Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > DF21/S192 > FGC3213 > ZZ1 > S3058 > S424 > S426 > S190 > FGC3215 > ZZ23 > Y12464 > ZZ25 > Z17998 > Y16002 > Z17999 > Z18000 > Z36749 > Z36748 > Z36750 > BY9400

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
107672
FB38
107672-A
BigY2
107672
Manual
Edits
17056926-T-TATAATA 14945046-T-TATAATA 12×ATA***+***
13466726-G-C 11311050-G-C BY85745 ****+
15054526-A-T 12942617-A-T BY99450 YY+++
17599897-T-C 15488017-T-C BY116058 YY+++
23165838-T-A 21003952-T-A BY143581 Y+++
22357298-TGTTC-GGTTG 20195412-TGTTC-GGTTG DYZ19 +
25955976-CTGTG-C 23809829-CTGTG-C P1_Y1 16×TG*
9202348-TGGT-GGGG 9364739-TGGT-GGGG *
20105742-T-TTATC,TTATCTATC 17993862-T-TTATC,TTATCTATC P5_Dst 14×TATC*
22259124-A-G 20097238-A-G DYZ19 ****
22430120-C-A 20268234-C-A DYZ19 ******
26224593-A-G 24078446-A-G P1_Y1 ****
13450521-CTTCACTCCAC-ATCCATCCCAT 11294845-CTTCACTCCAC-ATCCATCCCAT *
22239693-G-A 20077807-G-A DYZ19 *
19948179-CTC-TTT 17836299-CTC-TTT P5_Prx *
13688135-T-C 11532459-T-C *
16242402-CTT-C,CT 14130522-CTT-C,CT 18×T*
10661326-GCATC-CCATC,CCATT *
13447321-CCACTCCACTCCACTCCACTCCACTCCACT-ACACTCCACTCCACA,CCACTCCACTCCACA 11291645-CCACTCCACTCCACTCCACTCCACTCCACT-ACACTCCACTCCACA,CCACTCCACTCCACA *
13449071-TT-CT,TC 11293395-TT-CT,TC *
13449764-TATTCCATTCT-AATTCCATCAC,CATTGCATTCC 11294088-TATTCCATTCT-AATTCCATCAC,CATTGCATTCC *
13451088-TA-CA,CG 11295412-TA-CA,CG *
13451185-CTCCTTT-TTC,TTCCATTC 11295509-CTCCTTT-TTC,TTCCATTC *
13452374-TTCCATTCCATTCCATTCCATTCAAATACACTCCTTGC-GTCAAATCCACTCCATGA 11296698-TTCCATTCCATTCCATTCCATTCAAATACACTCCTTGC-GTCAAATCCACTCCATGA *
13850293-A-AATGGA,AATGGG 11729587-A-AATGGA,AATGGG *
56826746-C-CCATTC,T *
56826960-TCCATTAGTTTCCATTCCA-GGCATTCCATTCCATTCCA,TCCT *
56830657-TTCCACTG-CTCCACTT,CTCCCCTT *
56831127-TTTT-GTTG,GTTT *
56831649-TCCAC-CCCAT,TCCACTCCATCCCAT *
56831670-CC-GA,GC *
56831681-GACTCCACTCAACTCC-CATTCCACTCCACTCAAATCC,CATTCCCCTCCTCTCA *
56831762-TG-CC,CT *
56832479-TTCCATTCCATTCCACCGCACTCCACTCCACTCCACTCA-CTCAATTCCATTCCACTCCACTCCACTCCAATCC,TTCCATTCCATTCCACTGCACTCCACTCCACTCA *
56833843-CCCACTCCACT-CCCACT,TCCATC 4×CCACT*
56836673-AAGC-AAGA,CAGC *
19719327-CAA-C,CA 17607447-CAA-C,CA P5_Prx 17×A*
20500942-GA-G,GAA 18339056-GA-G,GAA P5_Dst 15×A*
22229585-TCAA-CCAC,TCAC 20067699-TCAA-CCAC,TCAC DYZ19 *
22257323-GG-CT,GT 20095437-GG-CT,GT DYZ19 *
22284679-T-C 20122793-T-C DYZ19 *
22421286-GAAC-CAAT,GACC 20259400-GAAC-CAAT,GACC DYZ19 *
22505044-GCCTT-ACCTC,ACCTT 20343158-GCCTT-ACCTC,ACCTT DYZ19 *
22510227-GTA-ATA,ATG 20348341-GTA-ATA,ATG DYZ19 *
24222264-CTT-C,CT 22076117-CTT-C,CT P3_b1 15×T*
25240239-CTT-C,CT 23094092-CTT-C,CT P2_r1 22×T*
27791898-CTCTTCC-TTCTTCT 25645751-CTCTTCC-TTCTTCT P1_Y2 *
20233046-CA-C 18071160-CA-C P5_Dst 10×A**
27937836-GA-G 25791689-GA-G P1_Y2 17×A**
28406839-CA-C 26260692-CA-C P1_gr2 16×A**
22332659-A-G 20170773-A-G DYZ19 **
22481197-G-A 20319311-G-A DYZ19 **
15495182-C-A 13383302-C-A ****
24363631-CTCTTTT-C 22217484-CTCTTTT-C **
16162095-CA-C 14050215-CA-C P8_Dst 19×A**
17713845-ATCTTC-TTTTT 15601965-ATCTTC-TTTTT **
20062533-TTTC-GTTT 17950653-TTTC-GTTT P5_Prx **
22052471-C-A 19890585-C-A **
17203349-C-T 15091469-C-T **
20593055-CA-C 18431169-CA-C P5_Dst 22×A**
23435202-C-TTT 21273316-C-TTT **
6992464-C-A 7124423-C-A **
58990648-CTTCC-GTTGA 56844501-CTTCC-GTTGA **
22077112-C-T 19915226-C-T **
6161451-A-G 6293410-A-G IR3_Dst **
22481178-A-G 20319292-A-G DYZ19 **
22497824-T-G 20335938-T-G DYZ19 **
58994903-T-A 56848756-T-A **
9592617-T-G 9755008-T-G IR3_Prx **
22235087-ATACAA-GTAAAG 20073201-ATACAA-GTAAAG DYZ19 **
22499406-G-A 20337520-G-A DYZ19 **
15533428-C-A 13421548-C-A **
6916222-C-A 7048181-C-A **
10821816-T-TCACTC **
16320394-C-CA 14208514-C-CA 10×A**
10014984-A-ATT 10177375-A-ATT 27×T**
2746024-T-C 2877983-T-C **
2773416-G-T 2905375-G-T **
2885489-G-A 3017448-G-A **
2926654-C-A 3058613-C-A **
2949098-C-A 3081057-C-A **
3007748-C-A 3139707-C-A ****
3022104-G-T 3154063-G-T ****
3091974-G-A 3223933-G-A **
3110446-C-A 3242405-C-A **
3285259-G-T 3417218-G-T **
3366639-C-A 3498598-C-A **
3367120-C-A 3499079-C-A **
3389581-C-A 3521540-C-A **
3574522-G-T 3706481-G-T FTB47139 **
3610159-C-A 3742118-C-A **
3630742-T-C 3762701-T-C **
3660317-G-T 3792276-G-T **
3732646-G-T 3864605-G-T 10×T**
3758897-C-A 3890856-C-A **
3768659-C-T 3900618-C-T **
3771055-C-A 3903014-C-A **
3836401-C-A 3968360-C-A **
4086015-G-T 4217974-G-T **
4101130-T-A 4233089-T-A **
4107821-G-C 4239780-G-C FT319534 **
4179238-C-A 4311197-C-A **
4213056-C-A 4345015-C-A **
4240929-G-A 4372888-G-A **
4271321-C-A 4403280-C-A **
4298206-C-A 4430165-C-A **
4325642-C-A 4457601-C-A **
4326593-G-T 4458552-G-T FTA26012 **
4347614-C-A 4479573-C-A **
4432556-G-T 4564515-G-T **
4557668-C-A 4689627-C-A **
4567810-G-T 4699769-G-T **
4747857-T-A 4879816-T-A **
4747877-G-T 4879836-G-T **
4847967-C-A 4979926-C-A ****
4898078-G-T 5030037-G-T **
4908074-C-A 5040033-C-A **
4925000-C-A 5056959-C-A **
4970023-G-T 5101982-G-T **
5011398-T-C 5143357-T-C **
5084108-C-A 5216067-C-A **
5084121-C-A 5216080-C-A **
5127768-C-A 5259727-C-A **
5201017-G-T 5332976-G-T **
5242247-C-A 5374206-C-A **
5266999-C-T 5398958-C-T **
5267947-A-G 5399906-A-G **
5274307-T-A 5406266-T-A **
5350314-A-C 5482273-A-C ****
5367004-C-A 5498963-C-A **
5388547-T-C 5520506-T-C **
5457900-G-A 5589859-G-A **
5534734-T-C 5666693-T-C FT45890 **
5587038-A-G 5718997-A-G **
5635259-G-T 5767218-G-T **
5706654-G-T 5838613-G-T **
5754988-G-T 5886947-G-T **
5888316-T-A 6020275-T-A **
5924336-C-A 6056295-C-A **
5926807-G-T 6058766-G-T **
5937547-C-A 6069506-C-A ****
5937594-C-A 6069553-C-A ****
6096860-C-A 6228819-C-A **
6125761-C-A 6257720-C-A **
6156307-C-A 6288266-C-A IR3_Dst **
6179507-CATT-C 6311466-CATT-C IR3_Dst **
6215965-G-T 6347924-G-T IR3_Dst **
6352763-G-T 6484722-G-T **
6374273-G-T 6506232-G-T **
6424837-C-A 6556796-C-A **
6492632-C-A 6624591-C-A **
6553612-G-C 6685571-G-C **
6646039-C-A 6777998-C-A **
6692829-CAAA-C 6824788-CAAA-C 14×A**
6729621-C-A 6861580-C-A **
6765588-T-G 6897547-T-G **
6765600-A-G 6897559-A-G **
6765603-A-G 6897562-A-G **
6770526-G-T 6902485-G-T **
6790247-C-A 6922206-C-A **
6892572-C-A 7024531-C-A **
6917115-C-A 7049074-C-A **
6925613-G-A 7057572-G-A **
6977318-C-A 7109277-C-A **
6978302-C-A 7110261-C-A **
7040245-G-T 7172204-G-T **
7043422-G-T 7175381-G-T **
7085260-C-A 7217219-C-A **
7100481-C-A 7232440-C-A **
7109302-C-G 7241261-C-G **
7111899-C-A 7243858-C-A **
7116215-C-A 7248174-C-A ****
7160830-C-A 7292789-C-A **
7186620-C-A 7318579-C-A **
7201441-C-T 7333400-C-T **
7201970-C-A 7333929-C-A **
7208337-C-A 7340296-C-A **
7237924-C-A 7369883-C-A **
7247616-C-A 7379575-C-A FT280538 *****
7255070-C-A 7387029-C-A ****
7306465-C-A 7438424-C-A **
7310415-C-G 7442374-C-G **
7319652-G-T 7451611-G-T FTA38121 **
7341108-G-T 7473067-G-T **
7783131-C-A 7915090-C-A **
7964712-C-G 8096671-C-G **
7990228-C-A 8122187-C-A **
8058525-C-A 8190484-C-A **
8075807-T-C 8207766-T-C **
8076760-C-G 8208719-C-G **
8173953-T-C 8305912-T-C **
8217932-G-T 8349891-G-T **
8279833-GT-G 8411792-GT-G 8×T**
8343920-C-A 8475879-C-A **
8668521-C-A 8800480-C-A **
8776477-C-A 8908436-C-A **
8786656-C-A 8918615-C-A **
8811238-C-A 8943197-C-A **
8850733-C-A 8982692-C-A **
9113851-G-T **
8983060-G-T 9145451-G-T **
9047012-A-C 9209403-A-C **
9427562-C-A 9589953-C-A **
9465218-G-T 9627609-G-T **
9475745-G-T 9638136-G-T **
9805217-C-A 9967608-C-A **
9927348-C-A 10089739-C-A **
9934250-C-A 10096641-C-A **
9946068-A-T 10108459-A-T **
9996235-C-A 10158626-C-A **
10018060-A-T 10180451-A-T **
10018109-T-G 10180500-T-G **
10657145-C-A **
10662614-T-C **
10662618-G-C **
10662841-C-A ****
10663540-C-A **
10663678-TTTCCATTCCA-T **
10671767-C-A **
10676675-C-A **
10688157-C-A ****
10691239-C-A **
10693166-C-A **
10745970-C-A **
10747744-C-T **
10752707-C-G **
10754177-C-T **
10755331-C-G **
10765972-C-A **
10767883-C-A **
10769021-T-A **
10769640-C-T **
10769645-CATGCT-C **
10769662-C-G **
10769688-TCCC-T **
10769696-A-T **
10769698-G-C **
10769702-T-CCTC **
10772081-C-T **
10773192-C-T **
10773991-G-T *****
10774192-C-A **
10775824-T-A **
10776912-C-A **
10784920-C-A **
10786024-C-A **
10787150-C-A **
10803142-T-C **
10808076-C-A **
10808561-C-A **
10819710-C-A ****
10824206-C-A **
10825045-C-A *****
10839120-C-A **
10839122-C-A **
10840933-G-T **
10844799-G-T FT433800 ****
10849153-C-A ****
10852661-T-C ****
10857434-A-T **
10863795-G-T **
10874506-C-T **
10885091-C-T **
10885105-T-A **
10888269-G-C **
10888279-T-C **
10888283-A-G **
10888289-T-C **
10888294-T-C **
10888301-C-CCATTT **
10888579-G-C **
10898341-TC-T **
10898369-A-T **
10898391-T-A **
10898404-T-A **
10898410-C-A FT435854 **
10898413-T-C **
10898414-G-A **
10898920-C-A *****
10905017-C-A *****
10911440-C-A **
10922183-C-A **
10928207-C-G **
10928210-T-C **
10928229-AGTCCT-A **
10928240-A-G **
10928254-A-G **
10928255-C-T **
10929854-G-T *****
10939644-T-A **
10946397-G-T **
10946411-C-T **
10946414-A-C **
10946441-C-T **
10946446-A-T **
10946450-ACTCCAGTCCAG-T **
10946463-C-G **
10947164-C-A ****
10954778-C-A **
10954931-C-A **
10956231-A-T ****
10959703-T-C **
10963124-A-G **
10967665-G-T **
10970852-C-G **
10973930-C-G **
10973953-C-A **
10973996-C-G **
10975446-C-A **
10980272-C-T FT439021 **
10980302-C-G **
10982089-C-A **
10982909-T-C **
10985904-C-A ****
10988717-C-A **
10988770-C-G **
10992249-T-A **
10992251-C-CATTTT **
10997910-A-G **
10999800-C-T **
11004806-T-A **
11013224-A-C **
11019750-C-A *****
11019978-C-A **
11028040-C-A **
11028107-C-A **
11033760-C-A **
13223739-AGAGG-A 11068063-AGAGG-A 4×GAGG**
13237669-C-A 11081993-C-A **
13238025-C-A 11082349-C-A **
13242735-T-C 11087059-T-C **
13257506-C-A 11101830-C-A **
13258459-C-A 11102783-C-A **
13294232-G-T 11138556-G-T **
13315562-C-A 11159886-C-A **
13320763-C-A 11165087-C-A **
13460760-T-C 11305084-T-C **
13460787-C-T 11305111-C-T **
13486603-C-A 11330927-C-A **
13509049-C-A 11353373-C-A **
13554760-C-A 11399084-C-A **
13578575-A-G 11422899-A-G **
13578762-C-A 11423086-C-A **
13604301-C-A 11448625-C-A **
13637229-C-A 11481553-C-A **
13639223-A-G 11483547-A-G **
11643984-G-T **
11644587-G-T **
11668885-A-G **
11677307-A-T **
13860650-G-A 11739944-G-A **
13888609-CT-C 11767903-CT-C 8×T**
13922603-C-A 11801897-C-A **
13928447-C-A 11807741-C-A **
13932459-C-A 11811753-C-A **
13941693-ATTT-A 11820987-ATTT-A 15×T**
14106982-C-A 11986276-C-A **
14181170-A-G 12060464-A-G **
14181653-C-T 12060947-C-T **
14203374-T-C 12082668-T-C **
14204888-G-A 12084182-G-A **
14273698-G-T 12152992-G-T **
14283928-C-A 12163222-C-A **
14291072-G-T 12170366-G-T ****
14297955-C-A 12177249-C-A **
14301967-G-A 12181261-G-A **
14307755-T-A 12187049-T-A **
14427419-CAA-C 12306694-CAA-C 12×A**
14431336-C-A 12310609-C-A ****
14445573-G-A 12324846-G-A **
14451211-G-A 12330484-G-A **
14451652-A-G 12330925-A-G **
14490282-C-A 12369551-C-A **
14558290-C-A 12446491-C-A **
14562366-TA-T 12450566-TA-T **
14562384-A-T 12450584-A-T **
14606286-C-A 12494488-C-A **
14627107-T-A 12515175-T-A **
14627135-C-A 12515203-C-A **
14760995-C-A 12649064-C-A **
14823527-T-A 12711594-T-A **
14832192-T-C 12720259-T-C **
15044314-C-A 12932404-C-A **
15168246-C-A 13056332-C-A **
15210814-G-T 13098900-G-T **
15218620-C-A 13106706-C-A **
15221973-C-A 13110059-C-A **
15280598-T-C 13168697-T-C **
15290140-C-A 13178239-C-A **
15365348-C-A 13253468-C-A **
15400059-C-A 13288179-C-A **
15468460-C-A 13356580-C-A **
15491937-GTGTGTA-G 13380057-GTGTGTA-G **
15495185-C-A 13383305-C-A **
15655131-C-A 13543251-C-A **
15677277-T-A 13565397-T-A **
15699857-C-A 13587977-C-A **
15733865-G-A 13621985-G-A **
15749136-C-A 13637256-C-A **
15768999-G-A 13657119-G-A **
15904072-C-A 13792192-C-A **
15928603-C-A 13816723-C-A **
15946726-C-A 13834846-C-A **
15957668-C-A 13845788-C-A **
16006847-C-A 13894967-C-A **
16044391-C-A 13932511-C-A **
16060662-C-A 13948782-C-A **
16073046-C-A 13961166-C-A **
16084030-G-T 13972150-G-T **
16176799-A-T 14064919-A-T **
16186706-C-CA 14074826-C-CA 9×A*****
16245952-A-G 14134072-A-G **
16266176-A-G 14154296-A-G **
16267088-TCA-T 14155208-TCA-T **
16270992-C-A 14159112-C-A **
16422143-T-A 14310263-T-A **
16429618-G-T 14317738-G-T **
16462448-C-A 14350568-C-A **
16462607-A-G 14350727-A-G **
16475082-T-A 14363202-T-A **
16605615-C-A 14493735-C-A **
16607923-C-A 14496043-C-A **
16701935-G-T 14590055-G-T **
16705192-C-A 14593312-C-A **
16729172-GTTTT-G 14617292-GTTTT-G 22×T**
16885102-C-A 14773222-C-A **
16915024-A-G 14803144-A-G **
17095390-C-A 14983510-C-A **
17175630-C-T 15063750-C-T **
17203354-A-C 15091474-A-C **
17355643-C-A 15243763-C-A **
17379776-C-A 15267896-C-A **
17403706-C-A 15291826-C-A **
17433909-C-A 15322029-C-A **
17502771-T-C 15390891-T-C **
17503414-C-A 15391534-C-A **
17580144-T-C 15468264-T-C **
17667022-C-A 15555142-C-A **
17737738-C-A 15625858-C-A **
17843170-C-A 15731290-C-A **
17859994-G-T 15748114-G-T **
17884516-C-A 15772636-C-A **
18094169-C-A 15982289-C-A **
18119614-C-A 16007734-C-A **
18155704-C-A 16043824-C-A **
18183194-C-A 16071314-C-A **
18407960-GA-G 16296080-GA-G P6_Gap ****
18511753-C-A 16399873-C-A P6_Dst **
18650528-C-A 16538648-C-A **
18661674-C-A 16549794-C-A **
18717724-C-A 16605844-C-A Y31890 **
18793780-C-A 16681900-C-A **
18933709-T-C 16821829-T-C **
18990411-C-A 16878531-C-A **
19053216-A-G 16941336-A-G **
19073696-G-T 16961816-G-T **
19126412-C-A 17014532-C-A **
19130738-CTTTTTTT-C 17018858-CTTTTTTT-C 33×T**
19253233-G-T 17141353-G-T ****
19286389-C-A 17174509-C-A **
19333293-C-A 17221413-C-A **
19460659-A-T 17348779-A-T **
19507021-C-A 17395141-C-A **
19748923-A-T 17637043-A-T P5_Prx **
20458865-G-A 18296979-G-A P5_Dst **
20612063-G-T 18450177-G-T P5_Dst **
20612077-G-T 18450191-G-T P5_Dst **
20809846-G-A 18647960-G-A P4_Gap **
21155276-T-A 18993390-T-A **
21196799-G-A 19034913-G-A FTA15295 **
21243960-G-T 19082074-G-T **
21315201-G-T 19153315-G-T **
21328812-A-AG 19166926-A-AG **
21362398-C-A 19200512-C-A **
21367616-C-A 19205730-C-A **
21409664-C-A 19247778-C-A **
21488775-C-A 19326889-C-A **
21543345-C-A 19381459-C-A **
21543356-C-A 19381470-C-A **
21596948-C-A 19435062-C-A **
21624540-C-T 19462654-C-T **
21677990-C-A 19516104-C-A **
21818997-C-A 19657111-C-A **
21840047-C-A 19678161-C-A **
21919480-C-A 19757594-C-A **
22077106-T-C 19915220-T-C **
22077107-G-T 19915221-G-T **
22091367-A-G 19929481-A-G **
22211898-C-A 20050012-C-A **
22307243-A-G 20145357-A-G DYZ19 **
22339753-G-A 20177867-G-A DYZ19 **
22457415-C-A 20295529-C-A DYZ19 **
22485774-A-C 20323888-A-C DYZ19 **
22485782-A-T 20323896-A-T DYZ19 **
22629738-C-A 20467852-C-A **
22696081-G-A 20534195-G-A **
22811973-C-A 20650087-C-A **
22841983-C-A 20680097-C-A **
22874388-C-A 20712502-C-A **
22965749-A-G 20803863-A-G **
23019417-C-A 20857531-C-A **
23048218-C-A 20886332-C-A **
23062773-G-A 20900887-G-A **
23065752-T-C 20903866-T-C **
23111665-G-T 20949779-G-T **
23186523-C-A 21024637-C-A **
23260834-C-A 21098948-C-A **
23306597-C-A 21144711-C-A **
23372094-C-A 21210208-C-A **
23439054-A-AT 21277168-A-AT 10×T**
24409220-C-T 22263073-C-T **
24435414-C-A 22289267-C-A **
24475184-T-C 22329037-T-C **
24634233-C-A 22488086-C-A P3_t2 **
24961035-G-T 22814888-G-T g1 **
25031173-C-A 22885026-C-A g1 **
25592900-CTATA-C 23446753-CTATA-C P1_gr1 12×TA**
25980187-A-AAAC 23834040-A-AAAC P1_Y1 10×AAT**
26229945-T-TC 24083798-T-TC P1_Y1 **
26593011-C-A 24446864-C-A P1_g2 **
27484447-C-A 25338300-C-A P1_Y2 **
27595985-A-T 25449838-A-T P1_Y2 **
27815616-G-T 25669469-G-T P1_Y2 **
27842207-G-T 25696060-G-T P1_Y2 **
27856381-G-T 25710234-G-T P1_Y2 **
27952083-CTG-C 25805936-CTG-C P1_Y2 **
28076574-T-A 25930427-T-A P1_Y2 **
28462085-C-A 26315938-C-A **
28465148-C-A 26319001-C-A **
28484520-C-A 26338373-C-A **
28497107-C-A 26350960-C-A **
28499353-C-A 26353206-C-A **
28502326-G-T 26356179-G-T **
28505382-A-C 26359235-A-C **
28535578-C-A 26389431-C-A **
28537092-C-A 26390945-C-A **
28545238-C-A 26399091-C-A **
28574539-A-G 26428392-A-G **
28583134-A-T 26436987-A-T **
28593660-C-A 26447513-C-A **
28610247-C-A 26464100-C-A **
28612230-C-A 26466083-C-A FGC49328 **
28631600-T-C 26485453-T-C **
28659990-C-A 26513843-C-A **
28665168-C-A 26519021-C-A **
28697853-C-A 26551706-C-A **
28698897-C-A 26552750-C-A **
28708360-T-C 26562213-T-C **
28722602-C-A 26576455-C-A **
56846231-G-T **
56848730-C-T **
56848733-G-A **
56848760-C-A **
56848775-GACAAA-G **
58994929-C-A 56848782-C-A **
56848797-C-G **
56848804-A-T **
56849655-G-T **
27437-C-A **
16421068-A-C 14309188-A-C **
10671280-TGGAT-AGTAC **
10671308-ATGCCGAGC-GTGCAGAGG **
10984450-TTCCGTTA-CTCCATTC **
22332574-A-C 20170688-A-C DYZ19 **
10789463-GC-AG **
10658499-AG-CA **
10671295-CACTC-TACCT **
20331371-G-T 18169485-G-T P5_Dst **
22493132-C-G 20331246-C-G DYZ19 **
22481956-T-A 20320070-T-A DYZ19 **
22332576-A-T 20170690-A-T DYZ19 **
22332606-T-G 20170720-T-G DYZ19 **
22482420-T-A 20320534-T-A DYZ19 **
2833175-ACCCT-CCCC 2965134-ACCCT-CCCC **
5992661-G-T 6124620-G-T **
7717733-CTTCC-TTTCT 7849692-CTTCC-TTTCT **
7897985-G-A 8029944-G-A **
10799565-TATTT-CATTC **
10799576-TC-AT **
10807293-TTCAACCAGAA-GTCACCCAGAT **
10808635-GC-CT **
10818690-CCACTCA-GCACGCT **
10887481-CGACTGGC-TGATTGGA **
10893564-CCTGTAC-AT **
10984501-AAGTGC-GAGAGG **
10987900-TCA-ACT **
11013584-TGTGTG-GGAGTA **
13291866-G-T 11136190-G-T **
13487725-GCAT-CAAG 11332049-GCAT-CAAG **
13727433-T-A 11571757-T-A **
17006257-GTTTC-TTTT 14894377-GTTTC-TTTT **
18872213-TTTCTTTCCTTATTTCTTCCTTCCTTCCTTCCTTTCTCTT-CTTATTTCTTCCTTCCTTCCTTCCTTTC 16760333-TTTCTTTCCTTATTTCTTCCTTCCTTCCTTCCTTTCTCTT-CTTATTTCTTCCTTCCTTCCTTCCTTTC **
19469877-A-CC 17357997-A-CC 12×C**
21464774-CTTC-A 19302888-CTTC-A **
23108745-G-T 20946859-G-T **
23488835-AAA-T 21326949-AAA-T **
28797853-GAGA-TGCT 26651706-GAGA-TGCT **
28818260-TCA-CCG 26672113-TCA-CCG **
56826584-ATTCCA-GTCCTG **
56842237-CCCT-TCCA **
56847469-CTAA-TTAC **
56847769-A-G **
56848730-CTAG-TTCA **
56848776-ACAAATC-TA **
56868049-C-A **
9592965-TTG-T 9755356-TTG-T IR3_Prx **
18354285-GAAACAGAGAAAGAAAGAAAGAAAG-CAGAGAAAGAAAGAAAGAAAGAGAA 16242405-GAAACAGAGAAAGAAAGAAAGAAAG-CAGAGAAAGAAAGAAAGAAAGAGAA P6_Prx **
6232329-C-A 6364288-C-A IR3_Dst **
9542197-CCTTT-C 9704588-CCTTT-C IR3_Prx 5×CTTT**
9623616-G-A 9786007-G-A IR3_Prx **
9634374-CAAAT-C 9796765-CAAAT-C IR3_Prx 6×AAAT**
9634767-C-A 9797158-C-A IR3_Prx **
9679237-G-T 9841628-G-T IR3_Prx **
18009540-G-T 15897660-G-T P7_Dst **
18437417-G-T 16325537-G-T P6_Dst **
18506222-TGAAGGAG-T 16394342-TGAAGGAG-T P6_Dst **
19680457-C-A 17568577-C-A P5_Prx **
19784375-G-T 17672495-G-T P5_Prx **
19916377-G-T 17804497-G-T P5_Prx **
20111096-G-T 17999216-G-T P5_Dst **
20247101-GA-G 18085215-GA-G P5_Dst **
20325212-C-A 18163326-C-A P5_Dst **
20541829-G-T 18379943-G-T P5_Dst **
20851695-C-A 18689809-C-A P4_Dst **
20854673-G-T 18692787-G-T P4_Dst **
20967616-C-T 18805730-C-T P4_Dst **
22234333-TATCAG-ACCAC 20072447-TATCAG-ACCAC DYZ19 **
22332598-TC-T 20170712-TC-T DYZ19 **
22351503-T-G 20189617-T-G DYZ19 **
22351538-T-TC 20189652-T-TC DYZ19 **
22481186-T-C 20319300-T-C DYZ19 **
22496292-G-T 20334406-G-T DYZ19 **
22497740-T-C 20335854-T-C DYZ19 **
22497784-A-G 20335898-A-G DYZ19 **
22497817-T-C 20335931-T-C DYZ19 **
22503693-TGAAT-CATAG 20341807-TGAAT-CATAG DYZ19 **
21749871-C-A **
24558088-A-G 22411941-A-G P3_t2 **
24600442-C-TTCTTTCTT 22454295-C-TTCTTTCTT P3_t2 18×TCTT**
24682518-T-C 22536371-T-C P3_b2 **
24700544-C-A 22554397-C-A P3_b2 **
24775049-TG-T 22628902-TG-T P3_b2 **
24775405-C-A 22629258-C-A P3_b2 **
24923226-G-T 22777079-G-T g1 **
24940461-C-A 22794314-C-A g1 **
25236957-G-T 23090810-G-T P2_r1 **
25413832-C-A 23267685-C-A P2_r2 **
25498546-C-A 23352399-C-A P2_r2 **
25544892-TA-T 23398745-TA-T P1_gr1 9×A**
25606696-T-C 23460549-T-C P1_gr1 **
25628439-CTTTTT-C 23482292-CTTTTT-C P1_b3 26×T**
26038079-G-A 23891932-G-A P1_Y1 **
26090603-T-C 23944456-T-C P1_Y1 **
26364862-C-A 24218715-C-A P1_Y1 **
26478079-AGT-GGC 24331932-AGT-GGC P1_Y1 **
26494155-C-A 24348008-C-A P1_Y1 **
27138811-G-T 24992664-G-T P1_g3 **
27167185-ACATAAAACATT-A 25021038-ACATAAAACATT-A P1_g3 **
27186323-GAA-G 25040176-GAA-G P1_g3 19×A**
27187556-CA-C 25041409-CA-C P1_g3 **
27275801-G-T 25129654-G-T P1_g3 **
27353523-C-T 25207376-C-T P1_g3 **
27391314-G-C 25245167-G-C P1_g3 **
27412875-GTG-T 25266728-GTG-T P1_g3 **
27431029-C-A 25284882-C-A P1_g3 **
27635857-C-A 25489710-C-A P1_Y2 **
27741749-C-T 25595602-C-T P1_Y2 **
27860204-CA-C 25714057-CA-C P1_Y2 **
27866972-C-A 25720825-C-A P1_Y2 **
27892754-C-A 25746607-C-A P1_Y2 **
27945303-GA-G 25799156-GA-G P1_Y2 **
27973150-AGCATT-A 25827003-AGCATT-A P1_Y2 **
28015550-G-T 25869403-G-T P1_Y2 **
28065930-G-A 25919783-G-A P1_Y2 **
28228330-T-A 26082183-T-A P1_b4 **
27150720-A-AT 25004573-A-AT P1_g3 12×T***
13715356-C-G 11559680-C-G ***
22512088-G-C 20350202-G-C DYZ19 ***
16114665-TTA-T 14002785-TTA-T P8_Prx 9×TA***
25652602-C-CT 23506455-C-CT P1_b3 11×T***
20000745-AT-A 17888865-AT-A P5_Prx 11×T***
22360234-A-C 20198348-A-C DYZ19 ***
22359716-A-C 20197830-A-C DYZ19 ***
22447848-T-A 20285962-T-A BY3919 DYZ19 ***
27976945-CA-C 25830798-CA-C P1_Y2 12×A***
8549032-G-GTT 8680991-G-GTT 23×T***
27255256-G-GA 25109109-G-GA P1_g3 14×A***
22469673-G-T 20307787-G-T DYZ19 ***
9202319-T-G 9364710-T-G ***
58979152-AAG-GAA 56833005-AAG-GAA ***
7464057-G-A 7596016-G-A IR1_L ***
16533538-CAT-C 14421658-CAT-C ***
14137729-CCT-C 12017023-CCT-C ******
22498385-G-A 20336499-G-A DYZ19 ***
22298663-T-A 20136777-T-A DYZ19 ***
24763477-T-TTG 22617330-T-TTG P3_b2 19×TG***
9589945-CT-C 9752336-CT-C IR3_Prx 10×T***
25689959-TA-T 23543812-TA-T P1_b3 13×A***
9988037-G-A 10150428-G-A ***
22361037-GT-TC 20199151-GT-TC DYZ19 ***
22504082-CCAGT-GCAGA 20342196-CCAGT-GCAGA DYZ19 ***
58979206-TGCG-AGTA 56833059-TGCG-AGTA ***
22234403-G-A 20072517-G-A DYZ19 ***
9316196-C-A 9478587-C-A ***
26279997-G-T 24133850-G-T P1_Y1 ***
24771297-A-AT 22625150-A-AT P3_b2 12×T***
22504068-TAA-CAT 20342182-TAA-CAT DYZ19 ***
13476188-ATAAAT-TTACAC 11320512-ATAAAT-TTACAC ***
22488722-G-C 20326836-G-C DYZ19 ***
22493065-G-A 20331179-G-A DYZ19 ***
22481820-G-T 20319934-G-T DYZ19 ***
22348874-A-T 20186988-A-T DYZ19 ***
25115872-G-GT 22969725-G-GT g1 9×T***
6400951-C-A 6532910-C-A FT226104 ***
17346138-CTTTC-TTTTT 15234258-CTTTC-TTTTT ***
18321273-CTG-TTT 16209393-CTG-TTT P6_Prx ***
22500957-T-C 20339071-T-C DYZ19 ***
23538557-G-GA 21376671-G-GA 11×A***
13843994-AGAC-GGAA 11723288-AGAC-GGAA ***
8631383-CTTTTTT-C 8763342-CTTTTTT-C 26×T***
17169919-CAA-C 15058039-CAA-C 11×A***
2810366-ATTTTTTTTTTT-A 2942325-ATTTTTTTTTTT-A 23×T******
6121066-C-A 6253025-C-A ***
6205660-G-T 6337619-G-T IR3_Dst ***
7660016-TAA-T 7791975-TAA-T 14×A***
8344064-G-T 8476023-G-T ***
8350564-A-G 8482523-A-G ******
9508060-C-A 9670451-C-A ***
9978912-C-A 10141303-C-A ***
10685327-C-A ******
10792322-C-A ***
10848426-C-A ******
10987127-C-T ***
11001689-G-T ******
11016285-T-A ******
13456721-C-A 11301045-C-A ******
13488971-C-A 11333295-C-A ***
13489629-C-G 11333953-C-G ***
13596576-C-T 11440900-C-T ******
13857880-G-T 11737174-G-T ******
14143069-C-A 12022363-C-A ******
14232961-C-A 12112255-C-A ***
14285877-C-A 12165171-C-A ******
14356890-CTTTT-C,CT 12236185-CTTTT-C,CT 17×T******
14767008-C-T 12655077-C-T F11511 ***
15430372-C-A 13318492-C-A ******
15785716-C-A 13673836-C-A ******
15971761-G-GTT 13859881-G-GTT 11×T***
16180183-C-A 14068303-C-A ***
16428483-C-A 14316603-C-A FT408198 ******
17031061-C-A 14919181-C-A ******
18691838-CTTT-C,CTT 16579958-CTTT-C,CTT 14×T***
18793534-G-T 16681654-G-T ******
21133381-C-A 18971495-C-A ***
21445120-C-A 19283234-C-A ******
21923295-ATTT-A,ATT 19761409-ATTT-A,ATT 15×T***
23054356-C-A 20892470-C-A ******
23188051-C-A 21026165-C-A ***
23952831-C-A 21806684-C-A ***
24406715-C-A 22260568-C-A ******
56827177-C-A ***
56849585-A-AG ***
56849588-GT-G ***
56849592-G-A ***
18487808-TA-T 16375928-TA-T P6_Dst 19×A***
17050084-CT-C,CTT 14938204-CT-C,CTT 14×T***
17284532-CTTT-C,CTTTT 15172652-CTTT-C,CTTTT 21×T***
20516474-A-G 18354588-A-G P5_Dst ***
17648009-CAAAA-C,CAAA 15536129-CAAAA-C,CAAA 17×A***
7126524-CTTTTT-C 7258483-CTTTTT-C 23×T***
18378959-CTTTT-C 16267079-CTTTT-C P6_Prx 28×T***
16406853-AT-A,ATT 14294973-AT-A,ATT 20×T***
9671339-CTT-C 9833730-CTT-C IR3_Prx 14×T***
23293700-C-A 21131814-C-A ***
11004393-GCCATTCCATTCCATTCCATT-G ***
6792628-CAAA-C,CAA 6924587-CAAA-C,CAA 18×A***
19849833-C-A 17737953-C-A P5_Prx ***
10652357-TT-CA ***
15171113-C-A 13059199-C-A ***
22500934-T-A 20339048-T-A DYZ19 ***
22493089-G-C 20331203-G-C DYZ19 ***
16629335-CAAA-C,CAA 14517455-CAAA-C,CAA 19×A***
2979209-T-A 3111168-T-A ***
5204641-CA-C,CAA 5336600-CA-C,CAA 22×A***
6444954-ACA-G 6576913-ACA-G ***
6786570-C-A 6918529-C-A ***
6923212-C-A 7055171-C-A ***
7935855-TAAAAA-T,TAAAAAA 8067814-TAAAAA-T,TAAAAAA 22×A***
8631383-CTTTTTTT-C,CTTTT 8763342-CTTTTTTT-C,CTTTT 26×T***
10658418-CATGCCAC-AAT ***
10662614-TATTG-CATTC ***
10671456-GTTG-ATTA ***
10671479-AC-CT ***
10934813-AACATTT-AACATTA,CACATTT ***
10965167-CCAGG-GCAGT ***
13297411-G-T 11141735-G-T ***
13450413-CCATTCCATTCCATTCTATTCCATTCCA-GCATTCCATTCCG 11294737-CCATTCCATTCCATTCTATTCCATTCCA-GCATTCCATTCCG ***
13488959-GCC-CCT 11333283-GCC-CCT ***
13488971-CC-AG 11333295-CC-AG ***
13489619-ACCCCCACCACCACCCACCACCCCC-CCTCCCCACCAGCAACCCCAGCCCA,CGTCCTCACCCTCACCACCCACCCCC 11333943-ACCCCCACCACCACCCACCACCCCC-CCTCCCCACCAGCAACCCCAGCCCA,CGTCCTCACCCTCACCACCCACCCCC ***
13727625-A-T 11571949-A-T ***
13936263-GAGAAAGGGAAAGGGAGAAAGAAAG-AGAAGAGAAAGGGAAAGGGAGAAAGAAA,AGAAGAGAAAGGGAAAGGGAGAAAGAAAG 11815557-GAGAAAGGGAAAGGGAGAAAGAAAG-AGAAGAGAAAGGGAAAGGGAGAAAGAAA,AGAAGAGAAAGGGAAAGGGAGAAAGAAAG ***
21687983-CACAGAGAG-C,CACAGAG 19526097-CACAGAGAG-C,CACAGAG ***
22202438-C-A 20040552-C-A ***
56728192-AC-GG ***
56826513-CAATCAAG-TAATTAAT ***
56826628-CA-TG ***
56828824-CATTGCATTCAATTCCATTCG-AATTCCATTCCATTCCATTTG,CATTCCATTCCATACCATTCA ***
56830382-C-TCACTG ***
56830501-TCAACT-ACAACA ***
56834802-CTCCACTCT-CTCCACTCC,TTCCACTCC ***
56834897-CAGG-CAGC,TAGC ***
56835110-GC-TT ***
22431900-A-C 20270014-A-C DYZ19 ***
22500839-T-C 20338953-T-C DYZ19 ***
22261382-C-T 20099496-C-T DYZ19 ***
6400990-GTTAT-CTTAG 6532949-GTTAT-CTTAG ***
9324913-G-C 9487304-G-C ***
9573655-G-C 9736046-G-C IR3_Prx ***
9584899-G-T 9747290-G-T IR3_Prx ***
9587046-G-A 9749437-G-A IR3_Prx ***
9669475-G-T 9831866-G-T IR3_Prx ***
9692443-G-T 9854834-G-T IR3_Prx ***
15865552-TTTT-A,TTT 13753672-TTTT-A,TTT ***
18440492-G-T 16328612-G-T P6_Dst ***
18470744-CACACAG-C 16358864-CACACAG-C P6_Dst ***
19391099-CT-C,TT 17279219-CT-C,TT 17×T***
19659150-A-G 17547270-A-G P5_Prx ***
19693687-ATT-A 17581807-ATT-A P5_Prx 10×T***
19744991-ATTT-A,AT 17633111-ATTT-A,AT P5_Prx 23×T***
19749309-CTTT-C,CTT 17637429-CTTT-C,CTT P5_Prx 22×T***
20101729-CATA-TATT 17989849-CATA-TATT P5_Dst ***
20229557-TAC-CAC,T 18067671-TAC-CAC,T P5_Dst 18×AC***
20292731-G-C 18130845-G-C P5_Dst ***
20495702-C-A 18333816-C-A P5_Dst ***
20966468-C-A 18804582-C-A P4_Dst ***
20970352-CA-C,CAA 18808466-CA-C,CAA P4_Dst 12×A***
22236345-AAGT-GATG,GATT 20074459-AAGT-GATG,GATT DYZ19 ***
22261312-TTT-GTG 20099426-TTT-GTG DYZ19 ***
22261348-CAGGATCAT-AAGGTTCAC 20099462-CAGGATCAT-AAGGTTCAC DYZ19 ***
22261364-GT-CC 20099478-GT-CC DYZ19 ***
22261402-G-T 20099516-G-T DYZ19 ***
22281998-CCG-ACA 20120112-CCG-ACA DYZ19 ***
22293314-AT-CA,CT 20131428-AT-CA,CT DYZ19 ***
22343106-G-A 20181220-G-A DYZ19 ***
22343119-T-G 20181233-T-G DYZ19 ***
22343147-T-C 20181261-T-C DYZ19 ***
22367093-AA-AC,CC 20205207-AA-AC,CC DYZ19 ***
22421088-A-T 20259202-A-T DYZ19 ***
22421144-AG-CT 20259258-AG-CT DYZ19 ***
22480992-GTCTTC-TTCTGT,TTCTTC 20319106-GTCTTC-TTCTGT,TTCTTC DYZ19 ***
22481051-C-G 20319165-C-G DYZ19 ***
22481880-C-A 20319994-C-A DYZ19 ***
22488853-TATG-GATA 20326967-TATG-GATA DYZ19 ***
22493072-AAGT-AAGG,CAGG 20331186-AAGT-AAGG,CAGG DYZ19 ***
22493107-G-T 20331221-G-T DYZ19 ***
22493116-G-T 20331230-G-T DYZ19 ***
21780406-GAA-G,GA ***
24028465-C-A 21882318-C-A ***
24034125-AT-A 21887978-AT-A ***
24037732-CT-C 21891585-CT-C ***
24270917-ATT-A 22124770-ATT-A P3_b1 19×T***
24300813-CTTTT-C,CTTT 22154666-CTTTT-C,CTTT P3_t1 25×T***
24611927-G-T 22465780-G-T P3_t2 ***
24684489-C-A 22538342-C-A P3_b2 ***
24693565-G-T 22547418-G-T P3_b2 ***
24698220-TGGG-T 22552073-TGGG-T P3_b2 ***
24698250-G-T 22552103-G-T P3_b2 ***
24698304-G-T 22552157-G-T P3_b2 ***
24755499-G-A 22609352-G-A P3_b2 ***
24765473-GAAAAC-G 22619326-GAAAAC-G P3_b2 ***
24805030-A-G 22658883-A-G P3_b2 ***
25125196-G-T 22979049-G-T g1 ***
25125280-G-T 22979133-G-T g1 ***
25166712-ATTTTTTTTTT-A,ATTTTTTTTT 23020565-ATTTTTTTTTT-A,ATTTTTTTTT g1 30×T***
25379869-G-T 23233722-G-T P2_r2 ***
25428871-G-T 23282724-G-T P2_r2 ***
25455215-A-G 23309068-A-G P2_r2 ***
25461433-CTTTT-C 23315286-CTTTT-C P2_r2 26×T***
25464683-G-T 23318536-G-T P2_r2 ***
25469723-C-T 23323576-C-T P2_r2 ***
25498449-A-G 23352302-A-G P2_r2 ***
25503870-G-T 23357723-G-T P1_gr1 ***
25536618-TAA-T 23390471-TAA-T P1_gr1 13×A***
25642691-C-T 23496544-C-T P1_b3 ***
25680898-AAAGAGG-A 23534751-AAAGAGG-A P1_b3 ***
25709386-GTTTTTTTT-G 23563239-GTTTTTTTT-G P1_b3 31×T***
26024548-CTTT-C,CTT 23878401-CTTT-C,CTT P1_Y1 17×T***
26181957-CTTT-C 24035810-CTTT-C P1_Y1 18×T***
26359590-CAAA-C,CAA 24213443-CAAA-C,CAA P1_Y1 22×A***
26478103-AAC-A 24331956-AAC-A P1_Y1 ***
27000417-C-T 24854270-C-T P1_r4 ***
27123611-C-T 24977464-C-T P1_g3 ***
27141655-C-T 24995508-C-T P1_g3 ***
27195544-GTTAGACTCAAGACC-G 25049397-GTTAGACTCAAGACC-G P1_g3 ***
27276921-G-T 25130774-G-T P1_g3 ***
27296050-T-C 25149903-T-C P1_g3 ***
27304433-G-T 25158286-G-T P1_g3 ***
27366414-G-T 25220267-G-T P1_g3 ***
27368682-C-T 25222535-C-T P1_g3 ***
27373374-CA-C 25227227-CA-C P1_g3 ***
27466926-G-A 25320779-G-A P1_Y2 ***
27643266-G-T 25497119-G-T P1_Y2 ***
27739932-C-T 25593785-C-T P1_Y2 ***
27741158-G-C 25595011-G-C P1_Y2 ***
27768973-C-T 25622826-C-T P1_Y2 ***
27769754-G-T 25623607-G-T P1_Y2 ***
27776836-C-A 25630689-C-A P1_Y2 ***
27822289-CAA-C,CA 25676142-CAA-C,CA P1_Y2 14×A***
28006373-TACACAC-T,TAC 25860226-TACACAC-T,TAC P1_Y2 16×AC***
28016471-G-T 25870324-G-T P1_Y2 ***
28143516-T-A 25997369-T-A P1_b4 ***
28257590-G-C 26111443-G-C P1_b4 ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Mutation Notes:

Kit POSITION-REF-ALT (hg19) POSITION-REF-ALT (hg38) Note
Manual8379144-CTTCT-C8511103-CTTCT-CJust one read, but positive.
Manual21464771-GTTC-G19302885-GTTC-G6 reads with the deletion of TTC, one read with a TTCTTC deletion.