Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > DF21/S192 > FGC3213 > ZZ1 > S3058 > S424 > S426 > S190 > FGC3215 > FGC3216 > FGC3197 > FGC3198 > FGC7854

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFB38
P9UH4-A
FGC
P9UH4
Manual
Edits
22237313-C-CT 20075427-C-CT DYZ19 +
35128-T-A FGC77797 +
35936-G-C FGC77603 +
35882-G-A FGC77175 +
10936948-A-T +
30520-C-A FGCLR36 +
29396-T-G FGC76931 +
8790228-A-G 8922187-A-G FGC3199 YY+*
27104-T-C +
27093-T-G +
27049-G-T FGC77613 +
24880-A-C FGCLR159 +
8292-T-G FGCLR226 +
59000770-T-TTGG 56854623-T-TTGG +***
14750-GTGGGG-TTTCAT +
11675277-AAAC-GAAT +
31130-T-G FGCLR37 +
23468-G-A FGCLR33 +
32872-G-T +
21464556-GAAAAG-AAAAAA 19302670-GAAAAG-AAAAAA +
18439427-TA-T 16327547-TA-T P6_Dst +
56877857-AAAAAAAAAAAAAAAAGGAG-CAAAAAAAAAGGGA +
36634-AAAAA-TAAAG +
34920-G-A +
58890696-G-A 56700175-C-T +
11666068-T-C +
13413-TAC-GGT +
13979797-T-C 11859091-T-C FGC3204 Y++
15612-AA-TC +
27614542-C-T 25468395-C-T P1_Y2 18×T+
14882-GT-G +
14857-GT-G +
11653101-NN-GA +
14873-AGT-TAG +
28534936-GTTTC-TTTTT 26388789-GTTTC-TTTTT +
23761672-A-C 21599786-A-C YP1209 Y+**
21805280-NN-TC +
22502503-AG-TA 20340617-AG-TA DYZ19 *
9952613-CACAT-TACAC 10115004-CACAT-TACAC *
13450930-CC-AT 11295254-CC-AT *
22481833-G-C 20319947-G-C DYZ19 *
22501509-C-G 20339623-C-G DYZ19 *
13448576-CTCTAT-TTCCAC 11292900-CTCTAT-TTCCAC *
58880323-C-T 56710548-G-A *
13565113-GTAT-ATAC 11409437-GTAT-ATAC *
22501549-A-C 20339663-A-C DYZ19 *
22501556-G-A 20339670-G-A DYZ19 *
13498002-TG-AA 11342326-TG-AA *
13251213-A-G 11095537-A-G *
22505044-G-T 20343158-G-T DYZ19 *
13694687-G-A 11539011-G-A *
22432968-A-G 20271082-A-G DYZ19 *
13688965-TGAAG-GGAAA 11533289-TGAAG-GGAAA *
28795663-CATC-GATA 26649516-CATC-GATA *
13707161-GGT-TGC 11551485-GGT-TGC *
59009355-G-T 56863208-G-T *
22501658-T-G 20339772-T-G DYZ19 *
20473133-G-A 18311247-G-A BY154935 P5_Dst *
22503441-C-G 20341555-C-G DYZ19 *
22481867-G-T 20319981-G-T DYZ19 *
27483421-A-G 25337274-A-G P1_Y2 *
58867066-A-T 56723805-T-A *
22343282-G-C 20181396-G-C DYZ19 *
58854637-CGATG-GCATT 56736230-CATCG-AATGC *
22351379-G-A 20189493-G-A DYZ19 *
10047855-ACACC-CCACA 10210246-ACACC-CCACA *
20751042-G-A 18589156-G-A P4_Prx 13×A*
28810533-GGCA-AGGG 26664386-GGCA-AGGG *
28802622-CGGA-TGGC 26656475-CGGA-TGGC *
19628136-T-G 17516256-T-G P5_Prx *
27221-T-C *
36453-T-G FGC77518 *
27176-C-A *
13515238-A-G 11359562-A-G *
19816-TA-AC *
56837376-A-C *
28807151-T-C 26661004-T-C *
11003571-C-T *
22238323-TAAA-AAAC 20076437-TAAA-AAAC DYZ19 *
56872325-G-A,T *
20551642-A-C 18389756-A-C P5_Dst *
19760-C-T *
19731-A-T *
22492650-A-C 20330764-A-C DYZ19 *
13449764-TATTCCATTCT-CATTGCATTCC 11294088-TATTCCATTCT-CATTGCATTCC *
22492755-G-C 20330869-G-C DYZ19 *
22496697-A-G 20334811-A-G DYZ19 *
34258-G-T FGC77591 *
59012364-AAAT-TAAG 56866217-AAAT-TAAG *
22297923-TCAC-ACAG 20136037-TCAC-ACAG DYZ19 *
22493308-A-T 20331422-A-T DYZ19 *
22493388-A-G 20331502-A-G DYZ19 *
58983577-A-G 56837430-A-G *
58983538-T-C 56837391-T-C *
28806891-GG-TT 26660744-GG-TT *
22501089-A-T 20339203-A-T DYZ19 *
28806847-TAG-GAT 26660700-TAG-GAT *
22481826-G-C 20319940-G-C DYZ19 *
22490333-A-G 20328447-A-G DYZ19 *
22314659-C-T 20152773-C-T DYZ19 *
27483042-G-A 25336895-G-A P1_Y2 *
22351368-T-A 20189482-T-A DYZ19 *
13535098-C-A 11379422-C-A *
13244874-A-G 11089198-A-G *
13261085-G-A 11105409-G-A *
13264217-TTC-T 11108541-TTC-T *
13268004-A-T 11112328-A-T *
13411573-G-A 11255897-G-A *
13500598-A-G 11344922-A-G A10798 *
13533339-A-G 11377663-A-G *
13533349-G-A 11377673-G-A *
13569797-T-A 11414121-T-A *
9946170-C-T 10108561-C-T Y*
28582566-C-G 26436419-C-G *
58968064-C-T 56821917-C-T *
58970570-G-A 56824423-G-A *
58998283-A-G 56852136-A-G *
58999713-C-A 56853566-C-A *
59000043-C-T 56853896-C-T *
59000116-G-A 56853969-G-A *
59002728-G-A 56856581-G-A *
9964281-G-A 10126672-G-A Y*
13717777-GTCA-CTCG 11562101-GTCA-CTCG *
59007644-C-A 56861497-C-A *
59022708-A-G 56876561-A-G *
58880269-C-T 56710602-G-A *
58971523-G-GAACA 56825376-G-GAACA *
58998489-G-GA 56852342-G-GA *
59001722-G-A 56855575-G-A *
59002627-G-T 56856480-G-T *
59002632-G-A 56856485-G-A *
59006977-TA-T 56860830-TA-T *
59018657-GCTGT-G 56872510-GCTGT-G *
13705110-T-A 11549434-T-A *
13451745-AC-GT 11296069-AC-GT *
27794677-C-CAT 25648530-C-CAT P1_Y2 12×AT*
22320494-C-A 20158608-C-A DYZ19 *
22320849-T-G 20158963-T-G DYZ19 *
22323036-A-C 20161150-A-C DYZ19 *
22481770-C-T 20319884-C-T DYZ19 *
22493637-T-C 20331751-T-C DYZ19 *
22501241-G-T 20339355-G-T DYZ19 *
13723167-GG-TT 11567491-GG-TT *
28812733-TTA-GTG 26666586-TTA-GTG *
59005020-T-C 56858873-T-C *
59008282-T-C 56862135-T-C *
22495101-T-G 20333215-T-G DYZ19 *
9936297-CACG-GACA 10098688-CACG-GACA *
28814590-TC-GA 26668443-TC-GA *
22455451-G-T 20293565-G-T DYZ19 *
28224059-A-G 26077912-A-G P1_b4 *
22321064-T-G 20159178-T-G DYZ19 *
13711825-A-C 11556149-A-C *
22367425-T-G 20205539-T-G DYZ19 *
22355517-G-C 20193631-G-C DYZ19 *
22503805-G-A 20341919-G-A DYZ19 *
13503039-TA-T 11347363-TA-T *
58974437-ATTC-GTTT 56828290-ATTC-GTTT *
27483079-T-C 25336932-T-C P1_Y2 *
13204025-ATAATGG-CTGATGA 11048349-ATAATGG-CTGATGA *
13514189-ATG-GTT 11358513-ATG-GTT *
13268061-AG-CA 11112385-AG-CA *
22324469-A-C 20162583-A-C DYZ19 *
9965245-GAACTAT-AAACAA 10127636-GAACTAT-AAACAA *
59031513-CC-GG 56885366-CC-GG *
59012419-AT-CA 56866272-AT-CA *
58977739-ATTG-TTTA 56831592-ATTG-TTTA *
13690848-CAA-GAT 11535172-CAA-GAT *
59008918-C-T 56862771-C-T *
59014682-AAT-A 56868535-AAT-A *
59009693-C-T 56863546-C-T *
59011061-T-A 56864914-T-A *
59012085-T-C 56865938-T-C *
59012232-GTA-G 56866085-GTA-G *
59013026-A-T 56866879-A-T *
59013179-G-T 56867032-G-T *
59014490-C-T 56868343-C-T *
59014536-A-G 56868389-A-G *
59017886-C-T 56871739-C-T *
59031595-C-T 56885448-C-T *
59018641-G-A 56872494-G-A *
59018683-G-A 56872536-G-A *
59018723-C-T 56872576-C-T *
59020900-T-C 56874753-T-C *
59024563-T-C 56878416-T-C *
59024573-G-A 56878426-G-A *
59024628-A-T 56878481-A-T *
59024836-G-T 56878689-G-T *
59031248-T-A 56885101-T-A *
13694270-ATGAC-GTGAA 11538594-ATGAC-GTGAA *
22496853-A-G 20334967-A-G DYZ19 *
28583599-GTG-CTA 26437452-GTG-CTA *
20428171-A-C 18266285-A-C P5_Dst *
27389579-G-A 25243432-G-A P1_g3 *
56835849-CACTCCATTCCAATCCGTGCCAC-ACTCCATTCCAATCCATGCCAC,ACTCCATTCCAATCCATGTCAA *
6533787-G-A 6665746-G-A *
6547179-C-A 6679138-C-A *
6584055-TAACTC-T 6716014-TAACTC-T *
7664475-T-G 7796434-T-G Y*
7664481-T-G 7796440-T-G Y*
13446325-GCT-ACA,GCA 11290649-GCT-ACA,GCA *
20428181-C-A 18266295-C-A P5_Dst *
56836191-CTTCG-CTTTG,TTTCA *
20428186-CTGG-ATGT 18266300-CTGG-ATGT P5_Dst *
22322371-C-T 20160485-C-T DYZ19 *
22323223-C-T 20161337-C-T DYZ19 *
22323625-A-C 20161739-A-C DYZ19 *
22323958-G-C 20162072-G-C DYZ19 *
22331275-T-A 20169389-T-A DYZ19 *
22343230-T-A 20181344-T-A DYZ19 *
22343238-C-T 20181352-C-T DYZ19 *
56857067-AAAAAAAT-A,AAAT *
13449164-G-ATCCCACTCCT 11293488-G-ATCCCACTCCT *
22360966-AA-AC,CA 20199080-AA-AC,CA DYZ19 *
28803998-GG-TT 26657851-GG-TT *
28793003-CAT-AAG 26646856-CAT-AAG *
28793486-TAATGGAATGGAATGGAATGGAATGGAAT-GAATGGAATGGAATGGAATGGAATGGAAC,TAATGTAATGGAATGGAATGGAATGGAAT 26647339-TAATGGAATGGAATGGAATGGAATGGAAT-GAATGGAATGGAATGGAATGGAATGGAAC,TAATGTAATGGAATGGAATGGAATGGAAT 7×AATGG*
28793555-CAAAT-GAAAC 26647408-CAAAT-GAAAC *
28794071-AA-CT 26647924-AA-CT *
28795410-GGCA-AGGG 26649263-GGCA-AGGG *
28797186-TAAG-GAAT 26651039-TAAG-GAAT *
28797371-ATC-GTA 26651224-ATC-GTA *
28799770-AAGGA-CAGGC 26653623-AAGGA-CAGGC *
28804032-CAGAGTGG-TAGAGTGC 26657885-CAGAGTGG-TAGAGTGC *
56870780-CA-CG,TG *
28805301-TCGG-ACGC 26659154-TCGG-ACGC *
28805796-CGT-TGG,TGT 26659649-CGT-TGG,TGT *
28809773-CAGAGTGG-TAGAGTGC 26663626-CAGAGTGG-TAGAGTGC *
28813876-TCGG-ACGC 26667729-TCGG-ACGC *
28817559-TAT-GAG,GAT 26671412-TAT-GAG,GAT *
19879-AG-GC *
56849999-GGTTA-TGTCT *
56867470-TATA-AATA,AATG *
22355674-C-G 20193788-C-G DYZ19 *
22481818-ACG-CCT 20319932-ACG-CCT DYZ19 *
22457534-TGTGTC-AGTGGT 20295648-TGTGTC-AGTGGT DYZ19 *
56856114-AAAA-AG,G *
56830541-GC-AT *
56834249-GTTCCATTCCATTCCATTCC-ATTCCGTTCCATTCCATTCCATTCT 4×TTCCA*
56836993-TTCCATTC-CTG *
56848710-CAT-CAC,GAC *
56852256-CA-ACC *
56852449-CA-TG *
56852959-TGACA-AGACA,AGACG *
56854117-CA-ACC,CC *
56861289-TTTTTTTTTT-ATATTTATTTTTT,ATTTTTATTTTTTA *
56827528-TTTCCTTTCCATTCCA-T,TTTCCATTCCATTCCA *
56866560-TG-GG,GT *
56869653-TCACA-CCATG,TCACG *
56878564-TAATT-T,TAATC *
56880908-GAGA-TAGG *
13453840-CTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCAT-CTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCAA,TTCCACTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCAT 11298164-CTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCAT-CTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCAA,TTCCACTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCAT 10×TCCAT*
13486612-AGGT-GGGA,GGGT 11330936-AGGT-GGGA,GGGT *
56831681-GACTCCACTCAACTCC-CACTCCACTCAACTCC,CATTCCCCTCCTCTCA *
56834434-ACTCCATTCCATTCCCT-ACTCCATTCCATTCCCTTCCAC,CTTCCATTCCATTCCCT *
56827548-TTTCCAT-ATGCGAG,ATTCCAT *
28587895-CCC-TCT 26441748-CCC-TCT *
22485112-AGAG-TGAC 20323226-AGAG-TGAC DYZ19 *
25730924-G-C 23584777-G-C P1_b3 *
22493488-A-G 20331602-A-G DYZ19 *
22493499-T-C 20331613-T-C DYZ19 *
22497817-T-G 20335931-T-G DYZ19 *
24063605-G-C 21917458-G-C P3_b1 *
24693941-G-A 22547794-G-A P3_b2 *
25311029-C-T 23164882-C-T P2_r1 *
25378117-G-A 23231970-G-A P2_r2 *
25419806-CT-C 23273659-CT-C P2_r2 16×T*
26477536-C-T 24331389-C-T P1_Y1 *
28582605-T-A,C 26436458-T-A,C *
26572829-C-T 24426682-C-T P1_g2 *
26819062-G-A 24672915-G-A P1_g2 *
26842075-TA-T 24695928-TA-T P1_r3 17×A*
26947102-C-T 24800955-C-T P1_r3 *
27003352-G-A 24857205-G-A P1_r4 *
27483061-C-T 25336914-C-T P1_Y2 *
27489479-A-G 25343332-A-G P1_Y2 *
28231450-C-G 26085303-C-G P1_b4 *
22457560-AGG-GGA 20295674-AGG-GGA DYZ19 *
22253943-T-C 20092057-T-C DYZ19 *
13694670-AGGA-CGGC 11538994-AGGA-CGGC *
25784078-A-C 23637931-A-C P1_b3 *
22355982-T-C 20194096-T-C DYZ19 *
22496895-C-T 20335009-C-T DYZ19 *
13362927-CTT-C 11207251-CTT-C 12×T*
22492211-C-T 20330325-C-T DYZ19 *
22492219-G-A 20330333-G-A DYZ19 *
22492240-G-A 20330354-G-A DYZ19 *
11003579-TC-T *
13514243-T-C 11358567-T-C *
23703760-G-A 21541874-G-A *
24057217-C-T 21911070-C-T P3_b1 *
28257621-T-A 26111474-T-A P1_b4 *
26476558-C-T 24330411-C-T P1_Y1 *
10972838-C-A *
27248-C-A *
27409-T-C *
27453-G-A *
9936449-TG-CA 10098840-TG-CA *
9952497-AG-GA,GG 10114888-AG-GA,GG *
28810437-GGT-AGGG 26664290-GGT-AGGG *
22493523-A-C 20331637-A-C DYZ19 *
10061852-TAC-CAT 10224243-TAC-CAT *
28811012-TCGG-ACGC 26664865-TCGG-ACGC *
20738728-G-T 18576842-G-T P4_Prx **
20905447-C-A 18743561-C-A P4_Dst **
20121812-T-C 18009932-T-C ZZ85_2 P5_Dst *
22453768-C-T 20291882-C-T DYZ19 *
22453776-G-A 20291890-G-A DYZ19 *
22453797-G-A 20291911-G-A DYZ19 *
28582481-T-A 26436334-T-A *
28809934-AGAAT-GGAAG 26663787-AGAAT-GGAAG *
9980474-C-T 10142865-C-T Y*
19770-C-T *
11003609-G-C *
13497335-G-A 11341659-G-A *
22501170-T-C 20339284-T-C DYZ19 *
22501251-G-T 20339365-G-T DYZ19 *
22501518-G-T 20339632-G-T DYZ19 *
22501525-T-A 20339639-T-A DYZ19 *
22501568-T-A 20339682-T-A DYZ19 *
56756653-C-A,G *
9961197-ATT-GTG 10123588-ATT-GTG *
10061899-ACAG-GCAT 10224290-ACAG-GCAT *
13850547-CATGGAATGGA-C,CATGGAATGGC 11729841-CATGGAATGGA-C,CATGGAATGGC 7×ATGGA*
13696759-CGAAC-CGAAT,GGAAC 11541083-CGAAC-CGAAT,GGAAC *
13689738-CTC-ATG,ATGGACTC 11534062-CTC-ATG,ATGGACTC *
13689934-CGGAG-CGGAA,TGGAA 11534258-CGGAG-CGGAA,TGGAA *
13690439-TAA-CAG 11534763-TAA-CAG *
13691626-CAAAATA-TAGAATT 11535950-CAAAATA-TAGAATT *
13691798-T-AATGGA,TATGGA 11536122-T-AATGGA,TATGGA *
13692824-GGAAC-AGAAT 11537148-GGAAC-AGAAT *
13693201-AGTCA-AGTCG,CGTCG 11537525-AGTCA-AGTCG,CGTCG *
13694812-AATGGG-GATTGC,GATTGG 11539136-AATGGG-GATTGC,GATTGG *
13705116-GG-TT 11549440-GG-TT *
13564093-TGAAA-CGAAG 11408417-TGAAA-CGAAG *
13706085-TATGGCG-AATGGCA 11550409-TATGGCG-AATGGCA *
13709156-CACTGGAATGGAA-GAT 11553480-CACTGGAATGGAA-GAT *
13712659-GAATA-AAATG,GAATG 11556983-GAATA-AAATG,GAATG *
13719489-AT-AA,TA 11563813-AT-AA,TA *
13720826-CA-TT 11565150-CA-TT *
13725970-CGAAC-CGAAT,GGAAC 11570294-CGAAC-CGAAT,GGAAC *
13726023-CTGGAATGGAA-T,TTGGAATGGAA 11570347-CTGGAATGGAA-T,TTGGAATGGAA *
13726355-CAA-GAA,GAC 11570679-CAA-GAA,GAC *
13688232-GAATGC-GAATGG,TAATGG 11532556-GAATGC-GAATGG,TAATGG *
13564080-TG-CC 11408404-TG-CC *
10683305-CA-AT,CT *
13272738-TT-CC,CT 11117062-TT-CC,CT *
10900008-CTCCA-ATCCC *
10986745-GAA-AAC,GAC *
13262027-C-A 11106351-C-A *
13263468-GGT-ACA,GCA 11107792-GGT-ACA,GCA *
13263676-TGCG-AGCT,TGTG 11108000-TGCG-AGCT,TGTG *
13267843-CC-AC,AT 11112167-CC-AC,AT *
13267850-GCTCA-CCTCA,CCTCT 11112174-GCTCA-CCTCA,CCTCT *
13271055-G-AAA 11115379-G-AAA *
13446484-TG-CA,CG 11290808-TG-CA,CG *
13468234-ATG-TTC 11312558-ATG-TTC *
13448317-CTCCAT-TTCCAC 11292641-CTCCAT-TTCCAC *
13448563-GAAATC-G,GCAATC 11292887-GAAATC-G,GCAATC *
13449059-GTTCCACTG-ATTC,ATTCCACTG 11293383-GTTCCACTG-ATTC,ATTCCACTG *
13449326-TTT-ATT,CTA 11293650-TTT-ATT,CTA *
13450503-ACACTCCACTCCACTCCACTTCACTCCAC-ACACTCCACTCCACTCCAC,CCACTCCACTCCACTCCAATCCATCCCAT 11294827-ACACTCCACTCCACTCCACTTCACTCCAC-ACACTCCACTCCACTCCAC,CCACTCCACTCCACTCCAATCCATCCCAT *
13450996-CAT-CAC,TAC 11295320-CAT-CAC,TAC *
13451074-CTAT-GGAA,GGAT 11295398-CTAT-GGAA,GGAT *
13452125-TTCCACTG-CTCCACTG,CTCTACTC 11296449-TTCCACTG-CTCCACTG,CTCTACTC *
13452227-CCACTC-C,G 11296551-CCACTC-C,G *
28582622-G-A 26436475-G-A A13716 *
56834779-GCA-CCA,GCG 4×CATTC*
13565107-A-G 11409431-A-G *
13513507-C-A 11357831-C-A FGC78372 *
13691232-CGC-GGG 11535556-CGC-GGG *
13468192-CTTAT-GTTAC 11312516-CTTAT-GTTAC *
13508841-A-G 11353165-A-G *
13468273-CCAT-TCGC 11312597-CCAT-TCGC *
9936329-C-A 10098720-C-A Y*
9936338-T-A 10098729-T-A Y*
9936357-T-A 10098748-T-A Y*
9964942-C-T 10127333-C-T FT262965 Y*
13499008-T-A 11343332-T-A *
10789463-GC-AG,GG *
13497289-A-G 11341613-A-G *
13495453-G-A 11339777-G-A *
28583163-T-C 26437016-T-C *
13286202-C-G 11130526-C-G *
13535056-A-G 11379380-A-G *
13362949-C-T 11207273-C-T FGC81169 *
28586221-A-G 26440074-A-G CTS12419 *
13347932-T-C 11192256-T-C 21×AC*
13296793-T-C 11141117-T-C *
13267992-G-A 11112316-G-A *
13259457-C-T 11103781-C-T BY3844 *
28585427-T-G 26439280-T-G *
28585444-G-C 26439297-G-C *
28585456-C-A 26439309-C-A FT307001 *
3547140-T-A 3679099-T-A 8×A*
22503789-T-C 20341903-T-C DYZ19 *
59013629-T-A 56867482-T-A *
22324619-G-T 20162733-G-T DYZ19 *
28582676-G-A 26436529-G-A FT306994 ***
59008936-A-AT 56862789-A-AT 8×T*
13535073-T-A 11379397-T-A *
22423729-T-C 20261843-T-C FGC58229 DYZ19 *
22504988-T-G 20343102-T-G DYZ19 *
28807106-C-G 26660959-C-G PF1347 *
22423737-G-A 20261851-G-A DYZ19 *
28808737-T-C 26662590-T-C PF1350 *
13546567-G-A 11390891-G-A *
13563985-G-A 11408309-G-A *
28808749-A-T 26662602-A-T PF1351 *
13564004-A-G 11408328-A-G *
13564273-T-A 11408597-T-A *
58979862-TG-CT 56833715-TG-CT *
22360051-C-G 20198165-C-G DYZ19 *
28805345-CA-AT 26659198-CA-AT *
13546500-G-T 11390824-G-T *
28812475-ATC-GTA 26666328-ATC-GTA *
28807090-T-G 26660943-T-G *
13709578-CA-TT 11553902-CA-TT *
58979661-TTTAC-ATTAT 56833514-TTTAC-ATTAT *
22481783-A-T 20319897-A-T DYZ19 *
13565045-C-A 11409369-C-A *
28582685-C-A 26436538-C-A FT306995 ***
13564989-G-C 11409313-G-C *
13700609-T-C,G 11544933-T-C,G *
22503841-T-G 20341955-T-G DYZ19 *
2783726-CAAACAAAC-AAAAAAAAA 2915685-CAAACAAAC-AAAAAAAAA **
10908390-CA-TG **
10927427-TA-CG **
13545351-AGAAAGAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAG-GAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAA 11389675-AGAAAGAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAG-GAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAA **
36730-C-T **
10930792-A-C **
10994207-TT-CG **
10764214-CTCCACA-TTGCACT **
22337705-A-G 20175819-A-G DYZ19 **
10764197-TG-CT **
10821681-TCAT-ACAC **
10801762-TAT-AAC **
10928720-A-T **
22353430-GAA-TAG 20191544-GAA-TAG DYZ19 **
10928711-C-A **
10911616-A-T **
4726-A-G FGC77664 **
56704748-C-A **
10994189-TCATTCTATA-CCACTCCATT **
22266272-G-C 20104386-G-C DYZ19 **
10936882-C-T **
10936894-C-T **
10917966-C-G **
11654632-T-C **
10936224-C-T **
58823338-TTC-ATT 56767531-GAA-AAT **
58859945-C-T 56730926-G-A *****
12371755-A-G **
10916335-A-G **
10692062-C-A **
10868553-T-A **
10868539-T-C **
20826389-CTTTCTTTC-TTTTTTTTT 18664503-CTTTCTTTC-TTTTTTTTT P4_Gap **
18227549-G-GT 16115669-G-GT 14×T*****
22281896-T-G 20120010-T-G DYZ19 **
10957767-N-A **
11660375-N-T **
10793969-T-C **
58845839-CATTCGAGTCCATTCG-C 56745015-TTCGAATGGACTCGAA-T **
24672342-C-G 22526195-C-G P3_b2 **
26386507-GAAAAAC-AAAAAAA 24240360-GAAAAAC-AAAAAAA P1_Y1 **
10922487-N-T **
26310632-C-CTTTT 24164485-C-CTTTT P1_Y1 28×T**
22252915-T-G 20091029-T-G DYZ19 **
4700-T-G FGC80356 **
36719-A-G **
10982820-A-C **
14982-T-G **
17275757-AA-GG 15163877-AA-GG **
22295936-AC-GT 20134050-AC-GT DYZ19 **
18892211-A-AT 16780331-A-AT **
10793993-CTA-TTC **
19377331-G-A 17265451-G-A ****
13329224-G-T 11173548-G-T **
10834132-ACATT-TCATG **
10655805-CGACAG-GAGAT **
10746845-T-C **
10744418-CCATT-ACATG **
10668043-CAATTC-A **
10693710-GTTGCA-TTTCCG **
10693698-CC-AA **
10782700-GCTC-ACTT **
10763851-G-A **
27701027-C-T 25554880-C-T P1_Y2 **
5786608-C-CAAAAAAAAAAAAA 5918567-C-CAAAAAAAAAAAAA 20×A**
10692261-AAAC-CAAA **
10807361-TTTCCAC-ATTTCCCT **
10834102-AAG-CAA **
10793951-CACC-TGCT **
10795028-GTA-ATC **
13139814-G-T 10629300-G-T **
10795020-ATGA-GTGT **
10997421-A-G **
10834089-TTCACA-GTCCCC **
10836461-CTCC-TTCG **
10629312-CTACTCC-ACATTAA **
10754280-TA-CC **
20526874-T-C 18364988-T-C P5_Dst **
20692965-CAAAAA-C 18531079-CAAAAA-C P4_Prx 19×A**
10754648-TCCAC-CCCAG **
10769195-C-T **
22236702-G-A 20074816-G-A DYZ19 **
19937284-G-GCCCCCCC 17825404-G-GCCCCCCC P5_Prx 13×C**
10749944-TCCAA-ACCAT **
10748308-TG-AC **
10879393-C-A **
10942651-ACATTCCACTT-CAGTTAAACTC **
3956691-AAC-A 4088650-AAC-A 12×AC*****
10866327-CACA-TACG **
22330071-T-TA 20168185-T-TA DYZ19 **
10859559-C-T **
10748289-TTCC-CTCT **
10754266-T-G **
10775629-A-C **
10755023-GTTCCG-TTTCTC **
10763273-TTC-CTA ***
10760349-GTACTC-CCACTT,GCACTC ***
10748018-TTCC-GTCT ***
10758814-TACTT-CACTC ***
58861589-G-T 56729282-C-A ***
58861660-T-C 56729211-A-G ***
10884578-ACTGCA-CCTTCT ***
13468361-GCAGA-ACAGG 11312685-GCAGA-ACAGG ***
10689140-GT-AA ***
28794963-CT-C 26648816-CT-C ***
13469931-TGAC-CGCA 11314255-TGAC-CGCA ***
58843631-T-A 56747240-A-T ***
58843684-A-G 56747187-T-C ***
58846255-G-C 56744616-C-G ***
9952642-TCGAGG-CCAAGC 10115033-TCGAGG-CCAAGC ***
58844026-A-ATC 56746843-A-AAG ***
10061716-CTC-AT 10224107-CTC-AT ***
13485685-CCCCCTGT-TGCCCTGG 11330009-CCCCCTGT-TGCCCTGG ***
13485669-GATA-TAGT 11329993-GATA-TAGT ***
13480242-TGTAC-GGAAG 11324566-TGTAC-GGAAG ***
58858642-C-A 56732229-G-T ***
10658500-GTCA-CTCT ***
10667693-A-G ***
10670891-C-T ***
10672241-TTCCT-CTCCA ***
10676946-TATTACGG-AACTACAC,TATTACGC ***
19183814-C-CTTT 17071934-C-CTTT 28×T***
58846705-G-C 56744166-C-G ***
10683323-ATTTCTTTCGAC-CTATCCTTCTAC,CTATCTTTTGAA ***
13465313-A-C 11309637-A-C ***
58864124-T-G 56726747-A-C ***
13404867-TATATAC-CATGTAA 11249191-TATATAC-CATGTAA ***
58867576-C-G 56723295-G-C ***
10851057-CTC-ACC,TTA ***
10980670-GCACAA-ACAAAG ***
10972920-CTA-ATC ***
10964544-C-A ***
10959530-AC-TCTCCAT ***
10952256-ACTAC-TTTTAACTGA ***
10952237-C-CTGAAT ***
10826872-AC-TT ***
10826907-TT-AC ***
10952213-TCCAT-ACCAC ***
10836749-A-T ***
10851997-CC-AA ***
10813041-CT-AA ***
10869962-CATC-TACT ***
10877044-ACTC-GCTG ***
10880693-AAT-CAC ***
10880700-T-A ***
58843622-T-G 56747249-A-C ***
10880727-CC-TA ***
9962120-AT-GG 10124511-AT-GG ***
10899063-TCCAT-ACCAC ***
10894207-A-T ***
10894190-C-T ***
10892802-TTC-CTT ***
10983275-C-G ***
10984499-TGA-AGG ***
58870015-T-A 56720856-A-T ***
58913139-G-A 56677732-C-T ***
58873281-G-A 56717590-C-T ***
58875220-T-G 56715651-A-C ***
58898514-G-A 56692357-C-T ***
13445374-AAAAGAAGAAAAAAGA-GAAGAAGAAAAAAGG 11289698-AAAAGAAGAAAAAAGA-GAAGAAGAAAAAAGG ***
13442553-TT-CC 11286877-TT-CC ***
10773716-TTTCC-ATTCG ***
13433622-TTTTCTCTCTTTCTCTCTT-CTTTCTCTCTCTATCTCCC 11277946-TTTTCTCTCTTTCTCTCTT-CTTTCTCTCTCTATCTCCC ***
10884589-CT-AA ***
58898602-T-G 56692269-A-C ***
58907346-G-A 56683525-C-T ***
58908656-C-A 56682215-G-T ***
58913294-G-A 56677577-C-T ***
13203943-TGA-GGT 11048267-TGA-GGT ***
22480585-TTTGAA-T 20318699-TTTGAA-T DYZ19 ***
58840569-T-G 56750302-A-C ***
13203965-GA-G 11048289-GA-G ***
10790985-ATTC-CTTT ***
11035584-TACTCGACTCC-CACTAG ***
11025434-AAT-CGG ***
11025088-AAC-CAT ***
11018868-ATTA-TTTC ***
10999996-CTA-ATC ***
10994686-CTCCA-GTCCT ***
10803523-C-T ***
10906093-CTTG-TC ***
21620499-ATACTATACTATACTATACTATACTATACTATACTATACTATACTATACTATACT-ATACTATACTATACTATACTATACTATACTATACTATACTATACTATACTATACC,GTACTATACTATACTATACTATACTATACTATACTATACTATACTATACTATACT 19458613-ATACTATACTATACTATACTATACTATACTATACTATACTATACTATACTATACT-ATACTATACTATACTATACTATACTATACTATACTATACTATACTATACTATACC,GTACTATACTATACTATACTATACTATACTATACTATACTATACTATACTATACT ***
58843621-T-A 56747250-A-T ***
10091216-G-C 10253607-G-C ***
13258279-C-A 11102603-C-A ******
13129723-C-G 10619209-C-G ***
22503940-A-C 20342054-A-C DYZ19 ***
23109873-C-T 20947987-C-T ***
23218634-G-A 21056748-G-A ***
10091249-C-T 10253640-C-T ***
10091214-A-G 10253605-A-G ***
13374277-G-C 11218601-G-C 13×A***
10052600-G-T 10214991-G-T ***
9939130-A-G 10101521-A-G ***
25614551-A-G 23468404-A-G P1_gr1 ***
9202147-C-A 9364538-C-A ***
25833864-CA-C 23687717-CA-C P1_b3 15×A***
26469280-A-C 24323133-A-C P1_Y1 ***
4275251-T-A 4407210-T-A ***
22493340-T-A 20331454-T-A DYZ19 ***
13580857-C-T 11425181-C-T ***
4275246-G-A 4407205-G-A ***
22293346-T-C 20131460-T-C DYZ19 ***
20655106-C-T 18493220-C-T P4_Prx ***
19029161-G-A 16917281-G-A ***
17196569-G-A 15084689-G-A ***
20460428-ATT-A 18298542-ATT-A P5_Dst 17×T***
16784423-G-A 14672543-G-A ***
22245746-G-A 20083860-G-A DYZ19 ***
15884958-A-C 13773078-A-C ***
13730234-C-G 11574558-C-G ***
14787830-T-A 12675901-T-A ***
14258636-A-C 12137930-A-C ***
14258626-G-A 12137920-G-A ***
14258574-C-A 12137868-C-A ***
14109993-C-T 11989287-C-T ***
14109889-C-T 11989183-C-T ***
13742683-C-G 11587007-C-G ******
26478948-G-C 24332801-G-C P1_Y1 ***
26697546-CT-C 24551399-CT-C P1_g2 12×T***
19751593-G-T 17639713-G-T P5_Prx ***
22257039-A-G 20095153-A-G DYZ19 ***
56826836-CCATTCCATTCGATTCCATTCCATTCAATTCC-AG ***
7646416-T-A 7778375-T-A 14×A***
22017853-T-G 19855967-T-G ***
58857351-A-G 56733520-T-C ***
10018309-A-T 10180700-A-T ***
3570961-C-A 3702920-C-A ***
13867986-T-G,TAATGG 11747280-T-G,TAATGG 10×AATGG***
6617327-A-G 6749286-A-G ***
25705290-A-T 23559143-A-T P1_b3 18×CT***
28793863-G-A 26647716-G-A ***
10658485-ATC-TTG ***
10668339-GC-CA,CCACTCA ***
10776554-TAC-CTA,TTC ***
13486557-GGAGAT-AGAGAC,AGTGAT 11330881-GGAGAT-AGAGAC,AGTGAT ***
22435749-A-AT 20273863-A-AT DYZ19 ***
22757115-A-G 20595229-A-G FGC24512 ***
13257337-C-T 11101661-C-T ***
58843625-G-A 56747246-C-T ***
27429623-A-C 25283476-A-C P1_g3 ***
26832059-CT-C 24685912-CT-C P1_g2 14×T***
22344854-A-C 20182968-A-C DYZ19 ***
22266205-C-G 20104319-C-G DYZ19 ***
22344856-A-T 20182970-A-T DYZ19 ***
27061668-AT-A 24915521-AT-A P1_r4 17×T***
27120309-CT-C 24974162-CT-C P1_r4 17×T***
22344851-C-G 20182965-C-G DYZ19 ***
28384225-TA-T 26238078-TA-T P1_gr2 13×A***
27483513-G-A 25337366-G-A P1_Y2 ***
27484908-G-A 25338761-G-A P1_Y2 ***
58864072-C-G 56726799-G-C ***
27519347-G-A 25373200-G-A P1_Y2 ***
27665773-TA-T,TAA 25519626-TA-T,TAA P1_Y2 17×A***
27924442-GT-G 25778295-GT-G P1_Y2 12×T***
13485153-T-A 11329477-T-A ***
19751603-T-G 17639723-T-G P5_Prx ***
19751585-CCAG-ACAT 17639705-CCAG-ACAT P5_Prx ***
58843619-C-G 56747252-G-C ***
28709251-CC-TA 26563104-CC-TA ***
16435936-GTAA-TTAAT 14324056-GTAA-TTAAT ***
25656546-G-T 23510399-G-T P1_b3 ***
25268596-G-A 23122449-G-A P2_r1 ***
22341315-T-A 20179429-T-A DYZ19 ***
24207616-C-A 22061469-C-A P3_b1 ***
24485675-C-TT 22339528-C-TT 15×T***
22757104-A-G 20595218-A-G ***
25736792-C-A 23590645-C-A P1_b3 ***
22757065-A-T 20595179-A-T ***
22504592-G-C 20342706-G-C DYZ19 ***
28793660-TA-GG 26647513-TA-GG ***
22499499-C-T 20337613-C-T DYZ19 ***
22496212-A-G 20334326-A-G DYZ19 ***
22496043-C-A 20334157-C-A DYZ19 ***
22495731-G-A 20333845-G-A DYZ19 ***
15752635-TCTC-CCTT 13640755-TCTC-CCTT ***
26483733-T-C 24337586-T-C P1_Y1 ***
28799782-AGAACGGA-TGAAAGGC 26653635-AGAACGGA-TGAAAGGC ***
58831563-T-A 56759308-A-T ***
13690724-AATGA-TATGG 11535048-AATGA-TATGG ***
58843539-T-C 56747332-A-G ***
58843537-T-G 56747334-A-C ***
58841320-C-T 56749551-G-A ***
58840431-G-A 56750440-C-T ***
58831571-C-A 56759300-G-T ***
13700510-AGCTCC-GGCTCG 11544834-AGCTCC-GGCTCG ***
27077100-A-T 24930953-A-T P1_r4 ***
58831551-T-C 56759320-A-G ***
58823172-C-T 56767699-G-A ***
58820351-T-C 56770520-A-G ***
27905021-C-T 25758874-C-T P1_Y2 ***
27902197-C-T 25756050-C-T P1_Y2 34×T***
27902189-C-T 25756042-C-T P1_Y2 ***
27078013-G-C 24931866-G-C P1_r4 24×AC***
22481674-T-A 20319788-T-A DYZ19 ***
28802953-CAAAT-GAAAC 26656806-CAAAT-GAAAC ***
22231993-A-T 20070107-A-T DYZ19 ***
22232192-G-T 20070306-G-T DYZ19 ***
22293063-A-C 20131177-A-C DYZ19 ***
22289810-T-A 20127924-T-A DYZ19 ***
22252638-C-T 20090752-C-T DYZ19 ***
22235064-A-C 20073178-A-C DYZ19 ***
22234913-C-G 20073027-C-G DYZ19 ***
22232196-T-A 20070310-T-A DYZ19 ***
22232190-G-T 20070304-G-T DYZ19 ***
22337669-C-G 20175783-C-G DYZ19 ***
22232168-A-T 20070282-A-T DYZ19 ***
7664487-T-G 7796446-T-G ***
9911351-GCAAG-CCAAT 10073742-GCAAG-CCAAT ***
9964214-AA-TG 10126605-AA-TG ***
10780565-TCTC-CCTG ***
22232165-C-A 20070279-C-A DYZ19 ***
16136933-T-C 14025053-T-C P8_Dst ***
22329991-T-A 20168105-T-A DYZ19 ***
22342921-T-A 20181035-T-A DYZ19 ***
22481631-A-G 20319745-A-G DYZ19 ***
28813720-GGTCGAT-AGTGGAG 26667573-GGTCGAT-AGTGGAG ***
22450150-G-T 20288264-G-T DYZ19 ***
28805108-TT-GG 26658961-TT-GG ***
22421847-T-C 20259961-T-C DYZ19 ***
22366768-C-G 20204882-C-G DYZ19 ***
22366714-A-T 20204828-A-T DYZ19 ***
28812813-AAACG-GAAC 26666666-AAACG-GAAC ***
22366688-G-T 20204802-G-T DYZ19 ***
22360260-G-T 20198374-G-T DYZ19 ***
22366658-G-T 20204772-G-T DYZ19 ***
56730318-A-T ***
22365691-C-A 20203805-C-A DYZ19 ***
22365649-G-A 20203763-G-A DYZ19 ***
36407-G-T ***
22361375-G-T 20199489-G-T DYZ19 ***
22361234-C-A 20199348-C-A DYZ19 ***
9946088-CT-GA 10108479-CT-GA ***
14258632-A-AT 12137926-A-AT ***
9934957-CTTGA-TTTGT 10097348-CTTGA-TTTGT ***
58885447-A-T 56705424-T-A ***
22337713-T-A 20175827-T-A DYZ19 ***
28582716-A-G 26436569-A-G FT306996 ***
58824569-CATTCCAATAG-C 56766285-ATGGAATCTAT-A ***
28583212-T-C 26437065-T-C ***
13398337-C-T 11242661-C-T ***
13266042-CACA-TACG 11110366-CACA-TACG ***
13504210-G-A 11348534-G-A ***
22342783-A-C 20180897-A-C DYZ19 ***
13531506-AA-G 11375830-AA-G ***
20021496-TTATATA-T 17909616-TTATATA-T P5_Prx 15×TA***
59002978-G-A 56856831-G-A ***
22503758-C-G 20341872-C-G DYZ19 ***
9416727-CTTTG-TTTTT 9579118-CTTTG-TTTTT ***
13262692-A-G 11107016-A-G ***
13474008-CGTA-GGTT 11318332-CGTA-GGTT ***
58853491-CTCC-TTCA 56737377-GGAG-TGAA ***
25571253-GA-G 23425106-GA-G P1_gr1 13×A***
13263697-CGTC-TGTT 11108021-CGTC-TGTT ***
10030599-TAGC-AAGT 10192990-TAGC-AAGT ***
5403266-C-T 5535225-C-T 15×T***
3174374-C-T 3306333-C-T 18×T***
13275640-C-T 11119964-C-T ***
26433572-C-T 24287425-C-T P1_Y1 19×T***
59024845-G-A 56878698-G-A ***
59031098-T-C 56884951-T-C ***
13517191-G-C 11361515-G-C ***
9911320-GCA-CCT 10073711-GCA-CCT ***
13517206-T-A 11361530-T-A ***
58903863-A-T 56687008-T-A ***
22328388-A-G 20166502-A-G DYZ19 ***
22235011-C-T 20073125-C-T DYZ19 ***
13508715-T-C 11353039-T-C ***
58874797-T-A 56716074-A-T ***
13437785-A-T 11282109-A-T ***
58853472-G-C 56737399-C-G ***
13517368-GACT-G 11361692-GACT-G ***
13249261-C-T 11093585-C-T ***
13203970-CCACCCCGCCTC-TAAT 11048294-CCACCCCGCCTC-TAAT ***
22257030-CCACG-GCATT 20095144-CCACG-GCATT DYZ19 ***
28797878-GAGTG-AAATT 26651731-GAGTG-AAATT ***
58874785-T-A 56716086-A-T ***
13482969-TA-CC 11327293-TA-CC ***
58840445-CCA-GCATTTT 56750424-TGG-AAAATGC ***
22268297-GTGACC-TTGAGT 20106411-GTGACC-TTGAGT DYZ19 ***
58840455-CGA-TGT 56750414-TCG-ACA ***
22263840-CAT-TCC 20101954-CAT-TCC DYZ19 ***
13463948-TTCCCCC-CTCACCCAAAA 11308272-TTCCCCC-CTCACCCAAAA ***
59017917-TCG-GCT 56871770-TCG-GCT ***
58843671-TTTCCGTTTCA-ATTCAATGATT 56747190-TGAAACGGAAA-AATCATTGAAT ***
58840410-CCATTCCATTCGATTTAG-ACATTCGATTCGATTCGA 56750444-CTAAATCGAATGGAATGG-TCGAATCGAATCGAATGT ***
28785100-A-G 26638953-A-G ***
22314594-G-A 20152708-G-A DYZ19 ***
13395224-C-G 11239548-C-G ***
58840395-CCGTTC-TCATT 56750471-GAACGG-AATGA ***
13546463-T-C 11390787-T-C F18196 ***
14297038-C-CTA 12176332-C-CTA 10×TA***
58843384-TGATG-GAATT 56747483-CATCA-AATTC ***
13562246-T-C 11406570-T-C ***
58841130-C-T 56749741-G-A ***
13492247-A-T 11336571-A-T ***
9965278-AGCAC-GGCAT 10127669-AGCAC-GGCAT ***
13251387-C-A 11095711-C-A ***
13471841-CTGGG-TGGGT 11316165-CTGGG-TGGGT ***
13641031-C-G 11485355-C-G ***
58823284-TCTCAT-A 56767582-ATGAGA-T ***
13262792-CGCC-TGCT 11107116-CGCC-TGCT ***
13570555-AGAC-TGAT 11414879-AGAC-TGAT ***
13519284-A-G 11363608-A-G ***
13516360-TG-CA 11360684-TG-CA ***
58828536-C-G 56762335-G-C ***
22227933-C-A 20066047-C-A DYZ19 ***
13519346-G-C 11363670-G-C ***
5493431-C-T 5625390-C-T Y60653 24×T***
13256619-G-C 11100943-G-C ***
58995119-AGGCA-GGGCG 56848972-AGGCA-GGGCG ***
9929314-G-C 10091705-G-C ***
13536428-C-T 11380752-C-T ***
13536423-C-G 11380747-C-G ***
13536091-T-C 11380415-T-C ***
13535024-T-TTGATCC 11379348-T-TTGATCC ***
13529581-C-A 11373905-C-A ***
13556705-T-C 11401029-T-C ***
13519382-A-C 11363706-A-C ***
22321030-A-C 20159144-A-C DYZ19 ***
13517022-T-A 11361346-T-A ***
10047828-A-C 10210219-A-C ***
13516825-C-T 11361149-C-T ***
13516368-C-T 11360692-C-T ***
13515257-T-G 11359581-T-G FGC77657 ***
13515161-A-C 11359485-A-C ***
13285744-C-G 11130068-C-G ***
13536435-C-A 11380759-C-A ***
13538856-A-T 11383180-A-T ***
13513551-A-C 11357875-A-C ***
13564769-G-A 11409093-G-A BY15119 ***
16656658-C-T 14544778-C-T 14×T***
28582495-G-A 26436348-G-A ***
28583617-A-G 26437470-A-G S3111 ***
28584105-G-A 26437958-G-A FT307000 ***
28585927-T-G 26439780-T-G CTS12413 ***
13564789-G-T 11409113-G-T ***
13564520-G-A 11408844-G-A ***
13557556-AC-GT 11401880-AC-GT ***
13557042-A-G 11401366-A-G ***
13557015-A-G 11401339-A-G ***
13557004-G-T 11401328-G-T ***
59027554-A-T 56881407-A-T ***
59032481-A-C 56886334-A-C ***
25706148-CA-C 23560001-CA-C P1_b3 16×A***
13546523-T-G 11390847-T-G ***
13363155-AC-A 11207479-AC-A ***
13411637-G-A 11255961-G-A ***
59018588-G-A 56872441-G-A ***
59009672-G-A 56863525-G-A ***
13492158-C-G 11336482-C-G FGC80997 ***
13437719-G-A 11282043-G-A ***
13398387-T-A 11242711-T-A ***
59008974-G-A 56862827-G-A ***
59008979-G-C 56862832-G-C ***
59009290-C-T 56863143-C-T ***
59010319-G-T 56864172-G-T ***
13495538-C-T 11339862-C-T ***
13354609-C-A 11198933-C-A ***
59011617-TTATC-T 56865470-TTATC-T ***
13324015-G-A 11168339-G-A ***
13277678-C-A 11122002-C-A ***
13269566-A-T 11113890-A-T ***
13260372-T-A 11104696-T-A ***
59017896-A-C 56871749-A-C ***
13495259-T-G 11339583-T-G ***
13497242-A-G 11341566-A-G ***
13429060-C-T 11273384-C-T ***
13504252-C-T 11348576-C-T ***
13442455-A-T 11286779-A-T ***
13442461-A-T 11286785-A-T ***
13493016-G-T 11337340-G-T ***
13506771-A-T 11351095-A-T ***
13503438-A-T 11347762-A-T ***
13519022-G-A 11363346-G-A ***
13524322-G-T 11368646-G-T ***
13503073-G-A 11347397-G-A ***
13498926-T-C 11343250-T-C ***
13502954-G-T 11347278-G-T ***
13540902-A-G 11385226-A-G ***
13544730-T-C 11389054-T-C ***
13502609-G-A 11346933-G-A ***
28582510-G-C 26436363-G-C ***
13499023-C-A 11343347-C-A ***
13498939-C-T 11343263-C-T ***
18688521-C-AAA 16576641-C-AAA ***
28178294-T-G 26032147-T-G FGC61364 P1_b4 ***
9931519-CTT-TTG 10093910-CTT-TTG ***
19409391-C-CAAAAA 17297511-C-CAAAAA 22×A***
20332111-C-CAAAAAAAAAAAAAAAAA 18170225-C-CAAAAAAAAAAAAAAAAA P5_Dst 30×A***
20025482-T-TCCCCCCC 17913602-T-TCCCCCCC P5_Prx 14×C***
13251187-A-G 11095511-A-G FGC77810 ***
19744991-ATTTTTTTTTTT-A 17633111-ATTTTTTTTTTT-A P5_Prx 23×T***
13558802-G-T 11403126-G-T FGC77658 ***
13563786-G-T 11408110-G-T ***
18688500-C-CAAAAA 16576620-C-CAAAAA 20×A***
22226585-GAGCT-CAGCA 20064699-GAGCT-CAGCA DYZ19 ***
18447621-G-GGTTTTTTTTTTT 16335741-G-GGTTTTTTTTTTT P6_Dst 18×T***
16344411-T-TTCTTCA 14232531-T-TTCTTCA ***
16344401-C-CTTCTTA 14232521-C-CTTCTTA ***
15884888-CA-GG 13773008-CA-GG ***
56881412-T-C ***
15340383-C-CTTTTT 13228501-C-CTTTT 18×T***
15336019-C-CAAAAAAA 13224137-C-CAAAAAAA 30×A***
22113187-C-CAAAAAA 19951301-C-CAAAAAA 23×A***
22232040-CAAA-AAAT 20070154-CAAA-AAAT DYZ19 ***
13641089-A-T 11485413-A-T ***
22265842-GT-CA 20103956-GT-CA DYZ19 ***
28585775-T-C 26439628-T-C ***
22273539-C-CCG 20111653-C-CCG DYZ19 ***
10807068-TA-CT ***
10972955-CTCT-TTCC ***
10982945-CCTCGCT-TC ***
13514810-CC-GT 11359134-CC-GT ***
13398373-A-G 11242697-A-G ***
22232055-ACAC-GCAT 20070169-ACAC-GCAT DYZ19 ***
22263795-AC-GT 20101909-AC-GT DYZ19 ***
56867491-ATTTTTTTTT-A,ATT 11×T***
22252645-TCTTCCTTTTGGC-CCTTAATTCTGGG 20090759-TCTTCCTTTTGGC-CCTTAATTCTGGG DYZ19 ***
22236464-CCCACCAAGG-ACCAGTAAGT 20074578-CCCACCAAGG-ACCAGTAAGT DYZ19 ***
22235087-AT-A 20073201-AT-A DYZ19 ***
13465852-C-T 11310176-C-T ***
22232109-TTC-GTG 20070223-TTC-GTG DYZ19 ***
14562321-C-CTTTT 12450522-C-CTTTTT 42×T***
14025566-G-GAA 11904860-G-GAA ***
22337200-CATGTCC-TATTTCG 20175314-CATGTCC-TATTTCG DYZ19 ***
10927236-TCC-GCA ***
4848574-G-GTTTTTTT 4980533-G-GTTTTTTT 29×T***
10987194-T-G ***
13569835-TA-T 11414159-TA-T 11×A***
4269771-C-CTTTTT 4401730-C-CTTTTT 24×T***
2685644-C-CTTTTTT 2817603-C-CTTTTTT 20×T***
6431385-G-C 6563344-G-C ***
11022872-TT-CA ***
10784966-C-A ***
9958318-GGGAAT-CGAAAC 10120709-GGGAAT-CGAAAC ***
11015964-AGTA-CATC ***
10763332-TTTCCA-GTTCTAT ***
11013909-AC-GA ***
11013918-TAC-CAG ***
11013943-CA-TG ***
13472484-TG-CA 11316808-TG-CA ***
13249418-G-A 11093742-G-A ***
6089764-G-GTTTTT 6221723-G-GTTTTT 31×T***
13485479-AG-TC 11329803-AG-TC ***
13140073-CGAGTGCGTGTGATTCCATT-C 10629559-CGAGTGCGTGTGATTCCATT-C ***
13485452-GGAGATA-AGAAATC 11329776-GGAGATA-AGAAATC ***
13483759-TGACT-AGATA 11328083-TGACT-AGATA ***
13482911-ATTC-GTTA 11327235-ATTC-GTTA ***
13468959-TTAGA-CTGTG 11313283-TTAGA-CTGTG ***
25738886-CTAA-C 23592739-CTAA-C P1_b3 ***
13267597-C-CAAAAAAAAAA 11111921-C-CAAAAAAAAAA 11×A***
13203955-CATCATT-GACAATA 11048279-CATCATT-GACAATA ***
13558817-A-T 11403141-A-T ***
26812667-AT-A 24666520-AT-A P1_g2 16×T***
9732895-C-CAAAAAA 9895286-C-CAAAAAA IR3_Prx 20×A***
22367414-T-A 20205528-T-A DYZ19 ***
8125067-AAG-A 8257026-AAG-A ***
7032333-A-ATTTTT 7164292-A-ATTTTT 22×T***
13545748-CA-C 11390072-CA-C ***
13465868-G-T 11310192-G-T ***
16137122-C-T 14025242-C-T P8_Dst ***
56863028-GT-CC ***
13259717-AG-GT 11104041-AG-GT ***
22503694-GAAT-AAAG 20341808-GAAT-AAAG DYZ19 ***
56853683-C-T ***
11035773-C-A ***
10667996-G-T ***
24016986-C-T 21870839-C-T 15×T***
10844667-T-C ***
10773729-C-A ***
11009347-C-T ***
13377964-G-A 11222288-G-A ***
10869944-T-C ***
13398261-G-A 11242585-G-A ***
20249276-CA-C 18087390-CA-C P5_Dst 22×A***
10629636-C-A ***
58862994-GATTTG-CATTAT 56727872-CAAATC-ATAATG ***
10758791-C-T ***
9929351-A-T 10091742-A-T ***
58823473-G-T 56767398-C-A ***
10836477-T-G ***
58840600-C-T 56750271-G-A ***
21021632-CT-C 18859746-CT-C P4_Dst 17×T***
10917917-G-C ***
11030778-A-C ***
20850693-GTA-G 18688807-GTA-G P4_Dst 12×TA***
10827110-A-G ***
11029537-T-G ***
10844239-A-T ***
11675236-T-G ***
10917946-C-A ***
10766544-T-C ***
10917955-T-G ***
13353871-GAC-G 11198195-GAC-G ***
11023149-T-G ***
56850396-A-T ***
13485854-CCG-TCA 11330178-CCG-TCA ***
10911642-T-C ***
10766534-T-C ***
10892829-C-A ***
59009279-C-A 56863132-C-A ***
22337241-GT-TC 20175355-GT-TC DYZ19 ***
22496054-AGTGT-TGTGA 20334168-AGTGT-TGTGA DYZ19 ***
27080520-G-T 24934373-G-T P1_r4 16×T***
13395199-G-A 11239523-G-A ***
23801733-C-CAAAAAAA 21639847-C-CAAAAAAA 31×A***
23037237-A-ATTTT 20875351-A-ATTTT 20×T***
13444868-T-G 11289192-T-G ***
22496169-TTTTG-CTTAC 20334283-TTTTG-CTTAC DYZ19 ***
22421840-TT-AG 20259954-TT-AG DYZ19 ***
24388083-T-TAA 22241936-T-TAA ***
10629330-T-C ***
22421783-GC-CT 20259897-GC-CT DYZ19 ***
22366755-AGAGA-GGAGT 20204869-AGAGA-GGAGT DYZ19 ***
22366714-ACT-TCG 20204828-ACT-TCG DYZ19 ***
22366697-TTT-AAG 20204811-TTT-AAG DYZ19 ***
22365977-GGTGG-TGTCA 20204091-GGTGG-TGTCA DYZ19 ***
22360381-GTTTT-CTTTG 20198495-GTTTT-CTTTG DYZ19 ***
10894201-C-A ***
13249403-C-T 11093727-C-T ***
9943729-G-T 10106120-G-T ***
58843639-CCAGCCC-GGAGTCA 56747226-GGGCTGG-TGACTCC ***
58972565-T-TATTCC 56826418-T-TATTCC ***
58908600-GTTC-CATT 56682268-GAAC-AATG ***
58885276-TATTTTATTCCATGCC-T 56705575-CAAATGGCATGGAATA-C ***
58868388-AGTGCATTCCATTCCGTGGCT-A 56722460-GACAGCCACGGAATGGAATGC-G ***
58844015-TATTCACTTCCATTTCC-T 56746835-CGAATGGAAATGGAAGT-C ***
58843694-GCATTC-TTTTTG 56747172-GAATGC-CAAAAA ***
58843651-ATTCCATTCCATT-TTTCGACACCCAG 56747208-AATGGAATGGAAT-CTGGGTGTCGAAA ***
28545880-CAAAAAA-C 26399733-CAAAAAA-C 20×A***
10668001-C-A ***
28539174-C-CAAAAAA 26393027-C-CAAAAAA 20×A***
28454731-A-AT 26308584-A-AT P1_gr2 10×T***
28253491-C-CAAAAAAAAA 26107344-C-CAAAAAAAAA P1_b4 32×A***
26228689-C-CTTTT 24082542-C-CTTTT P1_Y1 27×T***
25656575-TG-AA 23510428-TG-AA P1_b3 ***
56853008-G-A ***
25444404-CTATTTC-TTTTTTT 23298257-CTATTTC-TTTTTTT P2_r2 ***
9952663-AG-CA 10115054-AG-CA ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Mutation Notes:

Kit POSITION-REF-ALT (hg19) POSITION-REF-ALT (hg38) Note
Manual19346433-C-CCTTTCTTTCTTT17234553-C-CCTTTCTTTCTTTChecked my BAM file on 20141117.
P9UH420040482-GGCAAGCAC-G17928602-GGCAAGCAC-GChecked my BAM file. It looks like half of my reads at this location have the deletion. This location is opposite to 20089217-TTGCTTGCG-T.
Manual20089217-TTGCTTGCG-T17977337-TTGCTTGCG-TChecked my BAM file. It looks like half of my reads at this location have the deletion. This location is opposite to 20040482-GGCAAGCAC-G.
Manual24899333-C-T22753186-C-TLooks like about half of the reads in the BAM file have the mutation.
Manual19973015-C-T17861135-C-TThere are 38C and 46T. This SNP is in P5. This is a ZZ SNP as there are no distinguishing positions anywhere near, at least +/- 400bp.
Manual22453058-C-A20291172-C-AChecked BAM file. I have 537 reads which cover this point. 150 of them are A, another 376 are C, 3 are G and 8 are T. Without looking at paired end reads, I can't see any way to figure out the true location.
Manual22260454-G-A20098568-G-AHundreds of reads. With a couple filters to remove some misaligned reads, I still have about 490 A and 678 G.
Manual6861230-T-TTTTC6993189-T-TTTTCI have checked my BAM file, and I have about a half dozen reads supporting the claim that this in an insertion of TTTC. Oddly, my report from FGC indicates a deletion. This INDEL corresponds to DYS570, so I know what my value should be. I removed the deletion mutation from my FGC data.
P9UH46861230-TTTTC-T6993189-TTTTC-TI removed this mutation from my data. It would appear that I have 6861230-T-TTTTC instead.
Manual16809474-G-GAGAT14697594-G-GAGATAbout 10 reads, 9 of them show the insertion.
Manual26121103-C-T23974956-C-T1A 36C 31T. The A read and one of the T reads is misaligned.
Manual24939079-C-T22792932-C-T67 C, 46 T.
Manual22285004-C-T20123118-C-TSome reads clearly belong elsewhere. Of the reads which fit here, 376 are C, 217 are T.
Manual16110097-A-T13998217-A-T35A 40T
Manual14981830-TTTCCTTCC-T12869906-T-.This is an STR. There are about 10 reads with the deletion and maybe one or two that have a slightly different count.
Manual17662167-GTAGATAGATAGA-G15550287-GTAGATAGATAGA-GThis is an STR. The hg19 reference sequence has 16 copies of TAGA. My FGC BAM file has 1 read with 14 copies, 17 reads with 13 copies and 3 reads with 12 copies.
Manual4847052-T-G4979011-T-G2T 3G
Manual22298978-G-T20137092-G-T946G 431T
Manual20551642-A-C18389756-A-C36A 18C
Manual19628136-T-G17516256-T-G37T 12G
Manual20007955-A-G17896075-A-G17A 20G
Manual6347814-G-GAGAA6479773-G-GAGAAAll 26 reads which cover the insertion are positive.
Manual26179746-AAAC-A24033599-AAAC-A115 reads cover the deletion. 61 do not show the deletion and 54 show the deletion.
Manual19739340-A-AAAC17627460-A-AAAC33 reads cover the insertion. 18 have the insertion and 15 do not.
Manual23761608-A-AAAG21599722-A-AAAGAbout 13 reads cover the insertion. 10 of them are positive, 3 are negative. Note that there is an A>C SNP near the end of this STR.
Manual19842176-CAATAAATAAATA-C17730296-CAATAAATAAATA-C72 reads derived for the deletion and 33 reads ancestral.
Manual19600395-GGT-G17488515-GGT-GSTR on P5. 1 read with 17 copies of GT, 23 reads with 16 copies of GT, 35 reads with 15 copies of GT, 14 reads with 14 copies of GT and one read with just 13 copies of GT.
Manual19675596-G-C17563716-G-C21C 23G
Manual19970773-A-G17858893-A-G27A 26G
Manual23311147-T-TTTTC21149261-T-TTTTCThis is an STR where the reference sequence has 15 copies of TTTC. Because of the short reads of my FGC test, it's difficult to align properly. About a dozen reads however to indicate I am positive for this insertion.
Manual6274770-G-A6406729-G-A73A 1C 82G
Manual9595600-C-T9757991-C-T1A 67C 65T
Manual20738728-G-T18576842-G-T57G 64T
Manual20905447-C-A18743561-C-A34C 60A
Manual10907035-A-C6C

Haplotype Progression

The data below reveals the progression of changes in the haplotype. The bottom row is the haplotype for this man and above him are the inferred ancestral haplotypes for various upstream blocks. These inferred haplotypes are very much a work in progress, and any suggested modifications are appreciated. I think we can use our vast collection of haplotype data to refine these haplotypes. Mutations made from each upstream block are shown in sequence. The cell color is determined by the block in which the mutation took place.

DYS393
DYS390
DYS19
DYS391
DYS385
DYS426
DYS388
DYS439
DYS389i
DYS392
DYS389ii
DYS458
DYS459
DYS455
DYS454
DYS447
DYS437
DYS448
DYS449
DYS464
DYS460
Y-GATA-H4
YCAII
DYS456
DYS607
DYS576
DYS570
CDY
DYS442
DYS438
DYS531
DYS578
DYF395S1
DYS590
DYS537
DYS641
DYS472
DYF406S1
DYS511
DYS425
DYS413
DYS557
DYS594
DYS436
DYS490
DYS534
DYS450
DYS444
DYS481
DYS520
DYS446
DYS617
DYS568
DYS487
DYS572
DYS640
DYS492
DYS565
DYS710
DYS485
DYS632
DYS495
DYS540
DYS714
DYS716
DYS717
DYS505
DYS556
DYS549
DYS589
DYS522
DYS494
DYS533
DYS636
DYS575
DYS638
DYS462
DYS452
DYS445
Y-GATA-A10
DYS463
DYS441
Y-GGAAT-1B07
DYS525
DYS712
DYS593
DYS650
DYS532
DYS715
DYS504
DYS513
DYS561
DYS552
DYS726
DYS635
DYS587
DYS643
DYS497
DYS510
DYS434
DYS461
DYS435
FTY371
FTY303
FTY10
FTY284
FTY219
FTY324
FTY327
FTY394
DYS538
FTY220
FTY254
FTY19
FTY4
DYS577
FTY24
FTY346
FTY160
FTY62
FTY400
FTY114
FTY246
FTY26
FTY368
FTY173
FTY209
FTY337
FTY81
FTY387
FTY361
FTY330
FTY65
FTY168
FTY171
FTY136
FTY53
FTY40
FTY386
FTY100
FTY152
FTY55
FTY297
FTY370
FTY103
FTY64
FTY174
FTY313
FTY362
FTY342
FTY161
FTY374
FTY316
FTY101
FTY204
DYS477
FTY192
DYS502
FTY341
DYS493
FTY1
FTY227
DYS499
FTY391
FTY353
FTY332
FTY163
DYS483
FTY172
FTY180
DYS581
FTY179
FTY188
FTY369
FTY70
FTY63
DYS508
FTY347
FTY83
FTY277
FTY276
FTY195
FTY109
FTY356
FTY215
FTY105
FTY123
FTY242
FTY214
FTY132
FTY262
FTY333
FTY208
DYF398B
FTY43
FTY166
FTY13
FTY11
DYS584
DYS608
FTY95
FTY151
FTY388
FTY256
DYS580
FTY234
FTY268
FTY139
FTY27
FTY75
DYS512
FTY329
FTY320
FTY7
FTY247
FTY211
DYS474
FTY39
FTY376
FTY37
FTY373
DYS475
FTY138
FTY288
FTY264
FTY93
FTY380
FTY18
FTY115
DYS569
FTY390
FTY46
FTY243
FTY322
FTY281
FTY153
FTY181
FTY184
FTY359
FTY121
FTY74
FTY279
DYS530
FTY45
DYS573
DYS542
FTY36
FTY304
FTY203
FTY291
FTY142
FTY191
FTY183
FTY141
FTY299
FTY193
FTY124
FTY16
FTY236
FTY185
FTY378
FTY225
FTY397
FTY3
FTY67
FTY182
FTY334
DYS623
FTY348
FTY357
FTY275
FTY306
FTY383
FTY253
FTY285
DYS645
FTY17
FTY85
DYS598
FTY375
FTY325
FTY12
FTY365
FTY35
FTY237
FTY238
FTY305
FTY56
FTY129
FTY352
FTY292
FTY154
DYS539
FTY301
FTY366
FTY231
DYS618
FTY216
FTY82
FTY393
FTY155
FTY68
FTY32
FTY265
FTY300
FTY143
FTY201
FTY199
FTY86
FTY98
FTY144
DYS541
DYS507
FTY20
FTY116
FTY308
FTY177
FTY89
FTY158
FTY22
FTY84
FTY186
FTY396
FTY91
FTY29
FTY78
FTY229
FTY260
FTY250
FTY364
DYS476
FTY221
FTY57
FTY377
FTY384
DYS466
FTY363
FTY137
FTY69
FTY72
FTY251
FTY2
FTY217
FTY257
FTY120
FTY25
FTY252
FTY33
FTY42
FTY54
FTY372
DYS480
FTY176
FTY76
FTY66
FTY197
FTY385
FTY270
FTY298
FTY198
FTY117
DYS544
FTY159
FTY232
FTY156
FTY343
FTY296
FTY311
FTY344
FTY178
FTY367
FTY73
FTY112
FTY295
DYS616
FTY338
FTY196
FTY157
FTY162
DYS551
FTY148
FTY94
FTY52
FTY131
FTY9
FTY194
FTY8
FTY318
FTY317
FTY99
FTY289
FTY169
FTY51
FTY345
FTY398
FTY111
FTY273
FTY382
FTY47
FTY30
FTY147
DYS615
FTY302
FTY354
FTY326
FTY88
FTY248
FTY267
FTY170
FTY60
DYS453
FTY249
FTY167
DYS624
FTY134
FTY235
FTY145
FTY14
FTY80
FTY50
DYS514
FTY340
DYS585
DYS516
FTY293
FTY207
FTY278
FTY210
DYS523
FTY269
FTY530
FTY1156
FTY1070
FTY906
FTY1004
FTY331
FTY31
FTY226
FTY335
DYS583
FTY339
FTY113
FTY280
FTY255
FTY59
DYS620
FTY349
FTY130
FTY119
DYF398A
FTY58
FTY127
FTY321
FTY92
FTY392
DYF392
FTY290
FTY312
FTY135
FTY150
FTY294
FTY244
FTY48
FTY282
DYS489
FTY272
FTY239
FTY258
FTY49
DYS574
FTY41
FTY905
FTY1103
FTY502
FTY743
FTY443
FTY670
FTY883
DYS631
FTY1042
FTY510
DYS389B
FTY512
FTY837
DYS642
FTY407
FTY935
FTY563
FTY1016
FTY1091
FTY1049
FTY1155
DYS602
FTY587
FTY635
FTY904
DYS543
FTY1148
FTY861
FTY742
FTY433
FTY1039
FTY71
FTY259
FTY108
FTY336
FTY44
FTY233
FTY274
FTY34
FTY942
FTY1068
FTY945
FTY1051
FTY658
FTY625
FTY800
FTY818
FTY971
FTY509
FTY1025
FTY835
FTY984
DYS637
FTY832
FTY689
FTY998
FTY520
FTY445
FTY809
FTY428
FTY562
FTY897
FTY1064
FTY1088
FTY1052
DYF405
FTY310
FTY189
DYS488
FTY283
FTY28
FTY578
DYS484
FTY858
FTY596
FTY915
FTY446
FTY452
FTY1006
FTY612
FTY507
FTY614
FTY824
FTY1055
FTY690
FTY2318
FTY981
FTY946
FTY1040
DYS718
FTY15
FTY2025
DYS685u1
DYS596u5
FTY1511
FTY769
FTY923
FTY1167
FTY415
FTY505
FTY241
FTY2263
FTY517
FTY2180
FTY775
DYS567
FTY444
FTY691
FTY1120
FTY223
DYF393u3
FTY1850
FTY645
FTY696
FTY1166
FTY991
FTY912
DYS551u4
FTY447
DYS518u3
FTY875
DYS536u1
FTY585
FTY896
FTY731
FTY401
FTY2011
FTY665
FTY814
FTY2050
DYS626u3
FTY750
FTY471
FTY985
FTY589
FTY420
FTY921
FTY457
FTY657
FTY1110
FTY485
FTY315
FTY1852
FTY1107
FTY489
FTY522
FTY654
FTY110
FTY881
DYS470
FTY534
FTY1101
FTY1933
FTY936
FTY772
FTY1047
FTY2351
FTY680
FTY2254
FTY1030
FTY2083
FTY287
FTY797
FTY2366
FTY951
FTY774
FTY1116
DYS621
FTY885
FTY1012
DYF394u1
FTY888
FTY648
FTY725
FTY643
FTY927
FTY1022
DYS559
FTY933
FTY633
FTY900
FTY1848
FTY478
FTY533
FTY467
FTY1900
FTY421
DYS612u5
DYS595
FTY668
FTY1028
DYS579
FTY646
FTY1026
FTY801
FTY432
FTY2301
FTY466
FTY531
FTY1083
FTY997
FTY1114
FTY830
FTY655
FTY910
FTY1143
FTY572
DYS506
DYS558u2
FTY1127
FTY712
FTY634
FTY499
FTY1094
FTY724
FTY535
FTY552
FTY430
FTY588
DYS609
FTY961
FTY813
FTY656
FTY839
FTY882
FTY789
FTY459
FTY1037
FTY435
FTY1157
FTY1546
FTY2242
FTY720
DYS614u10
FTY887
FTY473
FTY816
FTY1060
FTY472
FTY943
FTY1482
FTY565
DYS629
FTY891
FTY438
DYS582
FTY468
FTY649
FTY606
FTY792
FTY1087
FTY895
DYS614u3
FTY574
FTY1556
FTY560
FTY694
FTY1097
DYS518u6
FTY876
FTY2443
FTY990
FTY934
FTY465
FTY1046
FTY1312
FTY751
FTY1915
FTY678
FTY419
FTY958
FTY456
DYS592u1
FTY1172
FTY416
FTY650
FTY808
FTY1542
DYS721u1
FTY746
FTY2233
FTY892
FTY845
FTY1034
FTY498
DYF382u1
FTY637
DYS588
FTY947
DYS543u3
FTY644
DYS703
DYS649
FTY212
FTY781
FTY1106
FTY592
FTY848
FTY940
FTY903
FTY1081
FTY952
DYS706u2
FTY1084
FTY700
FTY482
DYS625u7
FTY960
FTY586
FTY1330
FTY1119
FTY1762
FTY1010
FTY417
FTY716
DYS627u3
FTY1942
FTY1067
FTY841
FTY1031
FTY1082
FTY1023
FTY475
FTY222
FTY962
FTY423
FTY664
DYS517u1
FTY1076
FTY1557
FTY1154
DYS681
FTY1002
DYS706u1
FTY1174
FTY986
FTY651
FTY886
FTY1078
DYS546u4
FTY1092
FTY2471
FTY1111
FTY461
FTY323
FTY1013
FTY506
FTY550
FTY767
FTY721
DYS548
FTY559
DYS705
FTY640
FTY613
FTY402
FTY2426
FTY755
P312/S1161324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123315916122626191211131210912121011113012132413101020151913241712152412231810141791211
L21/S1451324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
DF21/S1921324141111-14121212131329179-1011112515192915-15-17-17111119-231615181836-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
S30581324141011-14121212131329179-1011112515192915-15-17-17111119-231615181836-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211121211912121011113012132413101020151913241712152412231810141791211
S4261324141011-14121212131329179-1011112515193015-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526191311121211912121011113012132413101020151913231712152412231810141791211
S1901324141011-14121212131329179-1011112515193013-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526201311121211912121011113012132413101020151913231712152412231810141791211
FGC32151324141011-14121212131329189-1011112515193013-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526201311121211912121011113012132413101020151913231712152412231810141791211
FGC31971324141011-14121212131329189-1011112515193013-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526201311121211913121011113012132413101020151914231712152412231810141791211
FGC78541324141011-14121212131329189-1011112515193013-15-17-17111019-231615191838-38121211915-1691110810101222-231610121215811222014121113111112123115915122526201311121211913121011113012132413101020151914231712152412231810141791211
Williamson1324141011-14121212121328189-1011112515193013-15-17-17111019-231615191838-38121211915-1691110810101222-231610121215811232014121113111112123115915122526201311121211913121011113012132413101020151914231712152412231810141791211

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: P9UH4*16000000100000008300000
Kit: P9UH4-A*16000000100000008300000
Used in age calculations16000000100000008300000
Counts of SNPs112
Variant counts last updated 2020-07-06 03:07:07.

* BED data not available. Using default values.


Big Tree Main Page