Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > DF21/S192 > FGC3213 > ZZ1 > S3058 > S424 > S426 > S190 > FGC3215 > ZZ23 > Y12464 > ZZ25 > Z17998 > Z17999 > Z18000 > Z36749 > Z36748 > Z36750 > BY9400

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
107672
FB38
107672-A
BigY2
107672
Manual
Edits
13466726-G-C 11311050-G-C BY85745 ****+
22357298-TGTTC-GGTTG 20195412-TGTTC-GGTTG DYZ19 +
23165838-T-A 21003952-T-A BY143581 Y+++
17599897-T-C 15488017-T-C BY116058 YY+++
15054526-A-T 12942617-A-T BY99450 YY+++
17056926-T-TATAATA 14945046-T-TATAATA 12×ATA***+***
13452374-TTCCATTCCATTCCATTCCATTCAAATACACTCCTTGC-GTCAAATCCACTCCATGA 11296698-TTCCATTCCATTCCATTCCATTCAAATACACTCCTTGC-GTCAAATCCACTCCATGA *
22229585-TCAA-CCAC,TCAC 20067699-TCAA-CCAC,TCAC DYZ19 *
13688181-AGAATGGAATG-A 11532505-AGAATGGAATG-A 8×GAATG*
13850293-A-AATGGA,AATGGG 11729587-A-AATGGA,AATGGG *
13447321-CCACTCCACTCCACTCCACTCCACTCCACT-ACACTCCACTCCACA,CCACTCCACTCCACA 11291645-CCACTCCACTCCACTCCACTCCACTCCACT-ACACTCCACTCCACA,CCACTCCACTCCACA *
56826746-C-CCATTC,T *
13451088-TA-CA,CG 11295412-TA-CA,CG *
22288627-A-G 20126741-A-G DYZ19 *
56826960-TCCATTAGTTTCCATTCCA-GGCATTCCATTCCATTCCA,TCCT *
13688135-T-C 11532459-T-C *
13451185-CTCCTTT-TTC,TTCCATTC 11295509-CTCCTTT-TTC,TTCCATTC *
22284679-T-C 20122793-T-C DYZ19 *
13449764-TATTCCATTCT-AATTCCATCAC,CATTGCATTCC 11294088-TATTCCATTCT-AATTCCATCAC,CATTGCATTCC *
13449071-TT-CT,TC 11293395-TT-CT,TC *
19948179-CTC-TTT 17836299-CTC-TTT P5_Prx *
56830657-TTCCACTG-CTCCACTT,CTCCCCTT *
22239693-G-A 20077807-G-A DYZ19 *
10661326-GCATC-CCATC,CCATT *
20105742-T-TTATC,TTATCTATC 17993862-T-TTATC,TTATCTATC P5_Dst 14×TATC*
22257323-GG-CT,GT 20095437-GG-CT,GT DYZ19 *
13450521-CTTCACTCCAC-ATCCATCCCAT 11294845-CTTCACTCCAC-ATCCATCCCAT *
22259124-A-G 20097238-A-G DYZ19 ****
22430120-C-A 20268234-C-A DYZ19 ******
26224593-A-G 24078446-A-G P1_Y1 ****
9202348-TGGT-GGGG 9364739-TGGT-GGGG *
20500942-GA-G,GAA 18339056-GA-G,GAA P5_Dst 15×A*
56831127-TTTT-GTTG,GTTT *
22505044-GCCTT-ACCTC,ACCTT 20343158-GCCTT-ACCTC,ACCTT DYZ19 *
56831649-TCCAC-CCCAT,TCCACTCCATCCCAT *
56836673-AAGC-AAGA,CAGC *
16242402-CTT-C,CT 14130522-CTT-C,CT 18×T*
25240239-CTT-C,CT 23094092-CTT-C,CT P2_r1 22×T*
22421286-GAAC-CAAT,GACC 20259400-GAAC-CAAT,GACC DYZ19 *
25955976-CTGTG-C 23809829-CTGTG-C P1_Y1 16×TG*
19719327-CAA-C,CA 17607447-CAA-C,CA P5_Prx 17×A*
24222264-CTT-C,CT 22076117-CTT-C,CT P3_b1 15×T*
56833843-CCCACTCCACT-CCCACT,TCCATC 4×CCACT*
56832479-TTCCATTCCATTCCACCGCACTCCACTCCACTCCACTCA-CTCAATTCCATTCCACTCCACTCCACTCCAATCC,TTCCATTCCATTCCACTGCACTCCACTCCACTCA *
56831670-CC-GA,GC *
56831681-GACTCCACTCAACTCC-CATTCCACTCCACTCAAATCC,CATTCCCCTCCTCTCA *
56831762-TG-CC,CT *
27791898-CTCTTCC-TTCTTCT 25645751-CTCTTCC-TTCTTCT P1_Y2 *
22510227-GTA-ATA,ATG 20348341-GTA-ATA,ATG DYZ19 *
16044391-C-A 13932511-C-A **
17403706-C-A 15291826-C-A **
16060662-C-A 13948782-C-A **
24700544-C-A 22554397-C-A P3_b2 **
16006847-C-A 13894967-C-A **
16084030-G-T 13972150-G-T **
16266176-A-G 14154296-A-G **
16073046-C-A 13961166-C-A **
16245952-A-G 14134072-A-G **
16176799-A-T 14064919-A-T **
17355643-C-A 15243763-C-A **
17379776-C-A 15267896-C-A **
16705192-C-A 14593312-C-A **
16462448-C-A 14350568-C-A **
16462607-A-G 14350727-A-G **
17502771-T-C 15390891-T-C **
16475082-T-A 14363202-T-A **
16605615-C-A 14493735-C-A **
16607923-C-A 14496043-C-A **
16701935-G-T 14590055-G-T **
16729172-GTTTT-G 14617292-GTTTT-G 22×T**
16267088-TCA-T 14155208-TCA-T **
16885102-C-A 14773222-C-A **
16915024-A-G 14803144-A-G **
17095390-C-A 14983510-C-A **
17175630-C-T 15063750-C-T **
17203354-A-C 15091474-A-C **
16429618-G-T 14317738-G-T **
16422143-T-A 14310263-T-A **
16270992-C-A 14159112-C-A **
17433909-C-A 15322029-C-A **
16186706-C-CA 14074826-C-CA 9×A*****
17503414-C-A 15391534-C-A **
20809846-G-A 18647960-G-A P4_Gap **
19286389-C-A 17174509-C-A **
19333293-C-A 17221413-C-A **
19460659-A-T 17348779-A-T **
19507021-C-A 17395141-C-A **
19748923-A-T 17637043-A-T P5_Prx **
20458865-G-A 18296979-G-A P5_Dst **
20612063-G-T 18450177-G-T P5_Dst **
20612077-G-T 18450191-G-T P5_Dst **
21155276-T-A 18993390-T-A **
19130738-CTTTTTTT-C 17018858-CTTTTTTT-C 33×T**
21196799-G-A 19034913-G-A **
21243960-G-T 19082074-G-T **
21315201-G-T 19153315-G-T **
21328812-A-AG 19166926-A-AG **
21362398-C-A 19200512-C-A **
21367616-C-A 19205730-C-A **
21409664-C-A 19247778-C-A **
24682518-T-C 22536371-T-C P3_b2 **
21488775-C-A 19326889-C-A **
19253233-G-T 17141353-G-T ****
19126412-C-A 17014532-C-A **
17580144-T-C 15468264-T-C **
18155704-C-A 16043824-C-A **
17667022-C-A 15555142-C-A **
17737738-C-A 15625858-C-A **
17843170-C-A 15731290-C-A **
17859994-G-T 15748114-G-T **
17884516-C-A 15772636-C-A **
18094169-C-A 15982289-C-A **
15946726-C-A 13834846-C-A **
18119614-C-A 16007734-C-A **
18183194-C-A 16071314-C-A **
19073696-G-T 16961816-G-T **
18407960-GA-G 16296080-GA-G P6_Gap ****
18511753-C-A 16399873-C-A P6_Dst **
18650528-C-A 16538648-C-A **
18661674-C-A 16549794-C-A **
18717724-C-A 16605844-C-A Y31890 **
18793780-C-A 16681900-C-A **
18933709-T-C 16821829-T-C **
18990411-C-A 16878531-C-A **
19053216-A-G 16941336-A-G **
15957668-C-A 13845788-C-A **
15210814-G-T 13098900-G-T **
15928603-C-A 13816723-C-A **
13941693-ATTT-A 11820987-ATTT-A 15×T**
11668885-A-G **
11677307-A-T **
13860650-G-A 11739944-G-A **
13888609-CT-C 11767903-CT-C 8×T**
13922603-C-A 11801897-C-A **
13928447-C-A 11807741-C-A **
13932459-C-A 11811753-C-A **
14106982-C-A 11986276-C-A **
11643984-G-T **
14181170-A-G 12060464-A-G **
14181653-C-T 12060947-C-T **
14203374-T-C 12082668-T-C **
14204888-G-A 12084182-G-A **
14273698-G-T 12152992-G-T **
14283928-C-A 12163222-C-A **
24940461-C-A 22794314-C-A g1 **
11644587-G-T **
13639223-A-G 11483547-A-G **
14297955-C-A 12177249-C-A **
13460760-T-C 11305084-T-C **
13242735-T-C 11087059-T-C **
13257506-C-A 11101830-C-A **
13258459-C-A 11102783-C-A **
13294232-G-T 11138556-G-T **
13315562-C-A 11159886-C-A **
13320763-C-A 11165087-C-A **
25413832-C-A 23267685-C-A P2_r2 **
13460787-C-T 11305111-C-T **
13637229-C-A 11481553-C-A **
13486603-C-A 11330927-C-A **
13509049-C-A 11353373-C-A **
13554760-C-A 11399084-C-A **
13578575-A-G 11422899-A-G **
18437417-G-T 16325537-G-T P6_Dst **
25236957-G-T 23090810-G-T P2_r1 **
13604301-C-A 11448625-C-A **
14291072-G-T 12170366-G-T ****
14301967-G-A 12181261-G-A **
15904072-C-A 13792192-C-A **
15491937-GTGTGTA-G 13380057-GTGTGTA-G **
15221973-C-A 13110059-C-A **
15280598-T-C 13168697-T-C **
15290140-C-A 13178239-C-A **
15365348-C-A 13253468-C-A **
15400059-C-A 13288179-C-A **
24775405-C-A 22629258-C-A P3_b2 **
15468460-C-A 13356580-C-A **
15495185-C-A 13383305-C-A **
21543356-C-A 19381470-C-A **
15655131-C-A 13543251-C-A **
15677277-T-A 13565397-T-A **
15699857-C-A 13587977-C-A **
15733865-G-A 13621985-G-A **
15749136-C-A 13637256-C-A **
15768999-G-A 13657119-G-A **
24775049-TG-T 22628902-TG-T P3_b2 **
15218620-C-A 13106706-C-A **
15168246-C-A 13056332-C-A **
14307755-T-A 12187049-T-A **
14558290-C-A 12446491-C-A **
24923226-G-T 22777079-G-T g1 **
14427419-CAA-C 12306694-CAA-C 12×A**
14431336-C-A 12310609-C-A ****
14445573-G-A 12324846-G-A **
14451211-G-A 12330484-G-A **
14451652-A-G 12330925-A-G **
14490282-C-A 12369551-C-A **
14562366-TA-T 12450566-TA-T **
15044314-C-A 12932404-C-A **
14562384-A-T 12450584-A-T **
14606286-C-A 12494488-C-A **
14627107-T-A 12515175-T-A **
14627135-C-A 12515203-C-A **
14760995-C-A 12649064-C-A **
14823527-T-A 12711594-T-A **
14832192-T-C 12720259-T-C **
21543345-C-A 19381459-C-A **
24600442-C-TTCTTTCTT 22454295-C-TTCTTTCTT P3_t2 18×TCTT**
21596948-C-A 19435062-C-A **
7897985-G-A 8029944-G-A **
22482420-T-A 20320534-T-A DYZ19 **
22351538-T-TC 20189652-T-TC DYZ19 **
2833175-ACCCT-CCCC 2965134-ACCCT-CCCC **
22351503-T-G 20189617-T-G DYZ19 **
5992661-G-T 6124620-G-T **
22332598-TC-T 20170712-TC-T DYZ19 **
7717733-CTTCC-TTTCT 7849692-CTTCC-TTTCT **
10799565-TATTT-CATTC **
22332576-A-T 20170690-A-T DYZ19 **
10799576-TC-AT **
10807293-TTCAACCAGAA-GTCACCCAGAT **
10808635-GC-CT **
10818690-CCACTCA-GCACGCT **
10887481-CGACTGGC-TGATTGGA **
10893564-CCTGTAC-AT **
10984501-AAGTGC-GAGAGG **
22332606-T-G 20170720-T-G DYZ19 **
22481956-T-A 20320070-T-A DYZ19 **
11013584-TGTGTG-GGAGTA **
22481186-T-C 20319300-T-C DYZ19 **
21749871-C-A **
22503693-TGAAT-CATAG 20341807-TGAAT-CATAG DYZ19 **
22497817-T-C 20335931-T-C DYZ19 **
22497784-A-G 20335898-A-G DYZ19 **
22497740-T-C 20335854-T-C DYZ19 **
22496292-G-T 20334406-G-T DYZ19 **
16421068-A-C 14309188-A-C **
10671280-TGGAT-AGTAC **
22493132-C-G 20331246-C-G DYZ19 **
10671308-ATGCCGAGC-GTGCAGAGG **
10984450-TTCCGTTA-CTCCATTC **
22332574-A-C 20170688-A-C DYZ19 **
10789463-GC-AG **
10658499-AG-CA **
10671295-CACTC-TACCT **
20331371-G-T 18169485-G-T P5_Dst **
10987900-TCA-ACT **
13291866-G-T 11136190-G-T **
56849655-G-T **
18354285-GAAACAGAGAAAGAAAGAAAGAAAG-CAGAGAAAGAAAGAAAGAAAGAGAA 16242405-GAAACAGAGAAAGAAAGAAAGAAAG-CAGAGAAAGAAAGAAAGAAAGAGAA P6_Prx **
56847469-CTAA-TTAC **
56847769-A-G **
56848730-CTAG-TTCA **
56848776-ACAAATC-TA **
56868049-C-A **
9592965-TTG-T 9755356-TTG-T IR3_Prx **
19784375-G-T 17672495-G-T P5_Prx **
6232329-C-A 6364288-C-A IR3_Dst **
19916377-G-T 17804497-G-T P5_Prx **
9542197-CCTTT-C 9704588-CCTTT-C IR3_Prx 5×CTTT**
19680457-C-A 17568577-C-A P5_Prx **
9623616-G-A 9786007-G-A IR3_Prx **
9634374-CAAAT-C 9796765-CAAAT-C IR3_Prx 6×AAAT**
9634767-C-A 9797158-C-A IR3_Prx **
18506222-TGAAGGAG-T 16394342-TGAAGGAG-T P6_Dst **
9679237-G-T 9841628-G-T IR3_Prx **
56842237-CCCT-TCCA **
20111096-G-T 17999216-G-T P5_Dst **
22234333-TATCAG-ACCAC 20072447-TATCAG-ACCAC DYZ19 **
21464774-CTTC-A 19302888-CTTC-A **
13487725-GCAT-CAAG 11332049-GCAT-CAAG **
20967616-C-T 18805730-C-T P4_Dst **
13727433-T-A 11571757-T-A **
20854673-G-T 18692787-G-T P4_Dst **
17006257-GTTTC-TTTT 14894377-GTTTC-TTTT **
18872213-TTTCTTTCCTTATTTCTTCCTTCCTTCCTTCCTTTCTCTT-CTTATTTCTTCCTTCCTTCCTTCCTTTC 16760333-TTTCTTTCCTTATTTCTTCCTTCCTTCCTTCCTTTCTCTT-CTTATTTCTTCCTTCCTTCCTTCCTTTC **
19469877-A-CC 17357997-A-CC 12×C**
20851695-C-A 18689809-C-A P4_Dst **
20247101-GA-G 18085215-GA-G P5_Dst **
20541829-G-T 18379943-G-T P5_Dst **
23108745-G-T 20946859-G-T **
23488835-AAA-T 21326949-AAA-T **
28797853-GAGA-TGCT 26651706-GAGA-TGCT **
28818260-TCA-CCG 26672113-TCA-CCG **
56826584-ATTCCA-GTCCTG **
20325212-C-A 18163326-C-A P5_Dst **
27437-C-A **
56848804-A-T **
21624540-C-T 19462654-C-T **
23260834-C-A 21098948-C-A **
23048218-C-A 20886332-C-A **
13237669-C-A 11081993-C-A **
23062773-G-A 20900887-G-A **
23065752-T-C 20903866-T-C **
23111665-G-T 20949779-G-T **
23186523-C-A 21024637-C-A **
24558088-A-G 22411941-A-G P3_t2 **
23306597-C-A 21144711-C-A **
22965749-A-G 20803863-A-G **
23372094-C-A 21210208-C-A **
23439054-A-AT 21277168-A-AT 10×T**
24409220-C-T 22263073-C-T **
24435414-C-A 22289267-C-A **
24475184-T-C 22329037-T-C **
24634233-C-A 22488086-C-A P3_t2 **
24961035-G-T 22814888-G-T g1 **
23019417-C-A 20857531-C-A **
22874388-C-A 20712502-C-A **
25592900-CTATA-C 23446753-CTATA-C P1_gr1 12×TA**
22211898-C-A 20050012-C-A **
21677990-C-A 19516104-C-A **
21818997-C-A 19657111-C-A **
21840047-C-A 19678161-C-A **
21919480-C-A 19757594-C-A **
22077106-T-C 19915220-T-C **
22077107-G-T 19915221-G-T **
22091367-A-G 19929481-A-G **
22307243-A-G 20145357-A-G DYZ19 **
22841983-C-A 20680097-C-A **
22339753-G-A 20177867-G-A DYZ19 **
22457415-C-A 20295529-C-A DYZ19 **
22485774-A-C 20323888-A-C DYZ19 **
22485782-A-T 20323896-A-T DYZ19 **
22629738-C-A 20467852-C-A **
22696081-G-A 20534195-G-A **
22811973-C-A 20650087-C-A **
25031173-C-A 22885026-C-A g1 **
25980187-A-AAAC 23834040-A-AAAC P1_Y1 10×AAT**
56848797-C-G **
28698897-C-A 26552750-C-A **
28593660-C-A 26447513-C-A **
28610247-C-A 26464100-C-A **
28612230-C-A 26466083-C-A FGC49328 **
28631600-T-C 26485453-T-C **
28659990-C-A 26513843-C-A **
28665168-C-A 26519021-C-A **
28697853-C-A 26551706-C-A **
28708360-T-C 26562213-T-C **
28574539-A-G 26428392-A-G **
28722602-C-A 26576455-C-A **
56846231-G-T **
56848730-C-T **
56848733-G-A **
56848760-C-A **
56848775-GACAAA-G **
58994929-C-A 56848782-C-A **
28583134-A-T 26436987-A-T **
28545238-C-A 26399091-C-A **
26229945-T-TC 24083798-T-TC P1_Y1 **
28076574-T-A 25930427-T-A P1_Y2 **
26593011-C-A 24446864-C-A P1_g2 **
27484447-C-A 25338300-C-A P1_Y2 **
27595985-A-T 25449838-A-T P1_Y2 **
27815616-G-T 25669469-G-T P1_Y2 **
27842207-G-T 25696060-G-T P1_Y2 **
27856381-G-T 25710234-G-T P1_Y2 **
27952083-CTG-C 25805936-CTG-C P1_Y2 **
28462085-C-A 26315938-C-A **
28537092-C-A 26390945-C-A **
28465148-C-A 26319001-C-A **
28484520-C-A 26338373-C-A **
28497107-C-A 26350960-C-A **
28499353-C-A 26353206-C-A **
28502326-G-T 26356179-G-T **
28505382-A-C 26359235-A-C **
28535578-C-A 26389431-C-A **
13238025-C-A 11082349-C-A **
13578762-C-A 11423086-C-A **
13223739-AGAGG-A 11068063-AGAGG-A 4×GAGG**
5587038-A-G 5718997-A-G **
5267947-A-G 5399906-A-G **
5274307-T-A 5406266-T-A **
5350314-A-C 5482273-A-C ****
5367004-C-A 5498963-C-A **
5388547-T-C 5520506-T-C **
5457900-G-A 5589859-G-A **
5534734-T-C 5666693-T-C FT45890 **
5635259-G-T 5767218-G-T **
5242247-C-A 5374206-C-A **
5706654-G-T 5838613-G-T **
5754988-G-T 5886947-G-T **
5888316-T-A 6020275-T-A **
5924336-C-A 6056295-C-A **
5926807-G-T 6058766-G-T **
5937547-C-A 6069506-C-A ****
5937594-C-A 6069553-C-A ****
5266999-C-T 5398958-C-T **
5241786-T-TAC 5373745-T-TAC 16×AC****
6125761-C-A 6257720-C-A **
4747877-G-T 4879836-G-T **
4325642-C-A 4457601-C-A **
4326593-G-T 4458552-G-T **
4347614-C-A 4479573-C-A **
4432556-G-T 4564515-G-T **
4557668-C-A 4689627-C-A **
4567810-G-T 4699769-G-T **
4747857-T-A 4879816-T-A **
4847967-C-A 4979926-C-A ****
5201017-G-T 5332976-G-T **
4898078-G-T 5030037-G-T **
4908074-C-A 5040033-C-A **
4925000-C-A 5056959-C-A **
4970023-G-T 5101982-G-T **
5011398-T-C 5143357-T-C **
5084108-C-A 5216067-C-A **
5084121-C-A 5216080-C-A **
5127768-C-A 5259727-C-A **
6096860-C-A 6228819-C-A **
6156307-C-A 6288266-C-A IR3_Dst **
4271321-C-A 4403280-C-A **
7186620-C-A 7318579-C-A **
7043422-G-T 7175381-G-T **
7085260-C-A 7217219-C-A **
7100481-C-A 7232440-C-A **
7109302-C-G 7241261-C-G **
7111899-C-A 7243858-C-A **
7116215-C-A 7248174-C-A ****
7160830-C-A 7292789-C-A **
7201441-C-T 7333400-C-T **
6978302-C-A 7110261-C-A **
7201970-C-A 7333929-C-A **
7208337-C-A 7340296-C-A **
7237924-C-A 7369883-C-A **
7247616-C-A 7379575-C-A *****
7255070-C-A 7387029-C-A ****
7306465-C-A 7438424-C-A **
7310415-C-G 7442374-C-G **
7319652-G-T 7451611-G-T **
7040245-G-T 7172204-G-T **
6977318-C-A 7109277-C-A **
6179507-CATT-C 6311466-CATT-C IR3_Dst **
11033760-C-A **
25628439-CTTTTT-C 23482292-CTTTTT-C P1_b3 26×T**
6215965-G-T 6347924-G-T IR3_Dst **
6352763-G-T 6484722-G-T **
6374273-G-T 6506232-G-T **
6424837-C-A 6556796-C-A **
6492632-C-A 6624591-C-A **
6553612-G-C 6685571-G-C **
6692829-CAAA-C 6824788-CAAA-C 14×A**
6925613-G-A 7057572-G-A **
6729621-C-A 6861580-C-A **
6765588-T-G 6897547-T-G **
6765600-A-G 6897559-A-G **
6765603-A-G 6897562-A-G **
6770526-G-T 6902485-G-T **
6790247-C-A 6922206-C-A **
6892572-C-A 7024531-C-A **
6917115-C-A 7049074-C-A **
4298206-C-A 4430165-C-A **
4240929-G-A 4372888-G-A **
25606696-T-C 23460549-T-C P1_gr1 **
6992464-C-A 7124423-C-A **
27635857-C-A 25489710-C-A P1_Y2 **
27431029-C-A 25284882-C-A P1_g3 **
27412875-GTG-T 25266728-GTG-T P1_g3 **
17203349-C-T 15091469-C-T **
27391314-G-C 25245167-G-C P1_g3 **
20593055-CA-C 18431169-CA-C P5_Dst 22×A**
23435202-C-TTT 21273316-C-TTT **
27353523-C-T 25207376-C-T P1_g3 **
20062533-TTTC-GTTT 17950653-TTTC-GTTT P5_Prx **
58990648-CTTCC-GTTGA 56844501-CTTCC-GTTGA **
27275801-G-T 25129654-G-T P1_g3 **
27187556-CA-C 25041409-CA-C P1_g3 **
27186323-GAA-G 25040176-GAA-G P1_g3 19×A**
27167185-ACATAAAACATT-A 25021038-ACATAAAACATT-A P1_g3 **
22077112-C-T 19915226-C-T **
27138811-G-T 24992664-G-T P1_g3 **
6161451-A-G 6293410-A-G IR3_Dst **
22052471-C-A 19890585-C-A **
17713845-ATCTTC-TTTTT 15601965-ATCTTC-TTTTT **
26494155-C-A 24348008-C-A P1_Y1 **
27866972-C-A 25720825-C-A P1_Y2 **
28228330-T-A 26082183-T-A P1_b4 **
28065930-G-A 25919783-G-A P1_Y2 **
28015550-G-T 25869403-G-T P1_Y2 **
27973150-AGCATT-A 25827003-AGCATT-A P1_Y2 **
20233046-CA-C 18071160-CA-C P5_Dst 10×A**
27945303-GA-G 25799156-GA-G P1_Y2 **
27892754-C-A 25746607-C-A P1_Y2 **
27937836-GA-G 25791689-GA-G P1_Y2 17×A**
16162095-CA-C 14050215-CA-C P8_Dst 19×A**
27860204-CA-C 25714057-CA-C P1_Y2 **
28406839-CA-C 26260692-CA-C P1_gr2 16×A**
22332659-A-G 20170773-A-G DYZ19 **
22481197-G-A 20319311-G-A DYZ19 **
27741749-C-T 25595602-C-T P1_Y2 **
15495182-C-A 13383302-C-A ****
16364058-CTATATATATA-C 14252178-CTATATATATA-C 27×TA**
24363631-CTCTTTT-C 22217484-CTCTTTT-C **
22481178-A-G 20319292-A-G DYZ19 **
22497824-T-G 20335938-T-G DYZ19 **
4213056-C-A 4345015-C-A **
3660317-G-T 3792276-G-T **
3285259-G-T 3417218-G-T **
3366639-C-A 3498598-C-A **
3367120-C-A 3499079-C-A **
3389581-C-A 3521540-C-A **
3574522-G-T 3706481-G-T **
3610159-C-A 3742118-C-A **
3630742-T-C 3762701-T-C **
3732646-G-T 3864605-G-T 10×T**
3091974-G-A 3223933-G-A **
3758897-C-A 3890856-C-A **
3768659-C-T 3900618-C-T **
3771055-C-A 3903014-C-A **
3836401-C-A 3968360-C-A **
4086015-G-T 4217974-G-T **
4101130-T-A 4233089-T-A **
4107821-G-C 4239780-G-C **
4179238-C-A 4311197-C-A **
3110446-C-A 3242405-C-A **
3022104-G-T 3154063-G-T ****
58994903-T-A 56848756-T-A **
26038079-G-A 23891932-G-A P1_Y1 **
26478079-AGT-GGC 24331932-AGT-GGC P1_Y1 **
9592617-T-G 9755008-T-G IR3_Prx **
26364862-C-A 24218715-C-A P1_Y1 **
22235087-ATACAA-GTAAAG 20073201-ATACAA-GTAAAG DYZ19 **
22499406-G-A 20337520-G-A DYZ19 **
26090603-T-C 23944456-T-C P1_Y1 **
15533428-C-A 13421548-C-A **
6916222-C-A 7048181-C-A **
3007748-C-A 3139707-C-A ****
10821816-T-TCACTC **
16320394-C-CA 14208514-C-CA 10×A**
10014984-A-ATT 10177375-A-ATT 27×T**
2746024-T-C 2877983-T-C **
2773416-G-T 2905375-G-T **
2885489-G-A 3017448-G-A **
2926654-C-A 3058613-C-A **
2949098-C-A 3081057-C-A **
7341108-G-T 7473067-G-T **
6646039-C-A 6777998-C-A **
7783131-C-A 7915090-C-A **
10898414-G-A **
10888579-G-C **
7935855-TAAAAA-T 8067814-TAAAAA-T 22×A**
10898369-A-T **
10898391-T-A **
10898404-T-A **
10898410-C-A **
10898413-T-C **
10898920-C-A *****
10888294-T-C **
10905017-C-A *****
10911440-C-A **
10922183-C-A **
10928207-C-G **
10928210-T-C **
10928229-AGTCCT-A **
10928240-A-G **
10888301-C-CCATTT **
10888289-T-C **
10928255-C-T **
10849153-C-A ****
10819710-C-A ****
10824206-C-A **
10825045-C-A *****
10839120-C-A **
10839122-C-A **
10840933-G-T **
10844799-G-T ****
10852661-T-C ****
10888283-A-G **
10857434-A-T **
10863795-G-T **
10874506-C-T **
10885091-C-T **
10885105-T-A **
10888269-G-C **
10888279-T-C **
10928254-A-G **
10929854-G-T *****
10808076-C-A **
10992251-C-CATTTT **
10980302-C-G **
10982089-C-A **
10982909-T-C **
10985904-C-A ****
10988717-C-A **
10988770-C-G **
10992249-T-A **
10997910-A-G **
10975446-C-A **
10999800-C-T **
11004806-T-A **
11013224-A-C **
11019750-C-A *****
11019978-C-A **
11028040-C-A **
11028107-C-A **
10980272-C-T **
10973996-C-G **
10939644-T-A **
10947164-C-A ****
10946397-G-T **
10946411-C-T **
10946414-A-C **
10946441-C-T **
10946446-A-T **
10946450-ACTCCAGTCCAG-T **
10946463-C-G **
10954778-C-A **
10973953-C-A **
10954931-C-A **
10956231-A-T ****
10959703-T-C **
10963124-A-G **
10967665-G-T **
10970852-C-G **
10973930-C-G **
10808561-C-A **
10898341-TC-T **
10803142-T-C **
10657145-C-A **
9805217-C-A 9967608-C-A **
9927348-C-A 10089739-C-A **
9934250-C-A 10096641-C-A **
9946068-A-T 10108459-A-T **
25498546-C-A 23352399-C-A P2_r2 **
9996235-C-A 10158626-C-A **
10018109-T-G 10180500-T-G **
10662614-T-C **
9465218-G-T 9627609-G-T **
10662618-G-C **
10662841-C-A ****
10663540-C-A **
10663678-TTTCCATTCCA-T **
10671767-C-A **
10676675-C-A **
10688157-C-A ****
10691239-C-A **
9475745-G-T 9638136-G-T **
9427562-C-A 9589953-C-A **
10745970-C-A **
8279833-GT-G 8411792-GT-G 8×T**
7964712-C-G 8096671-C-G **
7990228-C-A 8122187-C-A **
8058525-C-A 8190484-C-A **
8075807-T-C 8207766-T-C **
8076760-C-G 8208719-C-G **
8173953-T-C 8305912-T-C **
8217932-G-T 8349891-G-T **
8343920-C-A 8475879-C-A **
9047012-A-C 9209403-A-C **
25544892-TA-T 23398745-TA-T P1_gr1 9×A**
8668521-C-A 8800480-C-A **
8776477-C-A 8908436-C-A **
8786656-C-A 8918615-C-A **
8811238-C-A 8943197-C-A **
8850733-C-A 8982692-C-A **
9113851-G-T **
8983060-G-T 9145451-G-T **
10693166-C-A **
10018060-A-T 10180451-A-T **
10747744-C-T **
10772081-C-T **
10769645-CATGCT-C **
10769662-C-G **
10752707-C-G **
10769688-TCCC-T **
10769696-A-T **
10769698-G-C **
10769702-T-CCTC **
10773192-C-T **
10769021-T-A **
10773991-G-T *****
10774192-C-A **
10775824-T-A **
10776912-C-A **
10784920-C-A **
10786024-C-A **
10787150-C-A **
10769640-C-T **
18009540-G-T 15897660-G-T P7_Dst **
10754177-C-T **
10765972-C-A **
10755331-C-G **
10767883-C-A **
24037732-CT-C 21891585-CT-C ***
24611927-G-T 22465780-G-T P3_t2 ***
27769754-G-T 25623607-G-T P1_Y2 ***
27768973-C-T 25622826-C-T P1_Y2 ***
20101729-CATA-TATT 17989849-CATA-TATT P5_Dst ***
24034125-AT-A 21887978-AT-A ***
27741158-G-C 25595011-G-C P1_Y2 ***
24028465-C-A 21882318-C-A ***
25536618-TAA-T 23390471-TAA-T P1_gr1 13×A***
25461433-CTTTT-C 23315286-CTTTT-C P2_r2 26×T***
25379869-G-T 23233722-G-T P2_r2 ***
27739932-C-T 25593785-C-T P1_Y2 ***
25498449-A-G 23352302-A-G P2_r2 ***
22367093-AA-AC,CC 20205207-AA-AC,CC DYZ19 ***
21780406-GAA-G,GA ***
20229557-TAC-CAC,T 18067671-TAC-CAC,T P5_Dst 18×AC***
25464683-G-T 23318536-G-T P2_r2 ***
20292731-G-C 18130845-G-C P5_Dst ***
27643266-G-T 25497119-G-T P1_Y2 ***
27776836-C-A 25630689-C-A P1_Y2 ***
22293314-AT-CA,CT 20131428-AT-CA,CT DYZ19 ***
27822289-CAA-C,CA 25676142-CAA-C,CA P1_Y2 14×A***
19659150-A-G 17547270-A-G P5_Prx ***
18440492-G-T 16328612-G-T P6_Dst ***
18470744-CACACAG-C 16358864-CACACAG-C P6_Dst ***
25469723-C-T 23323576-C-T P2_r2 ***
28143516-T-A 25997369-T-A P1_b4 ***
24805030-A-G 22658883-A-G P3_b2 ***
28016471-G-T 25870324-G-T P1_Y2 ***
25680898-AAAGAGG-A 23534751-AAAGAGG-A P1_b3 ***
19391099-CT-C,TT 17279219-CT-C,TT 17×T***
28006373-TACACAC-T,TAC 25860226-TACACAC-T,TAC P1_Y2 16×AC***
27466926-G-A 25320779-G-A P1_Y2 ***
22421088-A-T 20259202-A-T DYZ19 ***
19693687-ATT-A 17581807-ATT-A P5_Prx 10×T***
25428871-G-T 23282724-G-T P2_r2 ***
22421144-AG-CT 20259258-AG-CT DYZ19 ***
19744991-ATTT-A,AT 17633111-ATTT-A,AT P5_Prx 23×T***
24684489-C-A 22538342-C-A P3_b2 ***
19749309-CTTT-C,CTT 17637429-CTTT-C,CTT P5_Prx 22×T***
25455215-A-G 23309068-A-G P2_r2 ***
24755499-G-A 22609352-G-A P3_b2 ***
24698250-G-T 22552103-G-T P3_b2 ***
20495702-C-A 18333816-C-A P5_Dst ***
25642691-C-T 23496544-C-T P1_b3 ***
26478103-AAC-A 24331956-AAC-A P1_Y1 ***
22488853-TATG-GATA 20326967-TATG-GATA DYZ19 ***
27123611-C-T 24977464-C-T P1_g3 ***
22236345-AAGT-GATG,GATT 20074459-AAGT-GATG,GATT DYZ19 ***
27000417-C-T 24854270-C-T P1_r4 ***
25125196-G-T 22979049-G-T g1 ***
22481880-C-A 20319994-C-A DYZ19 ***
24765473-GAAAAC-G 22619326-GAAAAC-G P3_b2 ***
22261312-TTT-GTG 20099426-TTT-GTG DYZ19 ***
22481051-C-G 20319165-C-G DYZ19 ***
27141655-C-T 24995508-C-T P1_g3 ***
24300813-CTTTT-C,CTTT 22154666-CTTTT-C,CTTT P3_t1 25×T***
24270917-ATT-A 22124770-ATT-A P3_b1 19×T***
22480992-GTCTTC-TTCTGT,TTCTTC 20319106-GTCTTC-TTCTGT,TTCTTC DYZ19 ***
26359590-CAAA-C,CAA 24213443-CAAA-C,CAA P1_Y1 22×A***
22261348-CAGGATCAT-AAGGTTCAC 20099462-CAGGATCAT-AAGGTTCAC DYZ19 ***
22261364-GT-CC 20099478-GT-CC DYZ19 ***
22261402-G-T 20099516-G-T DYZ19 ***
26181957-CTTT-C 24035810-CTTT-C P1_Y1 18×T***
22493072-AAGT-AAGG,CAGG 20331186-AAGT-AAGG,CAGG DYZ19 ***
22493107-G-T 20331221-G-T DYZ19 ***
22281998-CCG-ACA 20120112-CCG-ACA DYZ19 ***
22343106-G-A 20181220-G-A DYZ19 ***
25709386-GTTTTTTTT-G 23563239-GTTTTTTTT-G P1_b3 31×T***
24698304-G-T 22552157-G-T P3_b2 ***
25166712-ATTTTTTTTTT-A,ATTTTTTTTT 23020565-ATTTTTTTTTT-A,ATTTTTTTTT g1 30×T***
27373374-CA-C 25227227-CA-C P1_g3 ***
22343147-T-C 20181261-T-C DYZ19 ***
27368682-C-T 25222535-C-T P1_g3 ***
27366414-G-T 25220267-G-T P1_g3 ***
22343119-T-G 20181233-T-G DYZ19 ***
27304433-G-T 25158286-G-T P1_g3 ***
22493116-G-T 20331230-G-T DYZ19 ***
25503870-G-T 23357723-G-T P1_gr1 ***
27296050-T-C 25149903-T-C P1_g3 ***
20966468-C-A 18804582-C-A P4_Dst ***
27276921-G-T 25130774-G-T P1_g3 ***
24698220-TGGG-T 22552073-TGGG-T P3_b2 ***
20970352-CA-C,CAA 18808466-CA-C,CAA P4_Dst 12×A***
27195544-GTTAGACTCAAGACC-G 25049397-GTTAGACTCAAGACC-G P1_g3 ***
26024548-CTTT-C,CTT 23878401-CTTT-C,CTT P1_Y1 17×T***
25125280-G-T 22979133-G-T g1 ***
24693565-G-T 22547418-G-T P3_b2 ***
27150720-A-AT 25004573-A-AT P1_g3 12×T***
15865552-TTTT-A,TTT 13753672-TTTT-A,TTT ***
13843994-AGAC-GGAA 11723288-AGAC-GGAA ***
8344064-G-T 8476023-G-T ***
7660016-TAA-T 7791975-TAA-T 14×A***
6205660-G-T 6337619-G-T IR3_Dst ***
6121066-C-A 6253025-C-A ***
2810366-ATTTTTTTTTTT-A 2942325-ATTTTTTTTTTT-A 23×T******
17169919-CAA-C 15058039-CAA-C 11×A***
8631383-CTTTTTT-C 8763342-CTTTTTT-C 26×T***
23538557-G-GA 21376671-G-GA 11×A***
9508060-C-A 9670451-C-A ***
22500957-T-C 20339071-T-C DYZ19 ***
18321273-CTG-TTT 16209393-CTG-TTT P6_Prx ***
17346138-CTTTC-TTTTT 15234258-CTTTC-TTTTT ***
19966688-AAAGAAGAAGAAGAAG-A,AAAGAAG 17854808-AAAGAAGAAGAAGAAG-A,AAAGAAG P5_Prx 26×AAG***
6400951-C-A 6532910-C-A FT226104 ***
25115872-G-GT 22969725-G-GT g1 9×T***
22348874-A-T 20186988-A-T DYZ19 ***
8350564-A-G 8482523-A-G ******
9978912-C-A 10141303-C-A ***
22493065-G-A 20331179-G-A DYZ19 ***
13596576-C-T 11440900-C-T ******
15430372-C-A 13318492-C-A ******
14767008-C-T 12655077-C-T F11511 ***
14356890-CTTTT-C,CT 12236185-CTTTT-C,CT 17×T******
14285877-C-A 12165171-C-A ******
14232961-C-A 12112255-C-A ***
14143069-C-A 12022363-C-A ******
13857880-G-T 11737174-G-T ******
13489629-C-G 11333953-C-G ***
10685327-C-A ******
13488971-C-A 11333295-C-A ***
13456721-C-A 11301045-C-A ******
11016285-T-A ******
11001689-G-T ******
10987127-C-T ***
10848426-C-A ******
10792322-C-A ***
22481820-G-T 20319934-G-T DYZ19 ***
22488722-G-C 20326836-G-C DYZ19 ***
15971761-G-GTT 13859881-G-GTT 11×T***
8549032-G-GTT 8680991-G-GTT 23×T***
13480907-C-T 11325231-C-T ***
7464057-G-A 7596016-G-A IR1_L ***
8614794-CT-C 8746753-CT-C 10×T***
58979152-AAG-GAA 56833005-AAG-GAA ***
9202319-T-G 9364710-T-G ***
22469673-G-T 20307787-G-T DYZ19 ***
27255256-G-GA 25109109-G-GA P1_g3 14×A***
27976945-CA-C 25830798-CA-C P1_Y2 12×A***
14137729-CCT-C 12017023-CCT-C ******
22447848-T-A 20285962-T-A BY3919 DYZ19 ***
22359716-A-C 20197830-A-C DYZ19 ***
22360234-A-C 20198348-A-C DYZ19 ***
20000745-AT-A 17888865-AT-A P5_Prx 11×T***
25652602-C-CT 23506455-C-CT P1_b3 11×T***
16114665-TTA-T 14002785-TTA-T P8_Prx 9×TA***
22512088-G-C 20350202-G-C DYZ19 ***
16533538-CAT-C 14421658-CAT-C ***
22498385-G-A 20336499-G-A DYZ19 ***
13476188-ATAAAT-TTACAC 11320512-ATAAAT-TTACAC ***
22361037-GT-TC 20199151-GT-TC DYZ19 ***
22504068-TAA-CAT 20342182-TAA-CAT DYZ19 ***
24771297-A-AT 22625150-A-AT P3_b2 12×T***
26279997-G-T 24133850-G-T P1_Y1 ***
9316196-C-A 9478587-C-A ***
22234403-G-A 20072517-G-A DYZ19 ***
58979206-TGCG-AGTA 56833059-TGCG-AGTA ***
22504082-CCAGT-GCAGA 20342196-CCAGT-GCAGA DYZ19 ***
9988037-G-A 10150428-G-A ***
22298663-T-A 20136777-T-A DYZ19 ***
25689959-TA-T 23543812-TA-T P1_b3 13×A***
9589945-CT-C 9752336-CT-C IR3_Prx 10×T***
24763477-T-TTG 22617330-T-TTG P3_b2 19×TG***
7084233-TCA-T 7216192-TCA-T 9×CA***
22288703-C-A 20126817-C-A DYZ19 ***
22288646-T-G 20126760-T-G DYZ19 ***
22288634-G-T 20126748-G-T DYZ19 ***
15785716-C-A 13673836-C-A ******
16180183-C-A 14068303-C-A ***
9692443-G-T 9854834-G-T IR3_Prx ***
10965167-CCAGG-GCAGT ***
13936263-GAGAAAGGGAAAGGGAGAAAGAAAG-AGAAGAGAAAGGGAAAGGGAGAAAGAAA,AGAAGAGAAAGGGAAAGGGAGAAAGAAAG 11815557-GAGAAAGGGAAAGGGAGAAAGAAAG-AGAAGAGAAAGGGAAAGGGAGAAAGAAA,AGAAGAGAAAGGGAAAGGGAGAAAGAAAG ***
13727625-A-T 11571949-A-T ***
13489619-ACCCCCACCACCACCCACCACCCCC-CCTCCCCACCAGCAACCCCAGCCCA,CGTCCTCACCCTCACCACCCACCCCC 11333943-ACCCCCACCACCACCCACCACCCCC-CCTCCCCACCAGCAACCCCAGCCCA,CGTCCTCACCCTCACCACCCACCCCC ***
13488971-CC-AG 11333295-CC-AG ***
13488959-GCC-CCT 11333283-GCC-CCT ***
13450413-CCATTCCATTCCATTCTATTCCATTCCA-GCATTCCATTCCG 11294737-CCATTCCATTCCATTCTATTCCATTCCA-GCATTCCATTCCG ***
13297411-G-T 11141735-G-T ***
10934813-AACATTT-AACATTA,CACATTT ***
22202438-C-A 20040552-C-A ***
10671479-AC-CT ***
10671456-GTTG-ATTA ***
10662614-TATTG-CATTC ***
10658418-CATGCCAC-AAT ***
8631383-CTTTTTTT-C,CTTTT 8763342-CTTTTTTT-C,CTTTT 26×T***
7935855-TAAAAA-T,TAAAAAA 8067814-TAAAAA-T,TAAAAAA 22×A***
6923212-C-A 7055171-C-A ***
21687983-CACAGAGAG-C,CACAGAG 19526097-CACAGAGAG-C,CACAGAG ***
56728192-AC-GG ***
6444954-ACA-G 6576913-ACA-G ***
22500839-T-C 20338953-T-C DYZ19 ***
9669475-G-T 9831866-G-T IR3_Prx ***
9587046-G-A 9749437-G-A IR3_Prx ***
9584899-G-T 9747290-G-T IR3_Prx ***
9573655-G-C 9736046-G-C IR3_Prx ***
9324913-G-C 9487304-G-C ***
6400990-GTTAT-CTTAG 6532949-GTTAT-CTTAG ***
22261382-C-T 20099496-C-T DYZ19 ***
22431900-A-C 20270014-A-C DYZ19 ***
56826513-CAATCAAG-TAATTAAT ***
56835110-GC-TT ***
56834897-CAGG-CAGC,TAGC ***
56834802-CTCCACTCT-CTCCACTCC,TTCCACTCC ***
56830501-TCAACT-ACAACA ***
56830382-C-TCACTG ***
56828824-CATTGCATTCAATTCCATTCG-AATTCCATTCCATTCCATTTG,CATTCCATTCCATACCATTCA ***
56826628-CA-TG ***
6786570-C-A 6918529-C-A ***
5204641-CA-C,CAA 5336600-CA-C,CAA 22×A***
13715356-C-G 11559680-C-G ***
23188051-C-A 21026165-C-A ***
22996012-CA-C,CAA 20834126-CA-C,CAA 18×A***
56849592-G-A ***
56849588-GT-G ***
56849585-A-AG ***
56827177-C-A ***
24406715-C-A 22260568-C-A ******
23952831-C-A 21806684-C-A ***
23054356-C-A 20892470-C-A ******
17050084-CT-C,CTT 14938204-CT-C,CTT 14×T***
21923295-ATTT-A,ATT 19761409-ATTT-A,ATT 15×T***
21445120-C-A 19283234-C-A ******
21133381-C-A 18971495-C-A ***
18793534-G-T 16681654-G-T ******
18691838-CTTT-C,CTT 16579958-CTTT-C,CTT 14×T***
17031061-C-A 14919181-C-A ******
16428483-C-A 14316603-C-A ******
18487808-TA-T 16375928-TA-T P6_Dst 19×A***
17284532-CTTT-C,CTTTT 15172652-CTTT-C,CTTTT 21×T***
2979209-T-A 3111168-T-A ***
19849833-C-A 17737953-C-A P5_Prx ***
16629335-CAAA-C,CAA 14517455-CAAA-C,CAA 19×A***
22493089-G-C 20331203-G-C DYZ19 ***
22500934-T-A 20339048-T-A DYZ19 ***
15171113-C-A 13059199-C-A ***
20226751-A-T 18064865-A-T ZZ23_2 P5_Dst ***
28070168-C-T 25924021-C-T P1_Y2 ***
10652357-TT-CA ***
6792628-CAAA-C,CAA 6924587-CAAA-C,CAA 18×A***
20516474-A-G 18354588-A-G P5_Dst ***
12874786-G-GCA 17×CA***
11004393-GCCATTCCATTCCATTCCATT-G ***
23293700-C-A 21131814-C-A ***
9671339-CTT-C 9833730-CTT-C IR3_Prx 14×T***
16406853-AT-A,ATT 14294973-AT-A,ATT 20×T***
18378959-CTTTT-C 16267079-CTTTT-C P6_Prx 28×T***
7126524-CTTTTT-C 7258483-CTTTTT-C 23×T***
17648009-CAAAA-C,CAAA 15536129-CAAAA-C,CAAA 17×A***
28257590-G-C 26111443-G-C P1_b4 ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Mutation Notes:

Kit POSITION-REF-ALT (hg19) POSITION-REF-ALT (hg38) Note
Manual8379144-CTTCT-C8511103-CTTCT-CJust one read, but positive.
Manual21464771-GTTC-G19302885-GTTC-G6 reads with the deletion of TTC, one read with a TTCTTC deletion.

Haplotype Progression

The data below reveals the progression of changes in the haplotype. The bottom row is the haplotype for this man and above him are the inferred ancestral haplotypes for various upstream blocks. These inferred haplotypes are very much a work in progress, and any suggested modifications are appreciated. I think we can use our vast collection of haplotype data to refine these haplotypes. Mutations made from each upstream block are shown in sequence. The cell color is determined by the block in which the mutation took place.

DYS393
DYS390
DYS19
DYS391
DYS385
DYS426
DYS388
DYS439
DYS389i
DYS392
DYS389ii
DYS458
DYS459
DYS455
DYS454
DYS447
DYS437
DYS448
DYS449
DYS464
DYS460
Y-GATA-H4
YCAII
DYS456
DYS607
DYS576
DYS570
CDY
DYS442
DYS438
DYS531
DYS578
DYF395S1
DYS590
DYS537
DYS641
DYS472
DYF406S1
DYS511
DYS425
DYS413
DYS557
DYS594
DYS436
DYS490
DYS534
DYS450
DYS444
DYS481
DYS520
DYS446
DYS617
DYS568
DYS487
DYS572
DYS640
DYS492
DYS565
DYS710
DYS485
DYS632
DYS495
DYS540
DYS714
DYS716
DYS717
DYS505
DYS556
DYS549
DYS589
DYS522
DYS494
DYS533
DYS636
DYS575
DYS638
DYS462
DYS452
DYS445
Y-GATA-A10
DYS463
DYS441
Y-GGAAT-1B07
DYS525
DYS712
DYS593
DYS650
DYS532
DYS715
DYS504
DYS513
DYS561
DYS552
DYS726
DYS635
DYS587
DYS643
DYS497
DYS510
DYS434
DYS461
DYS435
P312/S1161324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123315916122626191211131210912121011113012132413101020151913241712152412231810141791211
L21/S1451324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
DF21/S1921324141111-14121212131329179-1011112515192915-15-17-17111119-231615181836-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
S30581324141011-14121212131329179-1011112515192915-15-17-17111119-231615181836-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211121211912121011113012132413101020151913241712152412231810141791211
S4261324141011-14121212131329179-1011112515193015-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526191311121211912121011113012132413101020151913231712152412231810141791211
S1901324141011-14121212131329179-1011112515193013-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526201311121211912121011113012132413101020151913231712152412231810141791211
FGC32151324141011-14121212131329189-1011112515193013-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526201311121211912121011113012132413101020151913231712152412231810141791211
ZZ231324141011-14121212131329189-1011112515193013-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526201311131211913121011113012132413101020151913231712152412231810141791211
Y124641324141011-14121212131329189-1011112515193013-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526201311131211913121011113012132413101020151913231712152412231810141791211
ZZ251324141011-14121212131329189-1011112515193013-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526201311131211913121011113012132413101020151913231712152412231810141791211
Z179981324141011-14121212131329189-1011112515193013-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526201311131211913121011113012132413101020151913231712152412231810141791211
Z179991324141011-14121212131329199-1011112515193013-15-17-17111019-231615181836-36121211915-1691010810101222-231610121216811222014121113111112123115915122526201311131211913121011113012132413101020151913231712152412231810141791211
Z180001324141011-15121212131329199-1011112515193013-15-17-17111019-231615181836-36121211915-1691010810101222-231610121216811222014121114111112123115915122526201311131211913121011113012132413101020151913231712152412231810141791211
Z367491324141011-15121212131329199-1011112515193013-15-17-17111019-231615181836-36121211915-1691010810101222-231610121216811222014121114111112123115915122426201311131211913121011113012132413101020151913231712152412231810141791211
Z367481324141011-15121212131329189-1011112515193013-15-17-17111019-231515181836-36121211915-1691010810101222-231610121216811222014121114111112123015915122426201311131211913121011113012132413101020151913231712152412231810141791211
Z367501324141011-15121212131329189-1011112515193013-15-17-17111019-231515181836-36121211915-1691010810101222-231610121216811222014121114111112123015915122426201311131211913121011113012132413101020151913231712152412231810141791211
BY94001324141011-15121212131329199-1011112515193013-15-17-17111019-231515181836-36121211915-1691010810101222-2316101212168112220141211141111
Akin1324141011-15121212131329199-1011112515193013-15-17-17111019-231515181835-36121211915-1691010810101222-23161012121681122201412111411111212

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 1076721088370179141107998784
Kit: 107672990096780528787940693
Kit: 107672-A*16000000100000008300000
Used in age calculations1088370180528787998784
Counts of SNPs32
Variant counts last updated 2020-04-03 04:02:50.

* BED data not available. Using default values.


Big Tree Main Page