Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > DF21/S192 > FGC3213 > ZZ1 > S3058 > S424 > S426 > S190 > FGC3215 > FGC3216 > FGC3197 > FGC3198 > FGC7854

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFB38
P9UH4-A
FGC
P9UH4
Manual
Edits
22237313-C-CT 20075427-C-CT DYZ19 +
35882-G-A FGC77175 +
27614542-C-T 25468395-C-T P1_Y2 18×T+
13979797-T-C 11859091-T-C FGC3204 Y++
14882-GT-G +
14873-AGT-TAG +
11666068-T-C +
11653101-NN-GA +
21464556-GAAAAG-AAAAAA 19302670-GAAAAG-AAAAAA +
21805280-NN-TC +
15612-AA-TC +
14750-GTGGGG-TTTCAT +
18439427-TA-T 16327547-TA-T P6_Dst +
13413-TAC-GGT +
35936-G-C FGC77603 +
30520-C-A FGCLR36 +
28534936-GTTTC-TTTTT 26388789-GTTTC-TTTTT +
29396-T-G FGC76931 +
27104-T-C +
27093-T-G +
27049-G-T FGC77613 +
24880-A-C FGCLR159 +
8292-T-G FGC45280FGCLR226 +
56877857-AAAAAAAAAAAAAAAAGGAG-CAAAAAAAAAGGGA +
35128-T-A FGC77797 +
36634-AAAAA-TAAAG +
34920-G-A +
31130-T-G FGCLR37 +
59000770-T-TTGG 56854623-T-TTGG +***
23468-G-A FGC45280FGCLR33 +
32872-G-T +
8790228-A-G 8922187-A-G FGC3199 YY+*
14857-GT-G +
11675277-AAAC-GAAT +
23761672-A-C 21599786-A-C YP1209 Y+**
58890696-G-A 56700175-C-T +
10936948-A-T +
19760-C-T *
56872325-G-A,T *
22238323-TAAA-AAAC 20076437-TAAA-AAAC DYZ19 *
22501518-G-T 20339632-G-T DYZ19 *
22501251-G-T 20339365-G-T DYZ19 *
13535073-T-A 11379397-T-A *
13535056-A-G 11379380-A-G *
11003571-C-T *
13497335-G-A 11341659-G-A *
22501170-T-C 20339284-T-C DYZ19 *
13546500-G-T 11390824-G-T *
56837376-A-C *
11003609-G-C *
9980474-C-T 10142865-C-T Y*
28811012-TCGG-ACGC 26664865-TCGG-ACGC *
28809934-AGAAT-GGAAG 26663787-AGAAT-GGAAG *
22496853-A-G 20334967-A-G DYZ19 *
22453797-G-A 20291911-G-A DYZ19 *
19731-A-T *
22501525-T-A 20339639-T-A DYZ19 *
56834779-GCA-CCA,GCG 4×CATTC*
28582622-G-A 26436475-G-A A13716 *
59022708-A-G 56876561-A-G *
59018657-GCTGT-G 56872510-GCTGT-G *
59006977-TA-T 56860830-TA-T *
59002632-G-A 56856485-G-A *
59002627-G-T 56856480-G-T *
59001722-G-A 56855575-G-A *
58998489-G-GA 56852342-G-GA *
58971523-G-GAACA 56825376-G-GAACA *
58880269-C-T 56710602-G-A *
28582481-T-A 26436334-T-A *
13546567-G-A 11390891-G-A *
34258-G-T FGC77591 *
13565107-A-G 11409431-A-G *
13565045-C-A 11409369-C-A *
13564989-G-C 11409313-G-C *
19770-C-T *
56756653-C-A,G *
13564273-T-A 11408597-T-A *
13514189-ATG-GTT 11358513-ATG-GTT *
13564004-A-G 11408328-A-G *
13563985-G-A 11408309-G-A *
22453776-G-A 20291890-G-A DYZ19 *
10047855-ACACC-CCACA 10210246-ACACC-CCACA *
22453768-C-T 20291882-C-T DYZ19 *
22501089-A-T 20339203-A-T DYZ19 *
59013629-T-A 56867482-T-A *
22324619-G-T 20162733-G-T DYZ19 *
22492650-A-C 20330764-A-C DYZ19 *
13513507-C-A 11357831-C-A FGC78372 *
22492755-G-C 20330869-G-C DYZ19 *
22496697-A-G 20334811-A-G DYZ19 *
22493388-A-G 20331502-A-G DYZ19 *
13468273-CCAT-TCGC 11312597-CCAT-TCGC *
22501509-C-G 20339623-C-G DYZ19 *
20551642-A-C 18389756-A-C P5_Dst *
22503789-T-C 20341903-T-C DYZ19 *
22501549-A-C 20339663-A-C DYZ19 *
22501556-G-A 20339670-G-A DYZ19 *
28585456-C-A 26439309-C-A *
13286202-C-G 11130526-C-G *
28585444-G-C 26439297-G-C *
28585427-T-G 26439280-T-G *
13694270-ATGAC-GTGAA 11538594-ATGAC-GTGAA *
28586221-A-G 26440074-A-G CTS12419 *
19628136-T-G 17516256-T-G P5_Prx *
3547140-T-A 3679099-T-A 8×A*
22501658-T-G 20339772-T-G DYZ19 *
13362949-C-T 11207273-C-T FGC81169 *
20121812-T-C 18009932-T-C ZZ85_2 P5_Dst *
13497289-A-G 11341613-A-G *
20905447-C-A 18743561-C-A P4_Dst **
13495453-G-A 11339777-G-A *
20738728-G-T 18576842-G-T P4_Prx **
27221-T-C *
13694670-AGGA-CGGC 11538994-AGGA-CGGC *
36453-T-G FGC77518 *
27176-C-A *
28807151-T-C 26661004-T-C *
13347932-T-C 11192256-T-C 21×AC*
13515238-A-G 11359562-A-G *
13296793-T-C 11141117-T-C *
28583599-GTG-CTA 26437452-GTG-CTA *
13267992-G-A 11112316-G-A *
28583163-T-C 26437016-T-C *
13259457-C-T 11103781-C-T BY3844 *
9965245-GAACTAT-AAACAA 10127636-GAACTAT-AAACAA *
19816-TA-AC *
13499008-T-A 11343332-T-A *
22314659-C-T 20152773-C-T DYZ19 *
59012364-AAAT-TAAG 56866217-AAAT-TAAG *
59017886-C-T 56871739-C-T *
22503441-C-G 20341555-C-G DYZ19 *
59024836-G-T 56878689-G-T *
59024628-A-T 56878481-A-T *
59024573-G-A 56878426-G-A *
59024563-T-C 56878416-T-C *
59020900-T-C 56874753-T-C *
59018723-C-T 56872576-C-T *
59018683-G-A 56872536-G-A *
59018641-G-A 56872494-G-A *
20473133-G-A 18311247-G-A BY154935 P5_Dst *
13694687-G-A 11539011-G-A *
59014682-AAT-A 56868535-AAT-A *
59031595-C-T 56885448-C-T *
59014536-A-G 56868389-A-G *
59014490-C-T 56868343-C-T *
59013179-G-T 56867032-G-T *
59013026-A-T 56866879-A-T *
59012232-GTA-G 56866085-GTA-G *
59012085-T-C 56865938-T-C *
13707161-GGT-TGC 11551485-GGT-TGC *
59011061-T-A 56864914-T-A *
28795663-CATC-GATA 26649516-CATC-GATA *
59009693-C-T 56863546-C-T *
13688965-TGAAG-GGAAA 11533289-TGAAG-GGAAA *
22432968-A-G 20271082-A-G DYZ19 *
59031248-T-A 56885101-T-A *
13690848-CAA-GAT 11535172-CAA-GAT *
22505044-G-T 20343158-G-T DYZ19 *
22351368-T-A 20189482-T-A DYZ19 *
13268061-AG-CA 11112385-AG-CA *
22324469-A-C 20162583-A-C DYZ19 *
27483042-G-A 25336895-G-A P1_Y2 *
27483079-T-C 25336932-T-C P1_Y2 *
13503039-TA-T 11347363-TA-T *
9936297-CACG-GACA 10098688-CACG-GACA *
22503805-G-A 20341919-G-A DYZ19 *
59031513-CC-GG 56885366-CC-GG *
59012419-AT-CA 56866272-AT-CA *
22355517-G-C 20193631-G-C DYZ19 *
22495101-T-G 20333215-T-G DYZ19 *
22351379-G-A 20189493-G-A DYZ19 *
58974437-ATTC-GTTT 56828290-ATTC-GTTT *
22367425-T-G 20205539-T-G DYZ19 *
13711825-A-C 11556149-A-C *
58854637-CGATG-GCATT 56736230-CATCG-AATGC *
22343282-G-C 20181396-G-C DYZ19 *
22321064-T-G 20159178-T-G DYZ19 *
28224059-A-G 26077912-A-G P1_b4 *
22455451-G-T 20293565-G-T DYZ19 *
28814590-TC-GA 26668443-TC-GA *
58867066-A-T 56723805-T-A *
27483421-A-G 25337274-A-G P1_Y2 *
22481867-G-T 20319981-G-T DYZ19 *
58977739-ATTG-TTTA 56831592-ATTG-TTTA *
22481833-G-C 20319947-G-C DYZ19 *
59008918-C-T 56862771-C-T *
22297923-TCAC-ACAG 20136037-TCAC-ACAG DYZ19 *
28812733-TTA-GTG 26666586-TTA-GTG *
13264217-TTC-T 11108541-TTC-T *
13261085-G-A 11105409-G-A *
13244874-A-G 11089198-A-G *
22481826-G-C 20319940-G-C DYZ19 *
28810533-GGCA-AGGG 26664386-GGCA-AGGG *
9964281-G-A 10126672-G-A Y*
9946170-C-T 10108561-C-T Y*
28806847-TAG-GAT 26660700-TAG-GAT *
28806891-GG-TT 26660744-GG-TT *
13717777-GTCA-CTCG 11562101-GTCA-CTCG *
13451745-AC-GT 11296069-AC-GT *
13723167-GG-TT 11567491-GG-TT *
22490333-A-G 20328447-A-G DYZ19 *
22501241-G-T 20339355-G-T DYZ19 *
22493637-T-C 20331751-T-C DYZ19 *
22481770-C-T 20319884-C-T DYZ19 *
22323036-A-C 20161150-A-C DYZ19 *
58983538-T-C 56837391-T-C *
22320849-T-G 20158963-T-G DYZ19 *
22320494-C-A 20158608-C-A DYZ19 *
58983577-A-G 56837430-A-G *
27794677-C-CAT 25648530-C-CAT P1_Y2 12×AT*
9936357-T-A 10098748-T-A Y*
22493308-A-T 20331422-A-T DYZ19 *
13705110-T-A 11549434-T-A *
13268004-A-T 11112328-A-T *
13449764-TATTCCATTCT-CATTGCATTCC 11294088-TATTCCATTCT-CATTGCATTCC *
59008282-T-C 56862135-T-C *
13498002-TG-AA 11342326-TG-AA *
59007644-C-A 56861497-C-A *
59005020-T-C 56858873-T-C *
59002728-G-A 56856581-G-A *
59000116-G-A 56853969-G-A *
59000043-C-T 56853896-C-T *
58999713-C-A 56853566-C-A *
58998283-A-G 56852136-A-G *
58970570-G-A 56824423-G-A *
58968064-C-T 56821917-C-T *
28582566-C-G 26436419-C-G *
13251213-A-G 11095537-A-G *
13569797-T-A 11414121-T-A *
13565113-GTAT-ATAC 11409437-GTAT-ATAC *
13411573-G-A 11255897-G-A *
13535098-C-A 11379422-C-A *
13533349-G-A 11377673-G-A *
13533339-A-G 11377663-A-G *
58880323-C-T 56710548-G-A *
13448576-CTCTAT-TTCCAC 11292900-CTCTAT-TTCCAC *
13450930-CC-AT 11295254-CC-AT *
13500598-A-G 11344922-A-G A10798 *
9952613-CACAT-TACAC 10115004-CACAT-TACAC *
22502503-AG-TA 20340617-AG-TA DYZ19 *
20751042-G-A 18589156-G-A P4_Prx 13×A*
59009355-G-T 56863208-G-T *
28802622-CGGA-TGGC 26656475-CGGA-TGGC *
9964942-C-T 10127333-C-T Y*
22501568-T-A 20339682-T-A DYZ19 *
9936338-T-A 10098729-T-A Y*
56857067-AAAAAAAT-A,AAAT *
28805301-TCGG-ACGC 26659154-TCGG-ACGC *
28805796-CGT-TGG,TGT 26659649-CGT-TGG,TGT *
28809773-CAGAGTGG-TAGAGTGC 26663626-CAGAGTGG-TAGAGTGC *
28813876-TCGG-ACGC 26667729-TCGG-ACGC *
28817559-TAT-GAG,GAT 26671412-TAT-GAG,GAT *
19879-AG-GC *
56849999-GGTTA-TGTCT *
56867470-TATA-AATA,AATG *
56870780-CA-CG,TG *
13449164-G-ATCCCACTCCT 11293488-G-ATCCCACTCCT *
56836191-CTTCG-CTTTG,TTTCA *
27389579-G-A 25243432-G-A P1_g3 *
28582676-G-A 26436529-G-A ***
56835849-CACTCCATTCCAATCCGTGCCAC-ACTCCATTCCAATCCATGCCAC,ACTCCATTCCAATCCATGTCAA *
6533787-G-A 6665746-G-A *
6547179-C-A 6679138-C-A *
6584055-TAACTC-T 6716014-TAACTC-T *
7664475-T-G 7796434-T-G Y*
7664481-T-G 7796440-T-G Y*
13446325-GCT-ACA,GCA 11290649-GCT-ACA,GCA *
20428171-A-C 18266285-A-C P5_Dst *
20428181-C-A 18266295-C-A P5_Dst *
20428186-CTGG-ATGT 18266300-CTGG-ATGT P5_Dst *
22322371-C-T 20160485-C-T DYZ19 *
22323223-C-T 20161337-C-T DYZ19 *
28804032-CAGAGTGG-TAGAGTGC 26657885-CAGAGTGG-TAGAGTGC *
28582685-C-A 26436538-C-A ***
22323958-G-C 20162072-G-C DYZ19 *
13726023-CTGGAATGGAA-T,TTGGAATGGAA 11570347-CTGGAATGGAA-T,TTGGAATGGAA *
13691798-T-AATGGA,TATGGA 11536122-T-AATGGA,TATGGA *
13692824-GGAAC-AGAAT 11537148-GGAAC-AGAAT *
13693201-AGTCA-AGTCG,CGTCG 11537525-AGTCA-AGTCG,CGTCG *
13694812-AATGGG-GATTGC,GATTGG 11539136-AATGGG-GATTGC,GATTGG *
9936329-C-A 10098720-C-A Y*
13705116-GG-TT 11549440-GG-TT *
13706085-TATGGCG-AATGGCA 11550409-TATGGCG-AATGGCA *
13709156-CACTGGAATGGAA-GAT 11553480-CACTGGAATGGAA-GAT *
13712659-GAATA-AAATG,GAATG 11556983-GAATA-AAATG,GAATG *
13719489-AT-AA,TA 11563813-AT-AA,TA *
13720826-CA-TT 11565150-CA-TT *
13725970-CGAAC-CGAAT,GGAAC 11570294-CGAAC-CGAAT,GGAAC *
13726355-CAA-GAA,GAC 11570679-CAA-GAA,GAC *
28803998-GG-TT 26657851-GG-TT *
13850547-CATGGAATGGA-C,CATGGAATGGC 11729841-CATGGAATGGA-C,CATGGAATGGC 7×ATGGA*
22253943-T-C 20092057-T-C DYZ19 *
22457534-TGTGTC-AGTGGT 20295648-TGTGTC-AGTGGT DYZ19 *
22457560-AGG-GGA 20295674-AGG-GGA DYZ19 *
28793003-CAT-AAG 26646856-CAT-AAG *
28793486-TAATGGAATGGAATGGAATGGAATGGAAT-GAATGGAATGGAATGGAATGGAATGGAAC,TAATGTAATGGAATGGAATGGAATGGAAT 26647339-TAATGGAATGGAATGGAATGGAATGGAAT-GAATGGAATGGAATGGAATGGAATGGAAC,TAATGTAATGGAATGGAATGGAATGGAAT 7×AATGG*
28793555-CAAAT-GAAAC 26647408-CAAAT-GAAAC *
28794071-AA-CT 26647924-AA-CT *
28795410-GGCA-AGGG 26649263-GGCA-AGGG *
28797186-TAAG-GAAT 26651039-TAAG-GAAT *
28797371-ATC-GTA 26651224-ATC-GTA *
28799770-AAGGA-CAGGC 26653623-AAGGA-CAGGC *
22323625-A-C 20161739-A-C DYZ19 *
22331275-T-A 20169389-T-A DYZ19 *
13690439-TAA-CAG 11534763-TAA-CAG *
28807090-T-G 26660943-T-G *
56848710-CAT-CAC,GAC *
56852256-CA-ACC *
56852449-CA-TG *
56852959-TGACA-AGACA,AGACG *
56854117-CA-ACC,CC *
56856114-AAAA-AG,G *
56861289-TTTTTTTTTT-ATATTTATTTTTT,ATTTTTATTTTTTA *
56866560-TG-GG,GT *
56869653-TCACA-CCATG,TCACG *
56878564-TAATT-T,TAATC *
56880908-GAGA-TAGG *
13453840-CTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCAT-CTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCAA,TTCCACTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCAT 11298164-CTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCAT-CTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCAA,TTCCACTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCAT 10×TCCAT*
56834249-GTTCCATTCCATTCCATTCC-ATTCCGTTCCATTCCATTCCATTCT 4×TTCCA*
13486612-AGGT-GGGA,GGGT 11330936-AGGT-GGGA,GGGT *
22360051-C-G 20198165-C-G DYZ19 *
28808749-A-T 26662602-A-T PF1351 *
28808737-T-C 26662590-T-C PF1350 *
28807106-C-G 26660959-C-G PF1347 *
56831681-GACTCCACTCAACTCC-CACTCCACTCAACTCC,CATTCCCCTCCTCTCA *
22504988-T-G 20343102-T-G DYZ19 *
22423737-G-A 20261851-G-A DYZ19 *
22423729-T-C 20261843-T-C FGC58229 DYZ19 *
13700609-T-C,G 11544933-T-C,G *
56834434-ACTCCATTCCATTCCCT-ACTCCATTCCATTCCCTTCCAC,CTTCCATTCCATTCCCT *
22481783-A-T 20319897-A-T DYZ19 *
56836993-TTCCATTC-CTG *
56830541-GC-AT *
22343230-T-A 20181344-T-A DYZ19 *
25419806-CT-C 23273659-CT-C P2_r2 16×T*
22343238-C-T 20181352-C-T DYZ19 *
22355674-C-G 20193788-C-G DYZ19 *
22360966-AA-AC,CA 20199080-AA-AC,CA DYZ19 *
22481818-ACG-CCT 20319932-ACG-CCT DYZ19 *
22485112-AGAG-TGAC 20323226-AGAG-TGAC DYZ19 *
22493488-A-G 20331602-A-G DYZ19 *
22493499-T-C 20331613-T-C DYZ19 *
22497817-T-G 20335931-T-G DYZ19 *
24063605-G-C 21917458-G-C P3_b1 *
24693941-G-A 22547794-G-A P3_b2 *
25311029-C-T 23164882-C-T P2_r1 *
25378117-G-A 23231970-G-A P2_r2 *
25730924-G-C 23584777-G-C P1_b3 *
56827548-TTTCCAT-ATGCGAG,ATTCCAT *
26477536-C-T 24331389-C-T P1_Y1 *
26572829-C-T 24426682-C-T P1_g2 *
26819062-G-A 24672915-G-A P1_g2 *
26842075-TA-T 24695928-TA-T P1_r3 17×A*
26947102-C-T 24800955-C-T P1_r3 *
27003352-G-A 24857205-G-A P1_r4 *
27483061-C-T 25336914-C-T P1_Y2 *
27489479-A-G 25343332-A-G P1_Y2 *
28231450-C-G 26085303-C-G P1_b4 *
28582605-T-A,C 26436458-T-A,C *
28587895-CCC-TCT 26441748-CCC-TCT *
56827528-TTTCCTTTCCATTCCA-T,TTTCCATTCCATTCCA *
13691626-CAAAATA-TAGAATT 11535950-CAAAATA-TAGAATT *
13696759-CGAAC-CGAAT,GGAAC 11541083-CGAAC-CGAAT,GGAAC *
13689934-CGGAG-CGGAA,TGGAA 11534258-CGGAG-CGGAA,TGGAA *
27453-G-A *
25784078-A-C 23637931-A-C P1_b3 *
23703760-G-A 21541874-G-A *
28257621-T-A 26111474-T-A P1_b4 *
26476558-C-T 24330411-C-T P1_Y1 *
10972838-C-A *
27248-C-A *
27409-T-C *
9936449-TG-CA 10098840-TG-CA *
11003579-TC-T *
9952497-AG-GA,GG 10114888-AG-GA,GG *
9961197-ATT-GTG 10123588-ATT-GTG *
10061852-TAC-CAT 10224243-TAC-CAT *
10061899-ACAG-GCAT 10224290-ACAG-GCAT *
10683305-CA-AT,CT *
13689738-CTC-ATG,ATGGACTC 11534062-CTC-ATG,ATGGACTC *
10789463-GC-AG,GG *
13514243-T-C 11358567-T-C *
22492240-G-A 20330354-G-A DYZ19 *
10986745-GAA-AAC,GAC *
13362927-CTT-C 11207251-CTT-C 12×T*
59008936-A-AT 56862789-A-AT 8×T*
22493523-A-C 20331637-A-C DYZ19 *
24057217-C-T 21911070-C-T P3_b1 *
13508841-A-G 11353165-A-G *
28810437-GGT-AGGG 26664290-GGT-AGGG *
22355982-T-C 20194096-T-C DYZ19 *
22496895-C-T 20335009-C-T DYZ19 *
22503841-T-G 20341955-T-G DYZ19 *
22492219-G-A 20330333-G-A DYZ19 *
58979862-TG-CT 56833715-TG-CT *
58979661-TTTAC-ATTAT 56833514-TTTAC-ATTAT *
22492211-C-T 20330325-C-T DYZ19 *
28812475-ATC-GTA 26666328-ATC-GTA *
28805345-CA-AT 26659198-CA-AT *
13709578-CA-TT 11553902-CA-TT *
13691232-CGC-GGG 11535556-CGC-GGG *
13468192-CTTAT-GTTAC 11312516-CTTAT-GTTAC *
10900008-CTCCA-ATCCC *
13204025-ATAATGG-CTGATGA 11048349-ATAATGG-CTGATGA *
13267850-GCTCA-CCTCA,CCTCT 11112174-GCTCA-CCTCA,CCTCT *
13468234-ATG-TTC 11312558-ATG-TTC *
13271055-G-AAA 11115379-G-AAA *
13448317-CTCCAT-TTCCAC 11292641-CTCCAT-TTCCAC *
13267843-CC-AC,AT 11112167-CC-AC,AT *
13448563-GAAATC-G,GCAATC 11292887-GAAATC-G,GCAATC *
13449059-GTTCCACTG-ATTC,ATTCCACTG 11293383-GTTCCACTG-ATTC,ATTCCACTG *
13263676-TGCG-AGCT,TGTG 11108000-TGCG-AGCT,TGTG *
13449326-TTT-ATT,CTA 11293650-TTT-ATT,CTA *
13446484-TG-CA,CG 11290808-TG-CA,CG *
13450996-CAT-CAC,TAC 11295320-CAT-CAC,TAC *
13263468-GGT-ACA,GCA 11107792-GGT-ACA,GCA *
13451074-CTAT-GGAA,GGAT 11295398-CTAT-GGAA,GGAT *
13452125-TTCCACTG-CTCCACTG,CTCTACTC 11296449-TTCCACTG-CTCCACTG,CTCTACTC *
13452227-CCACTC-C,G 11296551-CCACTC-C,G *
13450503-ACACTCCACTCCACTCCACTTCACTCCAC-ACACTCCACTCCACTCCAC,CCACTCCACTCCACTCCAATCCATCCCAT 11294827-ACACTCCACTCCACTCCACTTCACTCCAC-ACACTCCACTCCACTCCAC,CCACTCCACTCCACTCCAATCCATCCCAT *
13272738-TT-CC,CT 11117062-TT-CC,CT *
13564093-TGAAA-CGAAG 11408417-TGAAA-CGAAG *
13688232-GAATGC-GAATGG,TAATGG 11532556-GAATGC-GAATGG,TAATGG *
13564080-TG-CC 11408404-TG-CC *
13262027-C-A 11106351-C-A *
10764197-TG-CT **
27701027-C-T 25554880-C-T P1_Y2 **
10834089-TTCACA-GTCCCC **
4726-A-G FGC77664 **
10834102-AAG-CAA **
10997421-A-G **
10982820-A-C **
10821681-TCAT-ACAC **
10793969-T-C **
26386507-GAAAAAC-AAAAAAA 24240360-GAAAAAC-AAAAAAA P1_Y1 **
10942651-ACATTCCACTT-CAGTTAAACTC **
10917966-C-G **
10764214-CTCCACA-TTGCACT **
10868553-T-A **
10994207-TT-CG **
10936894-C-T **
13545351-AGAAAGAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAG-GAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAA 11389675-AGAAAGAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAG-GAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAA **
10754266-T-G **
10775629-A-C **
10692062-C-A **
18892211-A-AT 16780331-A-AT **
10916335-A-G **
10936882-C-T **
10868539-T-C **
10936224-C-T **
11654632-T-C **
22353430-GAA-TAG 20191544-GAA-TAG DYZ19 **
12371755-A-G **
20826389-CTTTCTTTC-TTTTTTTTT 18664503-CTTTCTTTC-TTTTTTTTT P4_Gap **
22295936-AC-GT 20134050-AC-GT DYZ19 **
22281896-T-G 20120010-T-G DYZ19 **
10957767-N-A **
10994189-TCATTCTATA-CCACTCCATT **
10866327-CACA-TACG **
10793993-CTA-TTC **
10922487-N-T **
10795020-ATGA-GTGT **
10795028-GTA-ATC **
10807361-TTTCCAC-ATTTCCCT **
10834132-ACATT-TCATG **
10836461-CTCC-TTCG **
10859559-C-T **
10879393-C-A **
10801762-TAT-AAC **
36730-C-T **
10911616-A-T **
14982-T-G **
56704748-C-A **
10927427-TA-CG **
10928711-C-A **
10928720-A-T **
10930792-A-C **
11660375-N-T **
10793951-CACC-TGCT **
10908390-CA-TG **
10629312-CTACTCC-ACATTAA **
10748308-TG-AC **
10655805-CGACAG-GAGAT **
10668043-CAATTC-A **
10692261-AAAC-CAAA **
10693698-CC-AA **
10693710-GTTGCA-TTTCCG **
10744418-CCATT-ACATG **
10746845-T-C **
10748289-TTCC-CTCT **
22330071-T-TA 20168185-T-TA DYZ19 **
10769195-C-T **
10749944-TCCAA-ACCAT **
36719-A-G **
10754280-TA-CC **
4700-T-G FGC80356 **
22236702-G-A 20074816-G-A DYZ19 **
20692965-CAAAAA-C 18531079-CAAAAA-C P4_Prx 19×A**
20526874-T-C 18364988-T-C P5_Dst **
10754648-TCCAC-CCCAG **
10763851-G-A **
10755023-GTTCCG-TTTCTC **
10782700-GCTC-ACTT **
58823338-TTC-ATT 56767531-GAA-AAT **
58859945-C-T 56730926-G-A *****
17275757-AA-GG 15163877-AA-GG **
22266272-G-C 20104386-G-C DYZ19 **
18227549-G-GT 16115669-G-GT 14×T*****
13329224-G-T 11173548-G-T **
19937284-G-GCCCCCCC 17825404-G-GCCCCCCC P5_Prx 13×C**
26310632-C-CTTTT 24164485-C-CTTTT P1_Y1 28×T**
13139814-G-T 10629300-G-T **
22252915-T-G 20091029-T-G DYZ19 **
24672342-C-G 22526195-C-G P3_b2 **
19377331-G-A 17265451-G-A ****
5786608-C-CAAAAAAAAAAAAA 5918567-C-CAAAAAAAAAAAAA 20×A**
58845839-CATTCGAGTCCATTCG-C 56745015-TTCGAATGGACTCGAA-T **
3956691-AAC-A 4088650-AAC-A 12×AC*****
22337705-A-G 20175819-A-G DYZ19 **
2783726-CAAACAAAC-AAAAAAAAA 2915685-CAAACAAAC-AAAAAAAAA **
8125067-AAG-A 8257026-AAG-A ***
58844026-A-ATC 56746843-A-AAG ***
13483759-TGACT-AGATA 11328083-TGACT-AGATA ***
13482911-ATTC-GTTA 11327235-ATTC-GTTA ***
13469931-TGAC-CGCA 11314255-TGAC-CGCA ***
13404867-TATATAC-CATGTAA 11249191-TATATAC-CATGTAA ***
2685644-C-CTTTTTT 2817603-C-CTTTTTT 20×T***
13433622-TTTTCTCTCTTTCTCTCTT-CTTTCTCTCTCTATCTCCC 11277946-TTTTCTCTCTTTCTCTCTT-CTTTCTCTCTCTATCTCCC ***
13485685-CCCCCTGT-TGCCCTGG 11330009-CCCCCTGT-TGCCCTGG ***
13485669-GATA-TAGT 11329993-GATA-TAGT ***
13442553-TT-CC 11286877-TT-CC ***
13445374-AAAAGAAGAAAAAAGA-GAAGAAGAAAAAAGG 11289698-AAAAGAAGAAAAAAGA-GAAGAAGAAAAAAGG ***
7032333-A-ATTTTT 7164292-A-ATTTTT 22×T***
13480242-TGTAC-GGAAG 11324566-TGTAC-GGAAG ***
13468361-GCAGA-ACAGG 11312685-GCAGA-ACAGG ***
13468959-TTAGA-CTGTG 11313283-TTAGA-CTGTG ***
4269771-C-CTTTTT 4401730-C-CTTTTT 24×T***
13465313-A-C 11309637-A-C ***
13267597-C-CAAAAAAAAAA 11111921-C-CAAAAAAAAAA 11×A***
28794963-CT-C 26648816-CT-C ***
13203955-CATCATT-GACAATA 11048279-CATCATT-GACAATA ***
13140073-CGAGTGCGTGTGATTCCATT-C 10629559-CGAGTGCGTGTGATTCCATT-C ***
9732895-C-CAAAAAA 9895286-C-CAAAAAA IR3_Prx 20×A***
6089764-G-GTTTTT 6221723-G-GTTTTT 31×T***
4848574-G-GTTTTTTT 4980533-G-GTTTTTTT 29×T***
13531506-AA-G 11375830-AA-G ***
19183814-C-CTTT 17071934-C-CTTT 28×T***
58861589-G-T 56729282-C-A ***
28709251-CC-TA 26563104-CC-TA ***
58843619-C-G 56747252-G-C ***
24485675-C-TT 22339528-C-TT 15×T***
58843621-T-A 56747250-A-T ***
58843622-T-G 56747249-A-C ***
22341315-T-A 20179429-T-A DYZ19 ***
58843631-T-A 56747240-A-T ***
58843684-A-G 56747187-T-C ***
21620499-ATACTATACTATACTATACTATACTATACTATACTATACTATACTATACTATACT-ATACTATACTATACTATACTATACTATACTATACTATACTATACTATACTATACC,GTACTATACTATACTATACTATACTATACTATACTATACTATACTATACTATACT 19458613-ATACTATACTATACTATACTATACTATACTATACTATACTATACTATACTATACT-ATACTATACTATACTATACTATACTATACTATACTATACTATACTATACTATACC,GTACTATACTATACTATACTATACTATACTATACTATACTATACTATACTATACT ***
58846255-G-C 56744616-C-G ***
16435936-GTAA-TTAAT 14324056-GTAA-TTAAT ***
15752635-TCTC-CCTT 13640755-TCTC-CCTT ***
58846705-G-C 56744166-C-G ***
58858642-C-A 56732229-G-T ***
58861660-T-C 56729211-A-G ***
13690724-AATGA-TATGG 11535048-AATGA-TATGG ***
58908656-C-A 56682215-G-T ***
9962120-AT-GG 10124511-AT-GG ***
13203943-TGA-GGT 11048267-TGA-GGT ***
22480585-TTTGAA-T 20318699-TTTGAA-T DYZ19 ***
58913294-G-A 56677577-C-T ***
58913139-G-A 56677732-C-T ***
13700510-AGCTCC-GGCTCG 11544834-AGCTCC-GGCTCG ***
58907346-G-A 56683525-C-T ***
58864124-T-G 56726747-A-C ***
58898602-T-G 56692269-A-C ***
58898514-G-A 56692357-C-T ***
58875220-T-G 56715651-A-C ***
58873281-G-A 56717590-C-T ***
58870015-T-A 56720856-A-T ***
58867576-C-G 56723295-G-C ***
13203965-GA-G 11048289-GA-G ***
14258632-A-AT 12137926-A-AT ***
13485452-GGAGATA-AGAAATC 11329776-GGAGATA-AGAAATC ***
22226585-GAGCT-CAGCA 20064699-GAGCT-CAGCA DYZ19 ***
10880700-T-A ***
10880693-AAT-CAC ***
19744991-ATTTTTTTTTTT-A 17633111-ATTTTTTTTTTT-A P5_Prx 23×T***
10877044-ACTC-GCTG ***
10869962-CATC-TACT ***
20025482-T-TCCCCCCC 17913602-T-TCCCCCCC P5_Prx 14×C***
10851997-CC-AA ***
10851057-CTC-ACC,TTA ***
10836749-A-T ***
20332111-C-CAAAAAAAAAAAAAAAAA 18170225-C-CAAAAAAAAAAAAAAAAA P5_Dst 30×A***
22113187-C-CAAAAAA 19951301-C-CAAAAAA 23×A***
10826907-TT-AC ***
10826872-AC-TT ***
10813041-CT-AA ***
10803523-C-T ***
10884578-ACTGCA-CCTTCT ***
22232040-CAAA-AAAT 20070154-CAAA-AAAT DYZ19 ***
22232055-ACAC-GCAT 20070169-ACAC-GCAT DYZ19 ***
22232109-TTC-GTG 20070223-TTC-GTG DYZ19 ***
22235087-AT-A 20073201-AT-A DYZ19 ***
10790985-ATTC-CTTT ***
22236464-CCCACCAAGG-ACCAGTAAGT 20074578-CCCACCAAGG-ACCAGTAAGT DYZ19 ***
58840569-T-G 56750302-A-C ***
10773716-TTTCC-ATTCG ***
22252645-TCTTCCTTTTGGC-CCTTAATTCTGGG 20090759-TCTTCCTTTTGGC-CCTTAATTCTGGG DYZ19 ***
22263795-AC-GT 20101909-AC-GT DYZ19 ***
10763273-TTC-CTA ***
10760349-GTACTC-CCACTT,GCACTC ***
10758814-TACTT-CACTC ***
22265842-GT-CA 20103956-GT-CA DYZ19 ***
10880727-CC-TA ***
10884589-CT-AA ***
13485479-AG-TC 11329803-AG-TC ***
10972920-CTA-ATC ***
14025566-G-GAA 11904860-G-GAA ***
58843537-T-G 56747334-A-C ***
14562321-C-CTTTT 12450522-C-CTTTTT 42×T***
11035584-TACTCGACTCC-CACTAG ***
11025434-AAT-CGG ***
11025088-AAC-CAT ***
11018868-ATTA-TTTC ***
10999996-CTA-ATC ***
10994686-CTCCA-GTCCT ***
15336019-C-CAAAAAAA 13224137-C-CAAAAAAA 30×A***
15340383-C-CTTTTT 13228501-C-CTTTT 18×T***
10984499-TGA-AGG ***
10983275-C-G ***
10980670-GCACAA-ACAAAG ***
10964544-C-A ***
10892802-TTC-CTT ***
10959530-AC-TCTCCAT ***
10952256-ACTAC-TTTTAACTGA ***
10952237-C-CTGAAT ***
10952213-TCCAT-ACCAC ***
15884888-CA-GG 13773008-CA-GG ***
16344401-C-CTTCTTA 14232521-C-CTTCTTA ***
16344411-T-TTCTTCA 14232531-T-TTCTTCA ***
18447621-G-GGTTTTTTTTTTT 16335741-G-GGTTTTTTTTTTT P6_Dst 18×T***
18688500-C-CAAAAA 16576620-C-CAAAAA 20×A***
10906093-CTTG-TC ***
19409391-C-CAAAAA 17297511-C-CAAAAA 22×A***
10899063-TCCAT-ACCAC ***
10894207-A-T ***
10894190-C-T ***
58843539-T-C 56747332-A-G ***
58831571-C-A 56759300-G-T ***
58841320-C-T 56749551-G-A ***
26469280-A-C 24323133-A-C P1_Y1 ***
27484908-G-A 25338761-G-A P1_Y2 ***
27483513-G-A 25337366-G-A P1_Y2 ***
10091216-G-C 10253607-G-C ***
27429623-A-C 25283476-A-C P1_g3 ***
27120309-CT-C 24974162-CT-C P1_r4 17×T***
27061668-AT-A 24915521-AT-A P1_r4 17×T***
10091249-C-T 10253640-C-T ***
13129723-C-G 10619209-C-G ***
13258279-C-A 11102603-C-A ******
26832059-CT-C 24685912-CT-C P1_g2 14×T***
26697546-CT-C 24551399-CT-C P1_g2 12×T***
13374277-G-C 11218601-G-C 13×A***
26478948-G-C 24332801-G-C P1_Y1 ***
13580857-C-T 11425181-C-T ***
25833864-CA-C 23687717-CA-C P1_b3 15×A***
27519347-G-A 25373200-G-A P1_Y2 ***
23109873-C-T 20947987-C-T ***
16784423-G-A 14672543-G-A ***
22493340-T-A 20331454-T-A DYZ19 ***
15884958-A-C 13773078-A-C ***
14787830-T-A 12675901-T-A ***
14258636-A-C 12137930-A-C ***
22503940-A-C 20342054-A-C DYZ19 ***
23218634-G-A 21056748-G-A ***
13730234-C-G 11574558-C-G ***
14258626-G-A 12137920-G-A ***
14258574-C-A 12137868-C-A ***
14109993-C-T 11989287-C-T ***
14109889-C-T 11989183-C-T ***
13742683-C-G 11587007-C-G ******
25614551-A-G 23468404-A-G P1_gr1 ***
10091214-A-G 10253605-A-G ***
10052600-G-T 10214991-G-T ***
19029161-G-A 16917281-G-A ***
22757115-A-G 20595229-A-G FGC24512 ***
22435749-A-AT 20273863-A-AT DYZ19 ***
28793863-G-A 26647716-G-A ***
25705290-A-T 23559143-A-T P1_b3 18×CT***
13486557-GGAGAT-AGAGAC,AGTGAT 11330881-GGAGAT-AGAGAC,AGTGAT ***
13867986-T-G,TAATGG 11747280-T-G,TAATGG 10×AATGG***
10776554-TAC-CTA,TTC ***
10668339-GC-CA,CCACTCA ***
10658485-ATC-TTG ***
22257039-A-G 20095153-A-G DYZ19 ***
3570961-C-A 3702920-C-A ***
10018309-A-T 10180700-A-T ***
58857351-A-G 56733520-T-C ***
22017853-T-G 19855967-T-G ***
7646416-T-A 7778375-T-A 14×A***
6617327-A-G 6749286-A-G ***
27665773-TA-T,TAA 25519626-TA-T,TAA P1_Y2 17×A***
58843625-G-A 56747246-C-T ***
9939130-A-G 10101521-A-G ***
27924442-GT-G 25778295-GT-G P1_Y2 12×T***
9202147-C-A 9364538-C-A ***
28384225-TA-T 26238078-TA-T P1_gr2 13×A***
4275251-T-A 4407210-T-A ***
4275246-G-A 4407205-G-A ***
56826836-CCATTCCATTCGATTCCATTCCATTCAATTCC-AG ***
13257337-C-T 11101661-C-T ***
22344854-A-C 20182968-A-C DYZ19 ***
22266205-C-G 20104319-C-G DYZ19 ***
22344856-A-T 20182970-A-T DYZ19 ***
22344851-C-G 20182965-C-G DYZ19 ***
58864072-C-G 56726799-G-C ***
13485153-T-A 11329477-T-A ***
17196569-G-A 15084689-G-A ***
20655106-C-T 18493220-C-T P4_Prx ***
28793660-TA-GG 26647513-TA-GG ***
26483733-T-C 24337586-T-C P1_Y1 ***
22481674-T-A 20319788-T-A DYZ19 ***
22495731-G-A 20333845-G-A DYZ19 ***
22496043-C-A 20334157-C-A DYZ19 ***
22496212-A-G 20334326-A-G DYZ19 ***
22499499-C-T 20337613-C-T DYZ19 ***
22504592-G-C 20342706-G-C DYZ19 ***
22757065-A-T 20595179-A-T ***
22757104-A-G 20595218-A-G ***
24207616-C-A 22061469-C-A P3_b1 ***
36407-G-T ***
25268596-G-A 23122449-G-A P2_r1 ***
25656546-G-T 23510399-G-T P1_b3 ***
56730318-A-T ***
25736792-C-A 23590645-C-A P1_b3 ***
27077100-A-T 24930953-A-T P1_r4 ***
22450150-G-T 20288264-G-T DYZ19 ***
28802953-CAAAT-GAAAC 26656806-CAAAT-GAAAC ***
58840431-G-A 56750440-C-T ***
22337200-CATGTCC-TATTTCG 20175314-CATGTCC-TATTTCG DYZ19 ***
58831563-T-A 56759308-A-T ***
58831551-T-C 56759320-A-G ***
58823172-C-T 56767699-G-A ***
28799782-AGAACGGA-TGAAAGGC 26653635-AGAACGGA-TGAAAGGC ***
58820351-T-C 56770520-A-G ***
28813720-GGTCGAT-AGTGGAG 26667573-GGTCGAT-AGTGGAG ***
27905021-C-T 25758874-C-T P1_Y2 ***
28805108-TT-GG 26658961-TT-GG ***
27902197-C-T 25756050-C-T P1_Y2 34×T***
27902189-C-T 25756042-C-T P1_Y2 ***
27078013-G-C 24931866-G-C P1_r4 24×AC***
28812813-AAACG-GAAC 26666666-AAACG-GAAC ***
22481631-A-G 20319745-A-G DYZ19 ***
22421847-T-C 20259961-T-C DYZ19 ***
22231993-A-T 20070107-A-T DYZ19 ***
22293346-T-C 20131460-T-C DYZ19 ***
20460428-ATT-A 18298542-ATT-A P5_Dst 17×T***
22329991-T-A 20168105-T-A DYZ19 ***
22293063-A-C 20131177-A-C DYZ19 ***
22289810-T-A 20127924-T-A DYZ19 ***
22252638-C-T 20090752-C-T DYZ19 ***
22245746-G-A 20083860-G-A DYZ19 ***
22235064-A-C 20073178-A-C DYZ19 ***
22342921-T-A 20181035-T-A DYZ19 ***
22234913-C-G 20073027-C-G DYZ19 ***
22232196-T-A 20070310-T-A DYZ19 ***
22232192-G-T 20070306-G-T DYZ19 ***
22232190-G-T 20070304-G-T DYZ19 ***
22232168-A-T 20070282-A-T DYZ19 ***
22232165-C-A 20070279-C-A DYZ19 ***
22337669-C-G 20175783-C-G DYZ19 ***
22360260-G-T 20198374-G-T DYZ19 ***
22366768-C-G 20204882-C-G DYZ19 ***
10780565-TCTC-CCTG ***
22366714-A-T 20204828-A-T DYZ19 ***
22366688-G-T 20204802-G-T DYZ19 ***
22366658-G-T 20204772-G-T DYZ19 ***
7664487-T-G 7796446-T-G ***
9911351-GCAAG-CCAAT 10073742-GCAAG-CCAAT ***
9964214-AA-TG 10126605-AA-TG ***
22365691-C-A 20203805-C-A DYZ19 ***
19751603-T-G 17639723-T-G P5_Prx ***
22365649-G-A 20203763-G-A DYZ19 ***
22361375-G-T 20199489-G-T DYZ19 ***
16136933-T-C 14025053-T-C P8_Dst ***
22361234-C-A 20199348-C-A DYZ19 ***
19751585-CCAG-ACAT 17639705-CCAG-ACAT P5_Prx ***
19751593-G-T 17639713-G-T P5_Prx ***
22273539-C-CCG 20111653-C-CCG DYZ19 ***
22366697-TTT-AAG 20204811-TTT-AAG DYZ19 ***
22337241-GT-TC 20175355-GT-TC DYZ19 ***
13546523-T-G 11390847-T-G ***
13377964-G-A 11222288-G-A ***
13536423-C-G 11380747-C-G ***
13536428-C-T 11380752-C-T ***
56853683-C-T ***
11009347-C-T ***
10773729-C-A ***
10844667-T-C ***
24016986-C-T 21870839-C-T 15×T***
10667996-G-T ***
11035773-C-A ***
10836477-T-G ***
13536435-C-A 11380759-C-A ***
13538856-A-T 11383180-A-T ***
10869944-T-C ***
10766544-T-C ***
20249276-CA-C 18087390-CA-C P5_Dst 22×A***
10766534-T-C ***
10911642-T-C ***
13557004-G-T 11401328-G-T ***
13557015-A-G 11401339-A-G ***
13557042-A-G 11401366-A-G ***
13564520-G-A 11408844-G-A ***
56850396-A-T ***
11023149-T-G ***
13564769-G-A 11409093-G-A BY15119 ***
13564789-G-T 11409113-G-T ***
10917955-T-G ***
10917946-C-A ***
10917917-G-C ***
13641089-A-T 11485413-A-T ***
13398261-G-A 11242585-G-A ***
10629636-C-A ***
16656658-C-T 14544778-C-T 14×T***
13502954-G-T 11347278-G-T ***
13269566-A-T 11113890-A-T ***
13277678-C-A 11122002-C-A ***
13324015-G-A 11168339-G-A ***
13354609-C-A 11198933-C-A ***
13398387-T-A 11242711-T-A ***
13437719-G-A 11282043-G-A ***
13492158-C-G 11336482-C-G FGC80997 ***
13495259-T-G 11339583-T-G ***
13495538-C-T 11339862-C-T ***
13497242-A-G 11341566-A-G ***
13498926-T-C 11343250-T-C ***
13498939-C-T 11343263-C-T ***
13499023-C-A 11343347-C-A ***
13502609-G-A 11346933-G-A ***
13503073-G-A 11347397-G-A ***
13536091-T-C 11380415-T-C ***
10892829-C-A ***
13535024-T-TTGATCC 11379348-T-TTGATCC ***
13529581-C-A 11373905-C-A ***
10758791-C-T ***
9929351-A-T 10091742-A-T ***
58823473-G-T 56767398-C-A ***
13519382-A-C 11363706-A-C ***
13517022-T-A 11361346-T-A ***
13504252-C-T 11348576-C-T ***
13516825-C-T 11361149-C-T ***
13516368-C-T 11360692-C-T ***
13515257-T-G 11359581-T-G FGC77657 ***
13515161-A-C 11359485-A-C ***
13513551-A-C 11357875-A-C ***
13506771-A-T 11351095-A-T ***
11675236-T-G ***
10844239-A-T ***
13256619-G-C 11100943-G-C ***
59024845-G-A 56878698-G-A ***
28582510-G-C 26436363-G-C ***
59008974-G-A 56862827-G-A ***
59008979-G-C 56862832-G-C ***
22227933-C-A 20066047-C-A DYZ19 ***
59009290-C-T 56863143-C-T ***
13516360-TG-CA 11360684-TG-CA ***
59009672-G-A 56863525-G-A ***
59010319-G-T 56864172-G-T ***
13570555-AGAC-TGAT 11414879-AGAC-TGAT ***
59011617-TTATC-T 56865470-TTATC-T ***
59017896-A-C 56871749-A-C ***
58843384-TGATG-GAATT 56747483-CATCA-AATTC ***
13471841-CTGGG-TGGGT 11316165-CTGGG-TGGGT ***
59018588-G-A 56872441-G-A ***
59031098-T-C 56884951-T-C ***
13544730-T-C 11389054-T-C ***
28492689-CAAA-C 26346542-CAAA-C 18×A***
58885447-A-T 56705424-T-A ***
13266042-CACA-TACG 11110366-CACA-TACG ***
13398337-C-T 11242661-C-T ***
58824569-CATTCCAATAG-C 56766285-ATGGAATCTAT-A ***
22337713-T-A 20175827-T-A DYZ19 ***
58853491-CTCC-TTCA 56737377-GGAG-TGAA ***
25571253-GA-G 23425106-GA-G P1_gr1 13×A***
9965278-AGCAC-GGCAT 10127669-AGCAC-GGCAT ***
9911320-GCA-CCT 10073711-GCA-CCT ***
22235011-C-T 20073125-C-T DYZ19 ***
14297038-C-CTA 12176332-C-CTA 10×TA***
22328388-A-G 20166502-A-G DYZ19 ***
58841130-C-T 56749741-G-A ***
58903863-A-T 56687008-T-A ***
13546463-T-C 11390787-T-C F18196 ***
13540902-A-G 11385226-A-G ***
11029537-T-G ***
13556705-T-C 11401029-T-C ***
28582495-G-A 26436348-G-A ***
10827110-A-G ***
28583617-A-G 26437470-A-G S3111 ***
20850693-GTA-G 18688807-GTA-G P4_Dst 12×TA***
28584105-G-A 26437958-G-A ***
28585927-T-G 26439780-T-G CTS12413 ***
11030778-A-C ***
59027554-A-T 56881407-A-T ***
59032481-A-C 56886334-A-C ***
22503694-GAAT-AAAG 20341808-GAAT-AAAG DYZ19 ***
28178294-T-G 26032147-T-G FGC61364 P1_b4 ***
25706148-CA-C 23560001-CA-C P1_b3 16×A***
13557556-AC-GT 11401880-AC-GT ***
22321030-A-C 20159144-A-C DYZ19 ***
9929314-G-C 10091705-G-C ***
13524322-G-T 11368646-G-T ***
13429060-C-T 11273384-C-T ***
13519022-G-A 11363346-G-A ***
58874785-T-A 56716086-A-T ***
13503438-A-T 11347762-A-T ***
13493016-G-T 11337340-G-T ***
13442461-A-T 11286785-A-T ***
13442455-A-T 11286779-A-T ***
13411637-G-A 11255961-G-A ***
10047828-A-C 10210219-A-C ***
59017917-TCG-GCT 56871770-TCG-GCT ***
13363155-AC-A 11207479-AC-A ***
13285744-C-G 11130068-C-G ***
28785100-A-G 26638953-A-G ***
22314594-G-A 20152708-G-A DYZ19 ***
13395224-C-G 11239548-C-G ***
13260372-T-A 11104696-T-A ***
56853008-G-A ***
22360381-GTTTT-CTTTG 20198495-GTTTT-CTTTG DYZ19 ***
26812667-AT-A 24666520-AT-A P1_g2 16×T***
11022872-TT-CA ***
10927236-TCC-GCA ***
6431385-G-C 6563344-G-C ***
28454731-A-AT 26308584-A-AT P1_gr2 10×T***
28539174-C-CAAAAAA 26393027-C-CAAAAAA 20×A***
13569835-TA-T 11414159-TA-T 11×A***
10987194-T-G ***
28545880-CAAAAAA-C 26399733-CAAAAAA-C 20×A***
13249418-G-A 11093742-G-A ***
58843639-CCAGCCC-GGAGTCA 56747226-GGGCTGG-TGACTCC ***
10784966-C-A ***
58843651-ATTCCATTCCATT-TTTCGACACCCAG 56747208-AATGGAATGGAAT-CTGGGTGTCGAAA ***
58843694-GCATTC-TTTTTG 56747172-GAATGC-CAAAAA ***
58844015-TATTCACTTCCATTTCC-T 56746835-CGAATGGAAATGGAAGT-C ***
16137122-C-T 14025242-C-T P8_Dst ***
11015964-AGTA-CATC ***
13465868-G-T 11310192-G-T ***
13545748-CA-C 11390072-CA-C ***
58868388-AGTGCATTCCATTCCGTGGCT-A 56722460-GACAGCCACGGAATGGAATGC-G ***
22367414-T-A 20205528-T-A DYZ19 ***
58885276-TATTTTATTCCATGCC-T 56705575-CAAATGGCATGGAATA-C ***
13558817-A-T 11403141-A-T ***
58908600-GTTC-CATT 56682268-GAAC-AATG ***
58972565-T-TATTCC 56826418-T-TATTCC ***
9943729-G-T 10106120-G-T ***
25738886-CTAA-C 23592739-CTAA-C P1_b3 ***
59009279-C-A 56863132-C-A ***
21021632-CT-C 18859746-CT-C P4_Dst 17×T***
58862994-GATTTG-CATTAT 56727872-CAAATC-ATAATG ***
58840600-C-T 56750271-G-A ***
9958318-GGGAAT-CGAAAC 10120709-GGGAAT-CGAAAC ***
28253491-C-CAAAAAAAAA 26107344-C-CAAAAAAAAA P1_b4 32×A***
13353871-GAC-G 11198195-GAC-G ***
10667693-A-G ***
22365977-GGTGG-TGTCA 20204091-GGTGG-TGTCA DYZ19 ***
10748018-TTCC-GTCT ***
20021496-TTATATA-T 17909616-TTATATA-T P5_Prx 15×TA***
22366714-ACT-TCG 20204828-ACT-TCG DYZ19 ***
22366755-AGAGA-GGAGT 20204869-AGAGA-GGAGT DYZ19 ***
22421783-GC-CT 20259897-GC-CT DYZ19 ***
22421840-TT-AG 20259954-TT-AG DYZ19 ***
10689140-GT-AA ***
10683323-ATTTCTTTCGAC-CTATCCTTCTAC,CTATCTTTTGAA ***
22496054-AGTGT-TGTGA 20334168-AGTGT-TGTGA DYZ19 ***
10676946-TATTACGG-AACTACAC,TATTACGC ***
10672241-TTCCT-CTCCA ***
10670891-C-T ***
22496169-TTTTG-CTTAC 20334283-TTTTG-CTTAC DYZ19 ***
10658500-GTCA-CTCT ***
10763332-TTTCCA-GTTCTAT ***
9946088-CT-GA 10108479-CT-GA ***
11013909-AC-GA ***
11013918-TAC-CAG ***
11013943-CA-TG ***
13472484-TG-CA 11316808-TG-CA ***
9931519-CTT-TTG 10093910-CTT-TTG ***
9934957-CTTGA-TTTGT 10097348-CTTGA-TTTGT ***
26228689-C-CTTTT 24082542-C-CTTTT P1_Y1 27×T***
23037237-A-ATTTT 20875351-A-ATTTT 20×T***
9952642-TCGAGG-CCAAGC 10115033-TCGAGG-CCAAGC ***
25656575-TG-AA 23510428-TG-AA P1_b3 ***
10061716-CTC-AT 10224107-CTC-AT ***
25444404-CTATTTC-TTTTTTT 23298257-CTATTTC-TTTTTTT P2_r2 ***
24388083-T-TAA 22241936-T-TAA ***
23801733-C-CAAAAAAA 21639847-C-CAAAAAAA 31×A***
13485854-CCG-TCA 11330178-CCG-TCA ***
58995119-AGGCA-GGGCG 56848972-AGGCA-GGGCG ***
13249261-C-T 11093585-C-T ***
58874797-T-A 56716074-A-T ***
10807068-TA-CT ***
13474008-CGTA-GGTT 11318332-CGTA-GGTT ***
13262692-A-G 11107016-A-G ***
9416727-CTTTG-TTTTT 9579118-CTTTG-TTTTT ***
28585775-T-C 26439628-T-C ***
22503758-C-G 20341872-C-G DYZ19 ***
56863028-GT-CC ***
59002978-G-A 56856831-G-A ***
13259717-AG-GT 11104041-AG-GT ***
13504210-G-A 11348534-G-A ***
28583212-T-C 26437065-T-C ***
28582716-A-G 26436569-A-G ***
22342783-A-C 20180897-A-C DYZ19 ***
13437785-A-T 11282109-A-T ***
13508715-T-C 11353039-T-C ***
10972955-CTCT-TTCC ***
3174374-C-T 3306333-C-T 18×T***
10668001-C-A ***
13249403-C-T 11093727-C-T ***
5493431-C-T 5625390-C-T Y60653 24×T***
10894201-C-A ***
5403266-C-T 5535225-C-T 15×T***
27080520-G-T 24934373-G-T P1_r4 16×T***
13395199-G-A 11239523-G-A ***
10629330-T-C ***
13275640-C-T 11119964-C-T ***
26433572-C-T 24287425-C-T P1_Y1 19×T***
13444868-T-G 11289192-T-G ***
10030599-TAGC-AAGT 10192990-TAGC-AAGT ***
13517191-G-C 11361515-G-C ***
13517206-T-A 11361530-T-A ***
58853472-G-C 56737399-C-G ***
10982945-CCTCGCT-TC ***
18688521-C-AAA 16576641-C-AAA ***
58840395-CCGTTC-TCATT 56750471-GAACGG-AATGA ***
58840410-CCATTCCATTCGATTTAG-ACATTCGATTCGATTCGA 56750444-CTAAATCGAATGGAATGG-TCGAATCGAATCGAATGT ***
56881412-T-C ***
58843671-TTTCCGTTTCA-ATTCAATGATT 56747190-TGAAACGGAAA-AATCATTGAAT ***
13463948-TTCCCCC-CTCACCCAAAA 11308272-TTCCCCC-CTCACCCAAAA ***
58840455-CGA-TGT 56750414-TCG-ACA ***
13203970-CCACCCCGCCTC-TAAT 11048294-CCACCCCGCCTC-TAAT ***
22268297-GTGACC-TTGAGT 20106411-GTGACC-TTGAGT DYZ19 ***
58840445-CCA-GCATTTT 56750424-TGG-AAAATGC ***
13563786-G-T 11408110-G-T ***
13558802-G-T 11403126-G-T FGC77658 ***
13482969-TA-CC 11327293-TA-CC ***
13251187-A-G 11095511-A-G FGC77810 ***
28797878-GAGTG-AAATT 26651731-GAGTG-AAATT ***
22257030-CCACG-GCATT 20095144-CCACG-GCATT DYZ19 ***
22263840-CAT-TCC 20101954-CAT-TCC DYZ19 ***
13263697-CGTC-TGTT 11108021-CGTC-TGTT ***
4493184-T-A 4625143-T-A ***
13514810-CC-GT 11359134-CC-GT ***
13517368-GACT-G 11361692-GACT-G ***
13562246-T-C 11406570-T-C ***
13398373-A-G 11242697-A-G ***
13492247-A-T 11336571-A-T ***
56867491-ATTTTTTTTT-A,ATT 11×T***
13251387-C-A 11095711-C-A ***
58823284-TCTCAT-A 56767582-ATGAGA-T ***
13641031-C-G 11485355-C-G ***
13465852-C-T 11310176-C-T ***
13262792-CGCC-TGCT 11107116-CGCC-TGCT ***
13519284-A-G 11363608-A-G ***
58828536-C-G 56762335-G-C ***
13519346-G-C 11363670-G-C ***
9952663-AG-CA 10115054-AG-CA ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Mutation Notes:

Kit POSITION-REF-ALT (hg19) POSITION-REF-ALT (hg38) Note
Manual19346433-C-CCTTTCTTTCTTT17234553-C-CCTTTCTTTCTTTChecked my BAM file on 20141117.
P9UH420040482-GGCAAGCAC-G17928602-GGCAAGCAC-GChecked my BAM file. It looks like half of my reads at this location have the deletion. This location is opposite to 20089217-TTGCTTGCG-T.
Manual20089217-TTGCTTGCG-T17977337-TTGCTTGCG-TChecked my BAM file. It looks like half of my reads at this location have the deletion. This location is opposite to 20040482-GGCAAGCAC-G.
Manual24899333-C-T22753186-C-TLooks like about half of the reads in the BAM file have the mutation.
Manual19973015-C-T17861135-C-TThere are 38C and 46T. This SNP is in P5. This is a ZZ SNP as there are no distinguishing positions anywhere near, at least +/- 400bp.
Manual22453058-C-A20291172-C-AChecked BAM file. I have 537 reads which cover this point. 150 of them are A, another 376 are C, 3 are G and 8 are T. Without looking at paired end reads, I can't see any way to figure out the true location.
Manual22260454-G-A20098568-G-AHundreds of reads. With a couple filters to remove some misaligned reads, I still have about 490 A and 678 G.
Manual6861230-T-TTTTC6993189-T-TTTTCI have checked my BAM file, and I have about a half dozen reads supporting the claim that this in an insertion of TTTC. Oddly, my report from FGC indicates a deletion. This INDEL corresponds to DYS570, so I know what my value should be. I removed the deletion mutation from my FGC data.
P9UH46861230-TTTTC-T6993189-TTTTC-TI removed this mutation from my data. It would appear that I have 6861230-T-TTTTC instead.
Manual16809474-G-GAGAT14697594-G-GAGATAbout 10 reads, 9 of them show the insertion.
Manual26121103-C-T23974956-C-T1A 36C 31T. The A read and one of the T reads is misaligned.
Manual24939079-C-T22792932-C-T67 C, 46 T.
Manual22285004-C-T20123118-C-TSome reads clearly belong elsewhere. Of the reads which fit here, 376 are C, 217 are T.
Manual16110097-A-T13998217-A-T35A 40T
Manual14981830-TTTCCTTCC-T12869906-T-.This is an STR. There are about 10 reads with the deletion and maybe one or two that have a slightly different count.
Manual17662167-GTAGATAGATAGA-G15550287-GTAGATAGATAGA-GThis is an STR. The hg19 reference sequence has 16 copies of TAGA. My FGC BAM file has 1 read with 14 copies, 17 reads with 13 copies and 3 reads with 12 copies.
Manual4847052-T-G4979011-T-G2T 3G
Manual22298978-G-T20137092-G-T946G 431T
Manual20551642-A-C18389756-A-C36A 18C
Manual19628136-T-G17516256-T-G37T 12G
Manual20007955-A-G17896075-A-G17A 20G
Manual6347814-G-GAGAA6479773-G-GAGAAAll 26 reads which cover the insertion are positive.
Manual26179746-AAAC-A24033599-AAAC-A115 reads cover the deletion. 61 do not show the deletion and 54 show the deletion.
Manual19739340-A-AAAC17627460-A-AAAC33 reads cover the insertion. 18 have the insertion and 15 do not.
Manual23761608-A-AAAG21599722-A-AAAGAbout 13 reads cover the insertion. 10 of them are positive, 3 are negative. Note that there is an A>C SNP near the end of this STR.
Manual19842176-CAATAAATAAATA-C17730296-CAATAAATAAATA-C72 reads derived for the deletion and 33 reads ancestral.
Manual19600395-GGT-G17488515-GGT-GSTR on P5. 1 read with 17 copies of GT, 23 reads with 16 copies of GT, 35 reads with 15 copies of GT, 14 reads with 14 copies of GT and one read with just 13 copies of GT.
Manual19675596-G-C17563716-G-C21C 23G
Manual19970773-A-G17858893-A-G27A 26G
Manual23311147-T-TTTTC21149261-T-TTTTCThis is an STR where the reference sequence has 15 copies of TTTC. Because of the short reads of my FGC test, it's difficult to align properly. About a dozen reads however to indicate I am positive for this insertion.
Manual6274770-G-A6406729-G-A73A 1C 82G
Manual9595600-C-T9757991-C-T1A 67C 65T
Manual20738728-G-T18576842-G-T57G 64T
Manual20905447-C-A18743561-C-A34C 60A
Manual10907035-A-C6C

Haplotype Progression

The data below reveals the progression of changes in the haplotype. The bottom row is the haplotype for this man and above him are the inferred ancestral haplotypes for various upstream blocks. These inferred haplotypes are very much a work in progress, and any suggested modifications are appreciated. I think we can use our vast collection of haplotype data to refine these haplotypes. Mutations made from each upstream block are shown in sequence. The cell color is determined by the block in which the mutation took place.

DYS393
DYS390
DYS19
DYS391
DYS385
DYS426
DYS388
DYS439
DYS389i
DYS392
DYS389ii
DYS458
DYS459
DYS455
DYS454
DYS447
DYS437
DYS448
DYS449
DYS464
DYS460
Y-GATA-H4
YCAII
DYS456
DYS607
DYS576
DYS570
CDY
DYS442
DYS438
DYS531
DYS578
DYF395S1
DYS590
DYS537
DYS641
DYS472
DYF406S1
DYS511
DYS425
DYS413
DYS557
DYS594
DYS436
DYS490
DYS534
DYS450
DYS444
DYS481
DYS520
DYS446
DYS617
DYS568
DYS487
DYS572
DYS640
DYS492
DYS565
DYS710
DYS485
DYS632
DYS495
DYS540
DYS714
DYS716
DYS717
DYS505
DYS556
DYS549
DYS589
DYS522
DYS494
DYS533
DYS636
DYS575
DYS638
DYS462
DYS452
DYS445
Y-GATA-A10
DYS463
DYS441
Y-GGAAT-1B07
DYS525
DYS712
DYS593
DYS650
DYS532
DYS715
DYS504
DYS513
DYS561
DYS552
DYS726
DYS635
DYS587
DYS643
DYS497
DYS510
DYS434
DYS461
DYS435
P312/S1161324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123315916122626191211131210912121011113012132413101020151913241712152412231810141791211
L21/S1451324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
DF21/S1921324141111-14121212131329179-1011112515192915-15-17-17111119-231615181836-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
S30581324141011-14121212131329179-1011112515192915-15-17-17111119-231615181836-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211121211912121011113012132413101020151913241712152412231810141791211
S4261324141011-14121212131329179-1011112515193015-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526191311121211912121011113012132413101020151913231712152412231810141791211
S1901324141011-14121212131329179-1011112515193013-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526201311121211912121011113012132413101020151913231712152412231810141791211
FGC32151324141011-14121212131329189-1011112515193013-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526201311121211912121011113012132413101020151913231712152412231810141791211
FGC31971324141011-14121212131329189-1011112515193013-15-17-17111019-231615181838-38121211915-1691010810101222-231610121215811222014121113111112123115915122526201311121211913121011113012132413101020151914231712152412231810141791211
FGC78541324141011-14121212131329189-1011112515193013-15-17-17111019-231615191838-38121211915-1691110810101222-231610121215811222014121113111112123115915122526201311121211913121011113012132413101020151914231712152412231810141791211
Williamson1324141011-14121212121328189-1011112515193013-15-17-17111019-231615191838-38121211915-1691110810101222-231610121215811232014121113111112123115915122526201311121211913121011113012132413101020151914231712152412231810141791211

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: P9UH4*16000000100000008300000
Kit: P9UH4-A*16000000100000008300000
Used in age calculations16000000100000008300000
Counts of SNPs112
Variant counts last updated 2020-02-01 03:05:21.

* BED data not available. Using default values.


Big Tree Main Page