Tree Position

R-M269 > L23 > Z2103 > Z2106 > Z2108 > Z2110 > CTS7556 > Y5589 > Exact position not yet finalized.

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
106619
28547898-T-C 26401751-T-C BY38905 Y+
13653451-G-A 11497775-G-A BY38898 +
3016115-C-G 3148074-C-G A20152 FGC72702 +
6673732-G-T 6805691-G-T Y32147 YY+
22423689-G-A 20261803-G-A FGC72719 DYZ19 +
6742486-G-T 6874445-G-T Y60894 YY+
7216740-A-G 7348699-A-G Y33199 YY+
8512092-G-C 8644051-G-C Y63957 YY+
9481443-G-T 9643834-G-T BY38896 +
14174142-C-T 12053436-C-T PH970 YY+
22473365-G-C 20311479-G-C FGC72720 BY38903 DYZ19 +
14897576-C-T 12785642-C-T Y23373 YY+
22038983-T-A 19877097-T-A Y18958 YY+
16511733-C-A 14399853-C-A Y32148 YY+
16792841-A-G 14680961-A-G PH2535 YY+
16864950-T-G 14753070-T-G Y70635 YY+
19471076-G-T 17359196-G-T Y75417 YY+
19285127-C-A 17173247-C-A Y23374 YY+
19268974-GA-G 17157094-GA-G 9×A+
22443093-G-T 20281207-G-T BY38901 DYZ19 +
2851561-ATAAT-A 2983520-ATAAT-A +
22480033-G-A 20318147-G-A BY38904 DYZ19 +
7066305-C-T 7198264-C-T BY15969CTS883 Z2705 YY+
19209925-T-A 17098045-T-A CTS10016 YY+
19209943-C-T 17098063-C-T CTS10017 YY+
19209917-T-G 17098037-T-G CTS10015 YY+
6673834-TA-T 6805793-TA-T 10×A+
22886746-C-G 20724860-C-G Y32149 YY+
17237455-A-G 15125575-A-G PH2903 YY+
22458394-G-T 20296508-G-T Z17069 DYZ19 +
23042788-G-T 20880902-G-T Y32150 YY+
18883955-CATCT-C 16772075-CATCT-C 6×ATCT+
23043588-G-C 20881702-G-C Y23375 YY+
22715179-C-A 20553293-C-A **
10014512-A-G 10176903-A-G **
2970299-T-G 3102258-T-G BY38894 **
10014517-A-G 10176908-A-G **
22360398-C-T 20198512-C-T FGC80542 DYZ19 **
13140588-A-C 10630074-A-C **
9314826-A-G 9477217-A-G **
13858600-T-A 11737894-T-A **
10014561-A-G 10176952-A-G **
9952152-A-G 10114543-A-G **
22503423-C-G 20341537-C-G DYZ19 **
10014445-T-G 10176836-T-G FT120188 **
10066770-C-T 10229161-C-T PF6734 **
10066799-TA-T 10229190-TA-T **
9950600-C-T 10112991-C-T PF6726 **
9382463-G-T 9544854-G-T FGC72713 **
10014477-C-T 10176868-C-T **
10014508-G-T 10176899-G-T FGC52316 **
10014459-A-C 10176850-A-C **
22360426-A-T 20198540-A-T DYZ19 **
10020491-AAG-A 10182882-AAG-A ***
22451317-C-G 20289431-C-G DYZ19 ***
22454622-G-C 20292736-G-C DYZ19 ***
22451326-G-T 20289440-G-T DYZ19 ***
22451333-T-A 20289447-T-A DYZ19 ***
22449318-G-A 20287432-G-A DYZ19 ***
28801706-A-C 26655559-A-C ***
13461692-A-C 11306016-A-C ***
25736777-C-CA 23590630-C-CA P1_b3 14×A***
9985882-G-T 10148273-G-T ***
9985906-G-C 10148297-G-C ***
28786336-A-T 26640189-A-T ***
13465298-T-C 11309622-T-C ***
13860203-TTGAATGGAATGGGAA-T 11739497-TTGAATGGAATGGGAA-T ***
22451252-T-C 20289366-T-C DYZ19 ***
13705917-C-A 11550241-C-A ***
10037247-C-TT 10199638-C-TT ***
22454549-T-G 20292663-T-G DYZ19 ***
13677823-C-A 11522147-C-A ***
25105842-A-G 22959695-A-G g1 ***
19981433-T-G 17869553-T-G ZS1309 P5_Prx ***
22451364-G-A 20289478-G-A BY9949 DYZ19 ***
22451376-T-A 20289490-T-A DYZ19 ***
13457954-TCCAC-T 11302278-TCCAC-T ***
13842180-A-G 11721474-A-G ***
10019453-AAGG-A,AGAGGGAGAGAGAGAGA 10181844-AAGG-A,AGAGGGAGAGAGAGAGA ***
22451401-T-G 20289515-T-G BY23274 DYZ19 ***
9745897-A-C 9908288-A-C ***
22451254-A-T 20289368-A-T DYZ19 ***
22450532-A-C 20288646-A-C DYZ19 ***
25142607-A-G 22996460-A-G g1 ***
13866809-C-T 11746103-C-T FGC44233 ***
27643795-T-A 25497648-T-A P1_Y2 ***
26318644-A-T 24172497-A-T P1_Y1 ***
22448116-T-G 20286230-T-G DYZ19 ***
10018816-GC-G 10181207-GC-G ***
26267206-T-C 24121059-T-C P1_Y1 ***
13461157-T-A 11305481-T-A ***
26122993-G-T 23976846-G-T P1_Y1 ***
10020889-C-CTCTG 10183280-C-CTCTG ***
10020488-G-A 10182879-G-A ***
22484137-C-G 20322251-C-G DYZ19 ***
13866811-G-A 11746105-G-A ***
22511704-A-G 20349818-A-G DYZ19 ***
13868491-G-C 11747785-G-C ***
22218019-C-T 20056133-C-T DYZ19 ***
28787361-A-G 26641214-A-G ***
9954914-A-C 10117305-A-C ***
26025790-G-T 23879643-G-T P1_Y1 ***
13422376-T-TAA 11266700-T-TAA 8×A***
25290958-T-C 23144811-T-C P2_r1 ***
25063797-CT-C 22917650-CT-C g1 12×T***
13513140-TCCA-T 11357464-TCCA-T ***
13869095-G-GAGTGA 11748389-G-GAGTGA ***
28801616-C-T 26655469-C-T FT462193 ***
28801621-G-T 26655474-G-T ***
13702428-G-A 11546752-G-A ***
25241969-G-C 23095822-G-C P2_r1 ***
22447878-A-T 20285992-A-T DYZ19 ***
22449606-A-T 20287720-A-T DYZ19 ***
22447981-A-C 20286095-A-C DYZ19 ***
9979860-C-T 10142251-C-T ***
58980582-CTCCATTCCATTCCCT-C,CTCCATTCCATTCCCTTCCAC 56834435-CTCCATTCCATTCCCT-C,CTCCATTCCATTCCCTTCCAC ***
22289539-G-A 20127653-G-A DYZ19 ***
22511690-T-A 20349804-T-A DYZ19 ***
58974868-G-C 56828721-G-C ***
22442734-A-C 20280848-A-C FT456664 DYZ19 ***
22433736-T-A 20271850-T-A DYZ19 ***
6290935-G-C 6422894-G-C IR3_Dst ***
22432976-G-A 20271090-G-A DYZ19 ***
22359259-G-T 20197373-G-T DYZ19 ***
22344907-C-G 20183021-C-G DYZ19 ***
22340904-C-G 20179018-C-G DYZ19 ***
7769254-CT-C 7901213-CT-C 10×T***
8094642-G-GTA 8226601-G-GTA ***
22299657-C-G 20137771-C-G DYZ19 ***
22283931-A-C 20122045-A-C FGC81086 DYZ19 ***
13332160-C-A 11176484-C-A ***
22283726-C-A 20121840-C-A DYZ19 ***
22268858-T-C 20106972-T-C DYZ19 ***
13469688-C-G 11314012-C-G BY38897 ***
22261308-GT-G 20099422-GT-G DYZ19 ***
13737112-G-A 11581436-G-A ***
13743022-A-C 11587346-A-C ***
22258682-GT-G 20096796-GT-G DYZ19 ***
22254025-T-G 20092139-T-G DYZ19 ***
22253387-T-G 20091501-T-G DYZ19 ***
19926114-T-A 17814234-T-A P5_Prx ***
19882009-T-C 17770129-T-C P5_Prx ***
19870449-C-A 17758569-C-A P5_Prx ***
18290449-C-A 16178569-C-A P6_Prx ***
22454945-A-C,G 20293059-A-C,G DYZ19 ***
13332170-G-T 11176494-G-T ***
18434630-G-C 16322750-G-C P6_Dst ***
13859635-AC-A,AA 11738929-AC-A,AA ***
24966441-G-A 22820294-G-A g1 ***
10012977-G-C 10175368-G-C FGC25962 ***
10012981-A-G 10175372-A-G ***
10012985-T-C 10175376-T-C ***
13481203-A-C 11325527-A-C ***
58979285-TTCGAC-T 56833138-TTCGAC-T ***
13481116-G-T 11325440-G-T ***
13481118-A-T 11325442-A-T ***
24954687-C-T 22808540-C-T g1 ***
13481208-T-G 11325532-T-G ***
13455416-T-C 11299740-T-C ***
13804200-G-T 11683494-G-T ***
28786406-C-A 26640259-C-A ***
22296508-C-G 20134622-C-G BY22920 DYZ19 ***
9305961-G-A 9468352-G-A ***
5263891-G-C 5395850-G-C Z2126 ***
24952734-CAT-C 22806587-CAT-C g1 ***
24807396-T-C 22661249-T-C P3_b2 ***
22285607-G-A 20123721-G-A DYZ19 ***
9485887-T-TCA 9648278-T-TCA 12×CA***
24806762-G-A 22660615-G-A P3_b2 ***
24163867-C-T 22017720-C-T P3_b1 ***
58976142-G-A 56829995-G-A ***
13332142-C-A 11176466-C-A ***
13846467-A-C 11725761-A-C ***
22502029-G-C 20340143-G-C DYZ19 ***
13481115-A-C 11325439-A-C ***
24084197-C-T 21938050-C-T P3_b1 ***
22454860-G-T 20292974-G-T DYZ19 ***
10004701-A-G 10167092-A-G ***
13833485-A-G 11712779-A-G ***
13822383-T-G 11701677-T-G ***
13866840-T-G 11746134-T-G ***
13833497-T-A 11712791-T-A ***
13799165-C-CGAATGGAATG 11678459-C-CGAATGGAATG ***
13142134-T-G 10631620-T-G ***
10017868-A-G 10180259-A-G ***
13868509-T-A 11747803-T-A ***
13827154-G-T 11706448-G-T FT42115 ***
13822330-A-C 11701624-A-C Y23136 ***
22450447-TC-T 20288561-TC-T DYZ19 ***
13822326-A-T 11701620-A-T Y23135 ***
13450194-C-T 11294518-C-T ***
13143794-T-C 10633280-T-C ***
22455045-A-G 20293159-A-G DYZ19 ***
13818725-G-A 11698019-G-A ***
13713726-T-C 11558050-T-C HU86 ***
13453919-ACTT-A 11298243-ACTT-A ***
13868960-G-A 11748254-G-A ***
22296270-C-G 20134384-C-G BY22913 DYZ19 ***
22422555-A-C 20260669-A-C FGC77927 DYZ19 ***
58975855-A-C 56829708-A-C ***
22449506-G-T 20287620-G-T DYZ19 ***
22449372-T-A,G 20287486-T-A,G DYZ19 ***
18160863-T-TGATG 16048983-T-TGATG 11×GATG***
22455467-A-G 20293581-A-G DYZ19 ***
22450439-G-T 20288553-G-T DYZ19 ***
22450437-A-T 20288551-A-T DYZ19 ***
13868493-C-G 11747787-C-G ***
22296276-G-T 20134390-G-T BY22915 DYZ19 ***
22360952-A-G 20199066-A-G DYZ19 ***
22296275-T-C 20134389-T-C BY22914 DYZ19 ***
22296258-A-C 20134372-A-C DYZ19 ***
9978136-T-G 10140527-T-G ***
58977229-T-C 56831082-T-C ***
22293526-T-C 20131640-T-C BY29977 DYZ19 ***
9987854-A-T 10150245-A-T ***
22360979-A-G 20199093-A-G DYZ19 ***
13470029-A-C,T 11314353-A-C,T ***
22360522-T-G 20198636-T-G FGC76167 DYZ19 ***
10016126-T-G 10178517-T-G ***
13869507-G-A 11748801-G-A ***
13433497-T-A 11277821-T-A ***
10018828-A-G 10181219-A-G ***
10018819-G-T 10181210-G-T ***
28786646-G-A 26640499-G-A ***
28785928-A-G 26639781-A-G ***
22506700-T-G 20344814-T-G DYZ19 ***
13870053-T-A 11749347-T-A ***
13852010-T-C 11731304-T-C ***
13717440-A-G 11561764-A-G ***
13851261-A-G 11730555-A-G ***
13851242-A-G 11730536-A-G ***
13850216-A-C 11729510-A-C ***
13846536-A-G 11725830-A-G ***
13716113-T-A 11560437-T-A ***
13453579-T-A 11297903-T-A ***
13140226-A-C 10629712-A-C ***
13710835-T-A 11555159-T-A ***
13717473-G-T 11561797-G-T A17500 ***
22296246-A-T 20134360-A-T DYZ19 ***
13837397-G-A 11716691-G-A ***
22270322-C-T 20108436-C-T BY27165 DYZ19 ***
13869749-T-C 11749043-T-C ***
13862161-A-G 11741455-A-G ***
13846390-T-G 11725684-T-G ***
22487541-T-G 20325655-T-G FGC7865 ZS6003 DYZ19 ***
22360616-A-G 20198730-A-G DYZ19 ***
13837432-G-T 11716726-G-T ***
13689480-C-G 11533804-C-G ***
13860163-T-A 11739457-T-A ***
13459589-G-C 11303913-G-C ***
10020634-G-A 10183025-G-A ***
9937922-T-C 10100313-T-C ***
28805089-C-G 26658942-C-G BY205006 ***
25096447-AG-A 22950300-AG-A g1 ***
13868599-A-T 11747893-A-T ***
13860249-A-G 11739543-A-G ***
13860165-G-T 11739459-G-T ***
22454723-C-A 20292837-C-A DYZ19 ***
22510009-C-T 20348123-C-T DYZ19 ***
9989435-T-C 10151826-T-C PR1222 SA24 ***
22477632-A-C 20315746-A-C BY45813 DYZ19 ***
58858848-A-G 56732023-T-C ***
28801644-G-A 26655497-G-A ***
13480832-C-A 11325156-C-A ***
22235686-T-A 20073800-T-A DYZ19 ***
22235683-G-C 20073797-G-C DYZ19 ***
22223125-A-G 20061239-A-G DYZ19 ***
13486599-T-A 11330923-T-A ***
22477629-T-G 20315743-T-G BY223854 DYZ19 ***
28787970-A-G 26641823-A-G ***
13867077-A-G 11746371-A-G ***
22343731-G-C 20181845-G-C DYZ19 ***
9995312-A-C 10157703-A-C ***
9995308-C-G 10157699-C-G ***
13447230-T-C 11291554-T-C ***
10016072-C-T 10178463-C-T ***
58980858-T-A 56834711-T-A ***
22451275-T-G 20289389-T-G DYZ19 ***
13140500-C-T 10629986-C-T ***
22284069-A-G 20122183-A-G DYZ19 ***
9989446-G-A 10151837-G-A FT373829 ***
13868544-T-A 11747838-T-A ***
13868528-A-T 11747822-A-T ***
13814084-T-C 11693378-T-C ***
58981827-A-T 56835680-A-T ***
22481411-A-G 20319525-A-G DYZ19 ***
9979864-T-TC 10142255-T-TC ***
13846459-C-G 11725753-C-G ***
14026945-A-ATATCTATCTATC 11906239-A-ATATCTATCTATC 10×TATC***
13480866-C-T 11325190-C-T ***
22289476-C-G 20127590-C-G DYZ19 ***
22289475-A-T 20127589-A-T DYZ19 ***
9977776-T-G 10140167-T-G ***
13833467-G-A 11712761-G-A FT328604 ***
58883850-T-C 56707021-A-G ***
13858643-T-A 11737937-T-A ***
13809163-G-A 11688457-G-A FT146225 ***
58978666-T-C 56832519-T-C ***
10018822-G-A 10181213-G-A ***
22510035-T-A,C 20348149-T-A,C DYZ19 ***
13839288-A-AT 11718582-A-AT ***
22455281-T-A 20293395-T-A DYZ19 ***
22247013-CAG-C 20085127-CAG-C DYZ19 ***
13863699-T-A 11742993-T-A ***
13735620-A-G 11579944-A-G ***
10018417-G-A 10180808-G-A ***
22455036-C-T 20293150-C-T DYZ19 ***
13866845-A-G 11746139-A-G ***
13833481-T-C 11712775-T-C ***
28787326-T-G 26641179-T-G ***
13833071-A-G 11712365-A-G ***
13735613-T-A 11579937-T-A ***
13143312-C-T 10632798-C-T A11365 ***
13142130-C-G 10631616-C-G ***
9959008-G-A 10121399-G-A ***
58979339-ACTCTACTTCT-A 56833192-ACTCTACTTCT-A ***
22510061-A-T 20348175-A-T DYZ19 ***
22507909-A-G 20346023-A-G DYZ19 ***
22293534-C-A 20131648-C-A DYZ19 ***
13801056-A-AG 11680350-A-AG ***
13732034-A-T 11576358-A-T ***
13513140-T-C 11357464-T-C ***
13869102-C-T 11748396-C-T ***
58980889-C-T 56834742-C-T ***
13833480-C-T 11712774-C-T ***
13473982-T-A 11318306-T-A ***
13143720-T-C 10633206-T-C 11×ATTCC***
22454823-A-C 20292937-A-C DYZ19 ***
28798898-A-T 26652751-A-T ***
13801051-A-ATCAG 11680345-A-ATCAG ***
22455056-T-C 20293170-T-C DYZ19 ***
22454652-T-A 20292766-T-A DYZ19 ***
22261044-A-G 20099158-A-G DYZ19 ***
13489359-G-A 11333683-G-A ***
10015233-G-A 10177624-G-A ***
22456183-G-A 20294297-G-A DYZ19 ***
22244643-C-T 20082757-C-T BY22436 DYZ19 ***
13809697-T-C 11688991-T-C ***
22454716-G-A 20292830-G-A DYZ19 ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 1066191090061479310008014354
Used in age calculations1090061479310008014354
Counts of SNPs2021
Variant counts last updated 2022-07-30 03:29:52.



Big Tree Main Page