16468664-G-A **
18616034-G-T 16504154-G-T **
18645889-A-C 16534009-A-C **
18660080-C-A 16548200-C-A **
18661631-AT-A 16549751-AT-A **
18710153-TC-T 16598273-TC-T **
18769564-C-T 16657684-C-T **
18790102-C-A 16678222-C-A **
18793427-A-G 16681547-A-G **
18810897-G-T 16699017-G-T **
18850574-C-A 16738694-C-A **
18873851-C-G 16761971-C-G **
18901065-G-C 16789185-G-C **
18901970-G-GA 16790090-G-GA **
18911105-C-A 16799225-C-A **
18923275-C-A 16811395-C-A **
18929995-C-T 16818115-C-T **
18932698-G-T 16820818-G-T **
18948232-G-A 16836352-G-A **
18966209-C-T 16854329-C-T **
18966238-A-C 16854358-A-C **
18970712-T-C 16858832-T-C **
18990407-A-G 16878527-A-G **
18990455-A-C 16878575-A-C **
19044400-C-A 16932520-C-A **
19055397-G-T 16943517-G-T FT176801 **
19067857-T-C 16955977-T-C **
19073878-A-C 16961998-A-C **
19104625-T-G 16992745-T-G **
19184513-T-C 17072633-T-C FT237508 **
19187058-C-A 17075178-C-A **
19226474-A-C 17114594-A-C **
19249476-C-A 17137596-C-A **
19250256-T-G 17138376-T-G **
19254215-G-T 17142335-G-T **
19286269-CT-C 17174389-CT-C **
19300264-C-A 17188384-C-A **
19353632-A-T 17241752-A-T **
19356349-T-G 17244469-T-G **
19356352-G-T 17244472-G-T **
19466989-T-C 17355109-T-C **
19523429-G-A 17411549-G-A **
19547731-G-T 17435851-G-T **
19551921-T-A 17440041-T-A **
19899657-G-T 17787777-G-T P5_Prx **
19926958-T-C 17815078-T-C P5_Prx **
19942325-G-T 17830445-G-T P5_Prx **
19942336-C-G 17830456-C-G P5_Prx **
19949602-T-C 17837722-T-C P5_Prx **
20244379-TTTTTGG-CCCCCCC 18082493-TTTTTGG-CCCCCCC P5_Dst **
20254985-G-A 18093099-G-A P5_Dst **
20535101-G-C 18373215-G-C P5_Dst **
20632027-G-A 18470141-G-A P4_Prx **
20632029-C-A 18470143-C-A P4_Prx **
20641688-G-T 18479802-G-T P4_Prx **
20673315-A-T 18511429-A-T P4_Prx **
20712216-T-G 18550330-T-G P4_Prx **
20776041-G-T 18614155-G-T P4_Prx **
20778764-G-A 18616878-G-A P4_Prx **
21118789-G-T 18956903-G-T **
21141470-G-T 18979584-G-T **
21144015-G-C 18982129-G-C **
21146451-G-A 18984565-G-A **
21153419-G-A 18991533-G-A **
21237842-C-A 19075956-C-A **
21299101-G-C 19137215-G-C **
21307163-TG-T 19145277-TG-T **
21328240-C-A 19166354-C-A **
21340434-C-A 19178548-C-A **
21352927-C-A 19191041-C-A **
21353354-G-A 19191468-G-A **
21389720-C-A 19227834-C-A **
21456141-G-T 19294255-G-T **
21468071-T-G 19306185-T-G **
21495634-A-C 19333748-A-C **
21513803-A-C 19351917-A-C **
21515644-C-A 19353758-C-A **
21515677-A-C 19353791-A-C **
21523489-A-G 19361603-A-G **
21582943-C-G 19421057-C-G **
21583481-G-T 19421595-G-T **
21601659-C-A 19439773-C-A **
21602778-C-A 19440892-C-A **
21602825-T-G 19440939-T-G **
21666842-G-T 19504956-G-T **
21694913-C-A 19533027-C-A **
21700352-C-A 19538466-C-A **
21796547-G-T 19634661-G-T **
21796557-T-C 19634671-T-C **
21796572-C-T 19634686-C-T **
21833060-C-A 19671174-C-A **
21840932-T-G 19679046-T-G **
21847441-T-C 19685555-T-C **
21947173-T-C 19785287-T-C **
21975363-C-A 19813477-C-A **
21993848-A-C 19831962-A-C **
22052732-C-G 19890846-C-G **
22056128-A-G 19894242-A-G **
22059458-G-T 19897572-G-T **
22065260-G-T 19903374-G-T **
22084642-C-A 19922756-C-A **
22113470-A-G 19951584-A-G **
22132938-G-C 19971052-G-C **
22137141-G-T 19975255-G-T **
22170842-G-T 20008956-G-T **
22193007-A-C 20031121-A-C **
22199320-A-C 20037434-A-C **
22204853-G-T 20042967-G-T **
22210616-C-T 20048730-C-T **
22564524-A-C 20402638-A-C **
22580108-C-A 20418222-C-A **
22611262-T-A 20449376-T-A **
22611396-T-G 20449510-T-G **
22611404-G-T 20449518-G-T **
22623421-C-A 20461535-C-A **
22658897-C-A 20497011-C-A **
22660970-A-G 20499084-A-G **
22691194-G-T 20529308-G-T **
22804067-T-G 20642181-T-G **
22811785-T-C 20649899-T-C **
22839196-C-A 20677310-C-A **
22841584-T-A 20679698-T-A **
22868896-C-A 20707010-C-A **
22871557-A-G 20709671-A-G **
22883546-C-A 20721660-C-A **
22938966-G-T 20777080-G-T **
22981080-A-C 20819194-A-C **
23007169-G-T 20845283-G-T **
23019959-C-A 20858073-C-A **
23038201-G-C 20876315-G-C **
23061813-C-A 20899927-C-A **
23065007-A-C 20903121-A-C **
23091618-G-C 20929732-G-C **
23138657-C-A 20976771-C-A **
23186655-G-T 21024769-G-T **
23232786-A-C 21070900-A-C **
23252765-C-G 21090879-C-G **
23345975-T-G 21184089-T-G **
23364229-T-G 21202343-T-G **
23368885-T-C 21206999-T-C **
23368891-G-T 21207005-G-T **
23420615-G-T 21258729-G-T **
23425294-A-C 21263408-A-C **
23773359-C-G 21611473-C-G **
23787270-A-C 21625384-A-C **
23808015-A-G 21646129-A-G **
23825263-G-T 21663377-G-T **
23837164-C-A 21675278-C-A **
23890465-T-TC 21728579-T-TC **
23954239-C-A 21808092-C-A **
24109047-C-A 21962900-C-A P3_b1 **
24472503-A-C 22326356-A-C **
24513665-C-A 22367518-C-A **
24588053-C-A 22441906-C-A P3_t2 **
24759266-G-T 22613119-G-T P3_b2 **
24759271-T-C 22613124-T-C P3_b2 **
24870112-C-A 22723965-C-A IR1_R **
26073037-G-GC 23926890-G-GC P1_Y1 **
26101789-A-G 23955642-A-G P1_Y1 **
26273703-A-G 24127556-A-G P1_Y1 **
26276099-C-T 24129952-C-T P1_Y1 **
26386343-C-A 24240196-C-A P1_Y1 **
26438983-C-A 24292836-C-A P1_Y1 **
27763313-A-AC 25617166-A-AC P1_Y2 **
27861832-G-A 25715685-G-A P1_Y2 **
27862508-C-A 25716361-C-A P1_Y2 **
27966860-TATA-T 25820713-TATA-T P1_Y2 **
28159361-A-C 26013214-A-C P1_b4 **
28376028-A-C 26229881-A-C P1_gr2 **
28469567-G-A 26323420-G-A **
28483839-C-A 26337692-C-A **
28491830-C-T 26345683-C-T **
28506039-C-A 26359892-C-A **
28532051-A-G 26385904-A-G **
28558849-C-G 26412702-C-G **
28575051-T-C 26428904-T-C **
28610498-G-T 26464351-G-T **
28632916-C-A 26486769-C-A **
28661411-G-T 26515264-G-T **
28722535-ACT-A 26576388-ACT-A **
28722553-G-A 26576406-G-A **
28729498-C-G 26583351-C-G **
28732142-T-G 26585995-T-G **
28735131-C-A 26588984-C-A **
28756919-T-G 26610772-T-G **
28761518-C-A 26615371-C-A **
28773688-C-A 26627541-C-A **
28774471-A-C 26628324-A-C **
28777226-C-A 26631079-C-A **
56830375-C-A **
56831031-C-A **
56831037-C-A **
56854879-G-A **
56860365-G-T **
56873032-C-A **
56877384-C-A **
56883643-C-A **
56883671-T-C **
13478497-C-T 11322821-C-T ***
13847278-A-G 11726572-A-G ***
13141728-C-T 10631214-C-T ***
13855556-G-C 11734850-G-C ***
13801189-G-T 11680483-G-T ***
13869465-G-A 11748759-G-A ***
13869484-G-T 11748778-G-T ***
13869513-T-C 11748807-T-C ***
13869597-A-G 11748891-A-G ***
13869612-T-A 11748906-T-A ***
17050121-G-A 14938241-G-A ******
22309919-A-C 20148033-A-C DYZ19 ***
22309920-C-T 20148034-C-T DYZ19 ***
28793131-G-T 26646984-G-T ***
58974053-T-C 56827906-T-C ***
22444034-C-T 20282148-C-T BY24486 DYZ19 ***
13856283-G-C 11735577-G-C ***
22328889-A-C 20167003-A-C DYZ19 ***
13664775-A-T 11509099-A-T ***
13805339-A-T 11684633-A-T ***
13483228-C-A,G 11327552-C-A,G ***
13686872-G-A 11531196-G-A ***
13801191-T-A,C 11680485-T-A,C ***
19868145-CT-C 17756265-CT-C P5_Prx 31×T***
28785659-A-G 26639512-A-G ***
58975532-G-C 56829385-G-C ***
13808753-T-C 11688047-T-C ***
13843665-T-G 11722959-T-G ***
13818717-A-G 11698011-A-G FTB8948 ***
13801216-A-T 11680510-A-T ***
13801220-A-T 11680514-A-T ***
13801224-G-A 11680518-G-A ***
19966688-AAAGAAGAAG-A,AAAG 17854808-AAAGAAGAAG-A,AAAG P5_Prx 26×AAG***
22245737-GC-AG,G 20083851-GC-AG,G DYZ19 ***
13453782-C-A 11298106-C-A ***
13857563-A-T 11736857-A-T ***
13801190-A-G 11680484-A-G ***
13664707-T-G 11509031-T-G ***
9221717-C-A 9384108-C-A ***
10017743-C-T 10180134-C-T ***
13854361-T-A 11733655-T-A ***
13862191-G-A 11741485-G-A FT273840 ***
13862232-A-C 11741526-A-C ***
13862248-A-C 11741542-A-C ***
58975488-T-A 56829341-T-A ***
58975514-G-T 56829367-G-T ***
13869337-A-C 11748631-A-C ***
13676728-A-G 11521052-A-G ***
20211758-AT-A 18049872-AT-A P5_Dst 14×T***
13723329-G-A,C 11567653-G-A,C ***
13856271-T-G 11735565-T-G ***
13856280-A-T 11735574-A-T ***
22244999-T-A 20083113-T-A DYZ19 ***
22305467-A-T 20143581-A-T DYZ19 ***
22364634-T-A 20202748-T-A DYZ19 ***
13833166-G-C 11712460-G-C FTB46798 ***
26100509-G-GTT 23954362-G-GTT P1_Y1 35×T***
13446754-C-A 11291078-C-A ***
13696283-G-A 11540607-G-A ***
58973996-G-C,T 56827849-G-C,T 5×ATTCC***
16108702-C-CTTTCTTTCTTTCCTT 13996822-C-CTTTCTTTCTTTCCTT P8_Prx 10×TTTCT***
22269595-T-A 20107709-T-A DYZ19 ***
22269597-C-T 20107711-C-T DYZ19 ***
58978792-T-A 56832645-T-A ***
13839900-G-C 11719194-G-C FTB14656 ***
13455539-T-C 11299863-T-C ***
13815023-G-A 11694317-G-A ***
13453318-G-C,T 11297642-G-C,T 12×CATTC***
58973039-C-G 56826892-C-G ***
13459102-G-A,C 11303426-G-A,C ***
13833165-A-T 11712459-A-T ***
16108662-A-G 13996782-A-G P8_Prx ***
19036743-TA-T 16924863-TA-T ***
20640930-GAA-G 18479044-GAA-G P4_Prx 14×A***
22309918-T-A 20148032-T-A DYZ19 ***
28542555-C-T 26396408-C-T Y795 ******
28785607-GACCAT-G 26639460-GACCAT-G ***
58973913-GTCCATTCCATTCGAGTCCAT-G,GTCCATTCCATTCGAGTCAAT 56827766-GTCCATTCCATTCGAGTCCAT-G,GTCCATTCCATTCGAGTCAAT ***
58974056-C-A 56827909-C-A ***
58975376-G-C 56829229-G-C ***
58978793-C-A 56832646-C-A ***
13839755-CTAATG-C 11719049-CTAATG-C ***
13142948-GCATTCCATTC-G 10632434-GCATTCCATTC-G 11×CATTC***
10021636-GTC-G 10184027-GTC-G ***
9307403-TGTG-AG,T 9469794-TGTG-AG,T ***
20045274-AAAAGAAAG-A,AAAAGAAAGAAAGAAAG 17933394-AAAAGAAAG-A,AAAAGAAAGAAAGAAAG P5_Prx 14×AAAG***
26099827-GTCTC-G,GTC 23953680-GTCTC-G,GTC P1_Y1 27×TC***
10668340-C-CAATCCAATCCACTCA ***
6341641-C-A 6473600-C-A ***
11022934-C-A ***
10965613-CCATTC-C,CCATTA ***
14458558-CAAAAA-C 12337831-CAAAAA-C 21×A***
7139321-C-A 7271280-C-A ***
10764583-TC-T ***
23315755-A-C 21153869-A-C ***
10764586-A-AT ***
11022901-C-T ***
22011826-C-A 19849940-C-A ***
9354168-C-A 9516559-C-A ***
18100704-C-A 15988824-C-A ***
16319412-C-A 14207532-C-A ***
23185748-C-A 21023862-C-A ***
21175745-G-T 19013859-G-T ***
16003010-G-T 13891130-G-T ***
13483434-C-T 11327758-C-T ***
22661945-C-A 20500059-C-A ***
14236026-CAAAAAA-C 12115320-CAAAAAA-C 16×A***
15584446-C-A 13472566-C-A ***
9328991-C-A 9491382-C-A ***
28771475-C-A 26625328-C-A ***
13483450-C-A 11327774-C-A ***
13461818-G-A 11306142-G-A ***
13461833-C-G 11306157-C-G ***
14439162-C-A 12318435-C-A ***
21665687-C-A 19503801-C-A ***
13483440-T-C 11327764-T-C ***
2666523-C-A 2798482-C-A ***
2877864-C-A 3009823-C-A ***
4078156-G-T 4210115-G-T ***
5965724-G-T 6097683-G-T ***
5976670-C-A 6108629-C-A A18097 ***
6000807-T-G 6132766-T-G ***
6803793-C-A 6935752-C-A ***
6978022-C-A 7109981-C-A ***
7043468-C-A 7175427-C-A ***
7184095-C-A 7316054-C-A ***
7207457-AT-A 7339416-AT-A ***
7418831-G-T 7550790-G-T ***
7434185-T-A 7566144-T-A ***
8264658-C-A 8396617-C-A ***
8859766-C-A 8991725-C-A ***
9116953-C-G ***
10008626-C-A 10171017-C-A ***
10013754-A-G 10176145-A-G ***
10023172-G-A 10185563-G-A ***
10023957-T-C 10186348-T-C ***
10693210-A-T ***
10876782-CT-C ***
11031641-C-A ***
13290085-C-A 11134409-C-A ***
13447236-C-A 11291560-C-A ***
13447282-CACTCCATCCCATCCCATTCCACTA-C 11291606-CACTCCATCCCATCCCATTCCACTA-C ***
13453318-GCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTC-G 11297642-GCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTC-G 12×CATTC***
13470444-T-A 11314768-T-A ***
13473583-C-A 11317907-C-A ***
13489527-C-A 11333851-C-A ***
13643121-T-C 11487445-T-C ***
13825004-A-G 11704298-A-G ***
13833443-A-G 11712737-A-G ***
13996232-C-A 11875526-C-A ***
14065937-T-C 11945231-T-C ***
14228128-C-A 12107422-C-A ***
14348745-C-A 12228040-C-A ***
14425931-G-T 12305206-G-T ***
14606328-G-T 12494530-G-T ***
14627387-ACAC-A 12515455-ACAC-A ***
14884694-G-T 12772760-G-T ***
15323720-C-A 13211838-C-A ***
13228501-CTTTTTTT-C,CTTTTTT 19×T***
15424866-G-T 13312986-G-T ***
15477772-CT-C 13365892-CT-C ***
15761887-G-A 13650007-G-A ***
15864333-G-A 13752453-G-A ***
16090136-C-A 13978256-C-A ***
16193867-C-A 14081987-C-A ***
16271260-C-T 14159380-C-T M10501 ***
16458402-C-A 14346522-C-A ***
16967198-C-A 14855318-C-A ***
17504821-C-A 15392941-C-A ***
17519359-C-A 15407479-C-A ***
17532498-C-A 15420618-C-A ***
17653781-C-A 15541901-C-A ***
17717329-C-A 15605449-C-A ***
18129515-C-A 16017635-C-A ***
18819751-C-A 16707871-C-A ***
18914958-C-A 16803078-C-A ***
19284101-A-T 17172221-A-T ***
19485196-C-A 17373316-C-A FTB4019 ***
20084453-TTTCTTTCT-T,TTTCTTTCTTTC 17972573-TTTCTTTCT-T,TTTCTTTCTTTC P5_Dst ***
21139666-C-A 18977780-C-A ***
21223320-C-A 19061434-C-A ***
21380426-G-T 19218540-G-T ***
21729073-C-A 19567187-C-A ***
22001681-G-T 19839795-G-T ***
22592604-T-A 20430718-T-A ***
22823197-T-C 20661311-T-C ***
22849491-CTTTTTTTTTT-C 20687605-CTTTTTTTTTT-C 20×T***
23190332-G-T 21028446-G-T ***
23256280-C-A 21094394-C-A ***
23762712-C-T 21600826-C-T ***
24504502-C-A 22358355-C-A ***
28631709-C-A 26485562-C-A ***
56824633-C-A ***
56826422-CCATT-C,CCATTCGATT ***
56827628-C-T ***
56832389-C-A ***
56833173-CTCCAC-C,CTCCAT ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.