Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > ZZ10 > Z253 > Z2534 > ZZ5 > Z2185 > BY44331 > Z2186 > L1066

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
B15548
BigY2
B15548
19903369-A-G 17791489-A-G P5_Prx ***A*
28817483-A-C 26671336-A-C A*
19728331-A-AT 17616451-A-AT P5_Prx 10×TA*
20636349-T-G 18474463-T-G P4_Prx ***A*
19618119-G-C 17506239-G-C P5_Prx YA*
22486958-G-A 20325072-G-A BY50872 DYZ19 +
14205549-G-A 12084843-G-A ZS3180 YY++
16173052-G-C 14061172-G-C BY105726 Y++
15990008-A-G 13878128-A-G BY35006 YY++
15907139-G-C 13795259-G-C BY50781 YY++
15028416-G-T 12916504-G-T BY99227 YY++
14578302-G-T 12466502-G-T BY96558 YY++
9881080-G-C 10043471-G-C BY81733 YY++
9987233-G-A 10149624-G-A BY82529 Y++
17985502-G-T 15873622-G-T BY50804 Y++
9475155-G-A 9637546-G-A BY35004 ++
8685626-T-C 8817585-T-C BY75190 YY++
8644806-A-T 8776765-A-T BY74884 YY++
7601809-G-C 7733768-G-C BY50710 YY++
7434667-C-G 7566626-C-G BY50707 Y++
16420359-C-T 14308479-C-T BY47162 YY++
17985503-T-C 15873623-T-C BY50805 Y++
23552353-TG-T 21390467-TG-T ++
19321494-G-A 17209614-G-A BY128251 YY++
7250911-A-G 7382870-A-G BY64195 YY++
21784370-C-G 19622484-C-G BY35010 YY++
21930494-C-G 19768608-C-G BY50847 YY++
22074248-G-T 19912362-G-T BY50849 YY++
22487189-A-C 20325303-A-C DYZ19 ++
22569188-TAGAA-T 20407302-TAGAA-T ++
22825456-A-G 20663570-A-G BY35012 YY++
23380156-TTTTA-T 21218270-TTTTA-T 4×TTTA+**
24372677-A-G 22226530-A-G BY149428 ++
24453727-C-T 22307580-C-T BY150055 Y++
19812764-T-C 17700884-T-C BY35013 P5_Prx +
18740863-AATATATATATAATATATATAGTAGTGTATATATATACACTACT-A 16628983-AATATATATATAATATATATAGTAGTGTATATATATACACTACT-A ++
21661512-GTTTC-G 19499626-GTTTC-G ++
7328061-TG-T 7460020-TG-T ++
13328-G-A +
3965552-C-G 4097511-C-G BY57928 **+
13695154-G-C 11539478-G-C *
22429353-C-T 20267467-C-T DYZ19 ****
22299485-G-A 20137599-G-A DYZ19 ****
9654352-TAGAAAGAA-T 9816743-TAGAAAGAA-T IR3_Prx 10×AGAA****
26092063-T-C 23945916-T-C P1_Y1 ****
17239290-TTATATA-T 15127410-TTATATA-T 17×TA*
13201596-A-C 11045920-A-C **
16028476-C-A 13916596-C-A **
13855301-G-T 11734595-G-T **
13198073-T-G 11042397-T-G **
13855320-T-A 11734614-T-A **
13855321-GGCAT-G 11734615-GGCAT-G **
13855329-ATG-A 11734623-ATG-A **
13855334-A-G 11734628-A-G **
11677286-C-A **
13946286-C-A 11825580-C-A **
15912103-A-C 13800223-A-C **
15680187-C-A 13568307-C-A **
15671267-A-G 13559387-A-G **
15671151-GTTTTT-G 13559271-GTTTTT-G 13×T**
13947355-C-A 11826649-C-A **
13811076-A-ATGCAT 11690370-A-ATGCAT **
13201584-G-A 11045908-G-A **
13206473-C-A 11050797-C-A **
13476066-G-T 11320390-G-T **
13228954-G-A 11073278-G-A **
13296574-C-T 11140898-C-T **
16052244-A-G 13940364-A-G **
13309541-C-A 11153865-C-A **
13461434-T-TCAG 11305758-T-TCAG **
16050345-C-A 13938465-C-A **
13479692-C-T 11324016-C-T **
11663488-AT-A **
13496299-G-T 11340623-G-T **
13643549-C-T 11487873-C-T **
13643572-T-C 11487896-T-C **
13201591-A-C 11045915-A-C **
13970874-C-A 11850168-C-A **
11653664-A-C **
11653661-A-G **
13973964-C-A 11853258-C-A **
15541980-C-A 13430100-C-A **
14766643-C-A 12654712-C-A **
15045580-C-A 12933670-C-A **
15034675-C-A 12922763-C-A **
14934440-C-A 12822505-C-A **
14887905-G-A 12775971-G-A **
14879864-TACCATCTGGGTTCAAGTGATTCTCCTGC-T 12767934-TACCATCTGGGTTCAAGTGATTCTCCTGC-T **
14797304-G-T 12685375-G-T **
14721575-CA-C 12609643-CA-C **
14368582-C-A 12247878-C-A **
14567141-C-A 12455341-C-A **
14562385-T-C 12450585-T-C **
14559966-C-T 12448167-C-T **
14501138-CT-C 12389343-CT-C **
14430266-T-C 12309539-T-C **
14427204-C-A 12306479-C-A **
14423845-G-T 12303120-G-T **
15080797-C-A 12968887-C-A **
11021972-G-T **
15431873-C-A 13319993-C-A **
14047891-C-A 11927185-C-A **
14383704-T-C 12263000-T-C **
14022923-C-A 11902217-C-A **
15420270-G-T 13308390-G-T **
15396789-C-A 13284909-C-A **
15270929-G-T 13159018-G-T **
15126880-C-A 13014967-C-A **
14067267-A-C 11946561-A-C **
15081131-A-G 12969221-A-G **
14227683-A-G 12106977-A-G **
14299803-G-A 12179097-G-A **
14299804-C-A 12179098-C-A **
14348077-C-A 12227372-C-A **
14352742-C-A 12232037-C-A **
15111458-C-A 12999545-C-A **
15106830-C-A 12994917-C-A **
11022033-C-A **
10686500-C-A **
11013209-A-G **
9737871-A-AGACAG 9900262-A-AGACAG IR3_Prx **
9123416-A-G **
9126683-G-T **
8968278-C-A 9130669-C-A **
9588028-G-GTGTT 9750419-G-GTGTT IR3_Prx **
9702967-G-GAA 9865358-G-GAA IR3_Prx 11×A**
9735693-T-A 9898084-T-A IR3_Prx **
9767447-C-A 9929838-C-A **
8661757-C-A 8793716-C-A **
9852697-T-C 10015088-T-C **
9908677-T-A 10071068-T-A **
9908683-T-C 10071074-T-C **
9908685-C-G 10071076-C-G F18036 **
9908689-C-A 10071080-C-A **
9908691-A-T 10071082-A-T **
9908700-A-C 10071091-A-C **
9057263-GGAATGTCTTCACATCTATTCACA-G **
8290950-C-T 8422909-C-T **
10019754-AT-A 10182145-AT-A **
7200707-T-C 7332666-T-C **
6878823-A-G 7010782-A-G **
6929577-C-A 7061536-C-A **
6977587-T-C 7109546-T-C **
7038389-C-A 7170348-C-A **
7135319-C-T 7267278-C-T **
7158023-C-A 7289982-C-A **
7184829-C-A 7316788-C-A **
7229025-C-A 7360984-C-A **
8135731-C-A 8267690-C-A **
7237874-A-G 7369833-A-G **
7255051-T-C 7387010-T-C **
7255422-C-A 7387381-C-A **
7462665-C-A 7594624-C-A IR1_L **
7656858-AC-A 7788817-AC-A **
7869185-A-G 8001144-A-G **
7996088-A-C 8128047-A-C **
10009411-C-A 10171802-C-A **
10026254-T-C 10188645-T-C **
10984059-A-G **
10856090-C-A **
10777042-C-A **
10777447-TC-T **
10785593-T-C **
10795865-C-G **
10801796-C-A **
10807344-C-G **
10849246-C-A FGC80240 **
10878169-CCACTCTATTCCACTCCACTCTATTCCACTCG-C **
10763133-T-A **
10880436-C-A **
10888003-A-T **
10898476-T-C **
10924386-C-A **
10926783-C-CGTCT **
10944662-T-C **
10968338-G-A **
10774382-C-A **
10686500-CCACG-C **
10026728-C-A 10189119-C-A **
10624065-A-G **
10050775-A-G 10213166-A-G **
10624019-A-T **
10624028-T-G **
10624032-T-A **
10624035-C-T **
10624045-T-A **
10624059-C-A **
10624080-AT-A **
16228085-G-T 14116205-G-T **
10624091-C-T **
10652179-T-C **
10652184-T-G **
10652187-T-A **
10653698-C-A **
10686481-A-C **
10686486-C-A **
16116373-A-AG 14004493-A-AG P8_Prx **
17220002-T-A 15108122-T-A **
16233442-A-C 14121562-A-C **
22613964-T-A 20452078-T-A **
22252090-G-T 20090204-G-T DYZ19 **
22277852-A-T 20115966-A-T DYZ19 **
22486965-G-A 20325079-G-A DYZ19 **
22486970-T-A 20325084-T-A DYZ19 **
22486974-T-G 20325088-T-G DYZ19 **
22551280-T-G 20389394-T-G **
22732782-C-A 20570896-C-A **
22211317-A-T 20049431-A-T **
22757572-G-A 20595686-G-A **
22757582-C-A 20595696-C-A **
22901883-G-A 20739997-G-A **
22986284-C-A 20824398-C-A **
23005346-C-A 20843460-C-A **
23033561-C-A 20871675-C-A **
23290754-T-A 21128868-T-A **
22228096-C-T 20066210-C-T DYZ19 **
22088800-A-G 19926914-A-G **
23373169-C-A 21211283-C-A **
21244188-G-T 19082302-G-T **
21009210-A-ATT 18847324-A-ATT P4_Dst **
21022710-T-TTCTG 18860824-T-TTCTG P4_Dst **
21106902-CA-C 18945016-CA-C **
21111713-C-T 18949827-C-T **
21122956-A-C 18961070-A-C **
21149199-C-A 18987313-C-A **
21262679-A-T 19100793-A-T **
22088799-C-T 19926913-C-T **
21367600-C-A 19205714-C-A **
21408895-C-A 19247009-C-A **
21540941-GTGCCA-G 19379055-GTGCCA-G **
21671768-C-A 19509882-C-A **
21823228-C-A 19661342-C-A **
22011587-C-T 19849701-C-T **
22084864-C-A 19922978-C-A **
23299715-A-T 21137829-A-T **
23742520-C-A 21580634-C-A **
20682223-T-TGAACC 18520337-T-TGAACC P4_Prx **
28720281-AG-A 26574134-AG-A **
28429911-C-A 26283764-C-A P1_gr2 **
28460795-T-A 26314648-T-A **
28570482-T-C 26424335-T-C **
28606074-G-A 26459927-G-A **
28688289-C-A 26542142-C-A **
28720272-T-C 26574125-T-C **
28721378-G-T 26575231-G-T **
28111552-C-A 25965405-C-A P1_Y2 **
28772221-T-C 26626074-T-C **
28774388-C-A 26628241-C-A **
28777857-C-T 26631710-C-T **
56823242-G-T **
56832894-A-AACAG **
56836804-C-A **
56848189-GGTC-G **
28229035-T-A 26082888-T-A P1_b4 **
28003062-A-AACAG 25856915-A-AACAG P1_Y2 **
23779643-C-T 21617757-C-T **
25524729-G-C 23378582-G-C P1_gr1 **
23802047-C-A 21640161-C-A **
23884141-A-AACAGG 21722255-A-AACAGG **
21781288-A-AAGACAG **
24250893-C-CACAG 22104746-C-CACAG P3_b1 **
24283987-A-AGACAG 22137840-A-AGACAG P3_t1 **
24405910-G-T 22259763-G-T **
24870544-T-TTCTG 22724397-T-TTCTG P3_b2 **
26055714-T-G 23909567-T-G P1_Y1 **
27943893-T-TTCTG 25797746-T-TTCTG P1_Y2 **
26095089-ATCAGGTTTTTTAGTATGCTTATTATAATG-A 23948942-ATCAGGTTTTTTAGTATGCTTATTATAATG-A P1_Y1 **
26095345-A-AGTCT 23949198-A-AGTCT P1_Y1 **
26140302-T-TC 23994155-T-TC P1_Y1 **
26188197-A-AGACAG 24042050-A-AGACAG P1_Y1 **
26355413-T-C 24209266-T-C P1_Y1 **
27497075-T-C 25350928-T-C P1_Y2 **
27837813-C-CTCCCTG 25691666-C-CTCCCTG P1_Y2 5×TCCT**
20902318-G-A 18740432-G-A P4_Dst **
20613164-A-ACAG 18451278-A-ACAG P4_Prx **
16412477-C-A 14300597-C-A Y27630 Z42044 **
17551535-T-A 15439655-T-A **
17183254-C-G 15071374-C-G **
6807055-A-G 6939014-A-G **
17270793-CTGCACCCACTGTCT-C 15158913-CTGCACCCACTGTCT-C **
17285188-CA-C 15173308-CA-C **
17462024-C-A 15350144-C-A **
17551530-G-A 15439650-G-A Y53403 **
17622662-T-C 15510782-T-C **
17130266-C-T 15018386-C-T **
17718467-C-A 15606587-C-A **
17804487-G-A 15692607-G-A Y136272 **
17859197-T-C 15747317-T-C **
17947054-T-C 15835174-T-C **
18009654-G-GCTGTC 15897774-G-GCTGTC P7_Dst **
18035975-C-A 15924095-C-A **
18085532-C-T 15973652-C-T **
17177248-A-G 15065368-A-G **
17097734-G-A 14985854-G-A **
18190862-T-C 16078982-T-C **
16676614-C-A 14564734-C-A **
16418544-C-A 14306664-C-A **
16471649-TAGGATTTGGGTAGGTAATGAAAAATTAC-T 14359769-TAGGATTTGGGTAGGTAATGAAAAATTAC-T **
16480060-C-A 14368180-C-A **
16522343-C-A 14410463-C-A **
16562708-G-A 14450828-G-A **
16607511-G-A 14495631-G-A **
16677373-C-A 14565493-C-A **
17092622-T-C 14980742-T-C **
16816675-CT-C 14704795-CT-C **
16876839-C-A 14764959-C-A **
16926238-C-T 14814358-C-T **
16971385-A-C 14859505-A-C **
16988824-C-A 14876944-C-A **
17029035-A-G 14917155-A-G **
17065009-G-T 14953129-G-T **
18127674-T-C 16015794-T-C **
18194403-T-C 16082523-T-C **
20533211-T-C 18371325-T-C P5_Dst **
19895334-T-TATTTA 17783454-T-TATTTA P5_Prx **
19403932-C-A 17292052-C-A **
19418380-C-A 17306500-C-A **
19435761-A-G 17323881-A-G **
19465664-A-G 17353784-A-G **
19622137-C-T 17510257-C-T P5_Prx **
19747805-TCTTTTTTAG-T 17635925-TCTTTTTTAG-T P5_Prx **
20089188-C-CTCCTG 17977308-C-CTCCTG P5_Dst **
19346752-A-G 17234872-A-G **
20089235-G-A 17977355-G-A P5_Dst **
20101167-TTATC-T 17989287-TTATC-T P5_Dst **
20323694-G-GCT 18161808-G-GCT P5_Dst **
20485072-T-TCTGTC 18323186-T-TCTGTC P5_Dst **
20512014-A-AAT 18350128-A-AAT P5_Dst **
20512021-G-A 18350135-G-A P5_Dst **
20512023-T-TC 18350137-T-TC P5_Dst **
19390088-C-A 17278208-C-A **
19346751-C-T 17234871-C-T **
18226820-A-G 16114940-A-G **
18754872-A-G 16642992-A-G **
18319612-A-G 16207732-A-G P6_Prx **
18319642-A-ATCTG 16207762-A-ATCTG P6_Prx **
18487913-A-AGACAG 16376033-A-AGACAG P6_Dst **
18488003-C-A 16376123-C-A P6_Dst **
18565048-C-A 16453168-C-A **
18611791-GCAGAAGT-G 16499911-GCAGAAGT-G **
18687490-T-C 16575610-T-C **
18879928-C-A 16768048-C-A **
19346743-A-T 17234863-A-T **
18926845-C-T 16814965-C-T FGC999 **
19061306-G-A 16949426-G-A **
19065404-G-T 16953524-G-T **
19071301-G-C 16959421-G-C **
19129133-C-A 17017253-C-A **
19184548-C-T 17072668-C-T **
19318352-TG-T 17206472-TG-T **
6808040-C-A 6939999-C-A **
15324347-A-T 13212465-A-T **
6630599-G-T 6762558-G-T **
10825206-AC-T **
18266210-TAA-T 16154330-TAA-T 11×A**
7028025-C-A 7159984-C-A **
16424478-G-T 14312598-G-T **
9965501-G-T 10127892-G-T **
2697389-C-A 2829348-C-A **
19535707-C-A 17423827-C-A **
14387718-C-A 12267014-C-A **
10934732-A-T **
10934731-T-C **
2845817-G-T 2977776-G-T **
11031676-C-A **
27971720-G-A 25825573-G-A P1_Y2 **
4788353-C-A 4920312-C-A **
21974868-C-A 19812982-C-A **
10825192-T-G **
15533725-C-A 13421845-C-A **
10974035-T-A **
10974034-T-A **
10974013-A-C **
10973992-C-A **
10973991-C-A **
10973964-A-T **
15430346-C-A 13318466-C-A **
17128535-CTTTT-C 15016655-CTTTT-C 25×T**
24553401-C-A 22407254-C-A P3_t2 **
23438262-T-A 21276376-T-A **
17871802-C-A 15759922-C-A **
22166578-G-T 20004692-G-T **
10992682-C-A **
16941737-C-A 14829857-C-A **
9971726-G-T 10134117-G-T **
24389942-G-C 22243795-G-C **
4389588-C-T 4521547-C-T **
16038117-C-A 13926237-C-A **
8766405-C-A 8898364-C-A **
3573348-G-T 3705307-G-T **
21148588-TCAAAA-T 18986702-TCAAAA-T **
6454068-T-G 6586027-T-G **
14402036-CA-C 12281333-CA-C 8×A**
14356472-C-A 12235767-C-A **
10849712-C-A **
8214947-C-A 8346906-C-A **
22962093-C-A 20800207-C-A **
2948214-C-A 3080173-C-A **
14383792-G-T 12263088-G-T **
10023481-C-A 10185872-C-A **
10776172-C-T **
10686498-T-A **
28480318-C-A 26334171-C-A **
14372014-T-C 12251310-T-C **
14567146-C-A 12455346-C-A **
16424327-G-T 14312447-G-T **
24389894-CTT-C 22243747-CTT-C 26×T**
22951169-C-A 20789283-C-A **
18262526-C-A 16150646-C-A **
23316118-C-A 21154232-C-A Y128960 **
16058797-C-A 13946917-C-A **
13705500-G-C 11549824-G-C **
23997529-C-A 21851382-C-A **
6475346-C-A 6607305-C-A **
6467676-G-T 6599635-G-T **
13209552-C-A 11053876-C-A **
9446171-C-A 9608562-C-A **
14413072-G-A 12292369-G-A **
10764553-TCCA-T **
10764550-CA-C **
10887996-C-G **
6461477-C-A 6593436-C-A **
4049753-C-A 4181712-C-A **
10935579-C-CTGCCA **
15324352-TA-T 13212470-TA-T **
10879046-C-A **
16860748-GCA-G 14748868-GCA-G **
24405854-C-A 22259707-C-A **
15918564-C-A 13806684-C-A **
14887925-AT-A 12775991-AT-A 10×T**
10750998-C-A **
17802162-TCAG-T 15690282-TCAG-T **
20888603-AG-A 18726717-AG-A P4_Dst **
5977005-C-A 6108964-C-A **
11655808-T-TTGGAA **
10821876-C-T **
22486969-T-G 20325083-T-G BY224866 DYZ19 **
24509266-C-A 22363119-C-A **
13855300-G-T 11734594-G-T **
13488835-C-A 11333159-C-A **
22321560-G-A 20159674-G-A DYZ19 ****
16692757-G-GA 14580877-G-GA 27×A**
23311204-TTTCC-T 21149318-TTTCC-T 11×TTCC**
22166584-G-T 20004698-G-T **
15862522-C-A 13750642-C-A **
15912133-C-A 13800253-C-A **
17081219-C-CTA 14969339-C-CTA 14×TA**
9927601-G-A 10089992-G-A Y17183 **
3195408-C-A 3327367-C-A **
19319834-GTATATA-G 17207954-GTATATA-G 23×TA**
19462180-T-C 17350300-T-C CTS10451 FGC40 ****
58978993-G-T 56832846-G-T **
13488831-C-G 11333155-C-G **
19346738-A-G 17234858-A-G **
13811071-A-ATGAAT 11690365-A-ATGAAT **
5186324-G-T 5318283-G-T **
17065137-G-A 14953257-G-A **
6816749-C-A 6948708-C-A **
14546502-C-A 12434703-C-A **
10751023-C-CGGGTT **
11004944-C-A **
21515837-T-G 19353951-T-G **
2772494-C-A 2904453-C-A **
13705484-T-G 11549808-T-G **
10624429-A-G **
10624427-G-T **
10934728-T-C **
23439929-A-T 21278043-A-T **
13489015-C-A 11333339-C-A **
26415749-G-GTT 24269602-G-GTT P1_Y1 14×T**
10946816-C-A **
7397551-C-A 7529510-C-A **
16462441-C-A 14350561-C-A **
18370849-T-TG 16258969-T-TG P6_Prx **
20798749-GAAAA-G 18636863-GAAAA-G P4_Prx 13×A**
19746884-TG-T 17635004-TG-T P5_Prx **
16484314-C-A 14372434-C-A **
26231028-G-GTGCGTATC 24084881-G-GTGCGTATC P1_Y1 **
10934769-T-A **
7103416-C-A 7235375-C-A **
10807277-A-T **
13576115-C-T 11420439-C-T **
10849763-C-A **
10849723-T-C **
21394796-C-A 19232910-C-A **
19129582-C-A 17017702-C-A **
8644323-GCA-G 8776282-GCA-G **
10859082-T-C **
20330486-G-T 18168600-G-T P5_Dst **
3008386-T-C 3140345-T-C **
3997059-C-A 4129018-C-A **
3996996-C-A 4128955-C-A **
3890853-G-T 4022812-G-T **
3877030-C-T 4008989-C-T **
3629828-C-T 3761787-C-T **
3604234-G-T 3736193-G-T **
3599693-C-A 3731652-C-A **
3569601-A-T 3701560-A-T **
3545810-G-T 3677769-G-T **
3349043-G-T 3481002-G-T **
3279390-C-A 3411349-C-A **
3152118-C-A 3284077-C-A **
2984613-C-A 3116572-C-A **
4310167-G-T 4442126-G-T **
2895159-A-T 3027118-A-T **
2895155-T-C 3027114-T-C **
2785310-C-A 2917269-C-A **
2706669-CAA-C 2838628-CAA-C **
17446888-C-T 15335008-C-T **
3328888-C-A 3460847-C-A **
13474781-C-A 11319105-C-A **
56841575-C-A **
9030328-GA-G 9192719-GA-G **
10821900-T-A **
23199780-C-A 21037894-C-A **
2895150-C-T 3027109-C-T **
10683693-T-C **
4310118-A-AT 4442077-A-AT 9×T**
4403094-C-A 4535053-C-A **
16070162-C-A 13958282-C-A **
5865803-G-T 5997762-G-T **
6401744-C-T 6533703-C-T BY60187 **
6268618-T-TTCTG 6400577-T-TTCTG IR3_Dst **
6090919-C-A 6222878-C-A **
6048847-C-A 6180806-C-A **
5976328-C-A 6108287-C-A **
5973181-G-A 6105140-G-A **
5973180-T-C 6105139-T-C **
5973174-T-C 6105133-T-C **
5965652-G-A 6097611-G-A **
5940325-C-A 6072284-C-A **
5895318-A-G 6027277-A-G **
5873657-T-C 6005616-T-C **
5866104-G-T 5998063-G-T **
5829844-C-A 5961803-C-A **
4403098-C-A 4535057-C-A **
5817973-GAGTGAAAAAGGAATAATAAAAATAGTT-G 5949932-GAGTGAAAAAGGAATAATAAAAATAGTT-G **
5607789-C-A 5739748-C-A **
5566776-C-A 5698735-C-A **
5435190-C-T 5567149-C-T **
5412103-C-A 5544062-C-A **
5241138-T-C 5373097-T-C **
5061227-A-T 5193186-A-T **
4768624-A-G 4900583-A-G **
4766655-G-T 4898614-G-T **
4687459-C-A 4819418-C-A **
4585560-A-G 4717519-A-G **
4558797-G-T 4690756-G-T **
4444890-G-A 4576849-G-A **
10685845-G-T **
3500573-G-A 3632532-G-A **
6063436-G-GGTCT 6195395-G-GGTCT **
28521111-C-A 26374964-C-A **
19512135-C-A 17400255-C-A **
8981589-A-C 9143980-A-C **
13201998-C-A 11046322-C-A **
10661346-C-A **
17158607-C-A 15046727-C-A **
10671137-C-A **
14350212-T-C 12229507-T-C **
28745804-G-T 26599657-G-T **
14484360-C-A 12363629-C-A **
11676409-T-A **
3876985-C-A 4008944-C-A **
6776106-C-A 6908065-C-A **
10694055-C-A **
4672515-C-A 4804474-C-A **
16342387-AAAAG-A 14230507-AAAAG-A 4×AAAG**
20440391-G-GTTT 18278505-G-GTTT P5_Dst **
6645471-C-A 6777430-C-A **
15201467-C-A 13089553-C-A **
22166564-TG-T 20004678-TG-T **
15012552-G-A 12900640-G-A **
13259054-C-A 11103378-C-A **
7185439-C-A 7317398-C-A **
2730122-T-C 2862081-T-C **
19187416-AC-T 17075536-AC-T **
14227671-G-A 12106965-G-A **
2895142-C-T 3027101-C-T **
14099779-G-A 11979073-G-A **
17479975-C-A 15368095-C-A **
20769443-A-ATGTC 18607557-A-ATGTC P4_Prx **
15374505-C-A 13262625-C-A **
10669656-C-A **
10969818-C-A **
10878949-C-A **
21748245-C-A 19586359-C-A **
22222179-T-G 20060293-T-G DYZ19 ***
6996505-C-A 7128464-C-A ***
27637198-T-TCA 25491051-T-TCA P1_Y2 17×CA******
17680077-CTTTT-C 15568197-CTTTT-C 17×T***
6012793-C-T 6144752-C-T ***
15057194-C-A 12945286-C-A ***
58977540-C-G 56831393-C-G ***
19646567-A-G 17534687-A-G P5_Prx ***
22312049-T-C 20150163-T-C DYZ19 ***
22247690-A-G 20085804-A-G DYZ19 ***
22247691-G-A 20085805-G-A DYZ19 ***
22317524-GA-G 20155638-GA-G DYZ19 ***
22487029-C-A,G 20325143-C-A,G DYZ19 ***
23006999-A-T 20845113-A-T ***
24168032-T-G 22021885-T-G P3_b1 ***
24212598-C-G 22066451-C-G P3_b1 ***
25146563-C-A 23000416-C-A g1 ***
26574803-G-A 24428656-G-A P1_g2 ***
58980384-C-G 56834237-C-G ***
13801034-T-C,G 11680328-T-C,G ***
14180704-C-A 12059998-C-A ***
6925090-C-A 7057049-C-A ***
22257342-T-TG 20095456-T-TG DYZ19 ***
22317605-T-G 20155719-T-G BY25069 DYZ19 ***
56848686-C-A ***
22345494-G-C 20183608-G-C DYZ19 ***
27967355-TAG-T,TAT 25821208-TAG-T,TAT P1_Y2 14×AG***
22305374-T-C 20143488-T-C DYZ19 ***
22279295-A-G 20117409-A-G A4020 DYZ19 ***
22278052-T-C 20116166-T-C FGC27631 DYZ19 ***
28815140-A-G 26668993-A-G ***
22224697-C-A 20062811-C-A DYZ19 ***
22224702-A-G 20062816-A-G DYZ19 ***
22282237-A-C 20120351-A-C DYZ19 ***
22284169-T-C 20122283-T-C DYZ19 ***
22422606-C-A 20260720-C-A DYZ19 ***
17951299-ATTTTTTTT-A,ATTTT 15839419-ATTTTTTTT-A,ATTTT 25×T***
13474405-A-C 11318729-A-C ***
22317560-TA-T 20155674-TA-T DYZ19 ***
13489766-A-C,T 11334090-A-C,T ***
22309582-G-A 20147696-G-A DYZ19 ***
22265789-T-C 20103903-T-C DYZ19 ***
22278209-G-C 20116323-G-C DYZ19 ***
22278231-G-T 20116345-G-T DYZ19 ***
22281379-T-C 20119493-T-C DYZ19 ***
22281397-T-C 20119511-T-C FGC22017 DYZ19 ***
22265835-G-T 20103949-G-T DYZ19 ***
6428562-C-G 6560521-C-G ***
13448839-C-T 11293163-C-T ***
56828910-A-ATTCCT ***
7285498-A-T 7417457-A-T ***
22486991-T-C 20325105-T-C DYZ19 ***
13291091-C-A 11135415-C-A ***
21456015-C-A 19294129-C-A ***
9875224-C-A 10037615-C-A ***
13489069-A-C,G 11333393-A-C,G ***
10761817-T-A ***
15542658-CAA-C,CA 13430778-CAA-C,CA 16×A***
19508342-C-A 17396462-C-A ***
10754936-C-CCATTT ***
14354578-C-A 12233873-C-A ***
3620708-G-T 3752667-G-T ***
18567876-C-A 16455996-C-A ***
56734829-G-A ***
10691028-C-A ***
10956544-C-A ***
10971295-C-A ***
3536145-AT-A 3668104-AT-A ***
22170398-G-T 20008512-G-T ***
14418109-C-A 12297406-C-A ***
10987824-CAT-C ***
13688223-CATGGAATGGAATGCA-C 11532547-CATGGAATGGAATGCA-C ***
2730134-A-C 2862093-A-C ***
18838721-T-A 16726841-T-A ***
17637638-AACACAC-A,AACAC 15525758-AACACAC-A,AACAC 21×AC***
10804784-C-G ***
10804791-A-G ***
28745817-A-G 26599670-A-G ***
19464135-G-T 17352255-G-T ***
17951443-ATCTCTC-A,ATC 15839563-ATCTCTC-A,ATC 12×TC***
21912160-C-A 19750274-C-A ***
16692115-ACC-A,AC 14580235-ACC-A,AC ***
18019832-CTTTTTTTT-C 15907952-CTTTTTTTT-C 22×T***
10757346-C-A,T ***
10805588-G-T ***
56834676-G-T ***
16514304-ATG-A,ATGTG 14402424-ATG-A,ATGTG 18×TG***
10956549-C-T ***
5621217-C-A 5753176-C-A ***
13447896-CGTTCAATTCCATTCCATTTA-C,CATTCCATTCCATTCCATTCC 11292220-CGTTCAATTCCATTCCATTTA-C,CATTCCATTCCATTCCATTCC ***
8806526-C-A 8938485-C-A ***
21950211-A-G 19788325-A-G ***
5609458-C-A 5741417-C-A ***
28745795-G-A 26599648-G-A ***
10911833-C-T ***
10759950-C-A ***
2825206-GTT-G 2957165-GTT-G 12×T***
22962455-G-T 20800569-G-T ***
10992782-C-A ***
11017796-C-A ***
10669490-A-T ***
11659200-C-A ***
15439991-C-A 13328111-C-A ***
9875236-A-G 10037627-A-G ***
8401083-CAA-C,CA 8533042-CAA-C,CA 14×A***
10899925-G-T ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Haplotype Progression

The data below reveals the progression of changes in the haplotype. The bottom row is the haplotype for this man and above him are the inferred ancestral haplotypes for various upstream blocks. These inferred haplotypes are very much a work in progress, and any suggested modifications are appreciated. I think we can use our vast collection of haplotype data to refine these haplotypes. Mutations made from each upstream block are shown in sequence. The cell color is determined by the block in which the mutation took place.

DYS393
DYS390
DYS19
DYS391
DYS385
DYS426
DYS388
DYS439
DYS389i
DYS392
DYS389ii
DYS458
DYS459
DYS455
DYS454
DYS447
DYS437
DYS448
DYS449
DYS464
DYS460
Y-GATA-H4
YCAII
DYS456
DYS607
DYS576
DYS570
CDY
DYS442
DYS438
DYS531
DYS578
DYF395S1
DYS590
DYS537
DYS641
DYS472
DYF406S1
DYS511
DYS425
DYS413
DYS557
DYS594
DYS436
DYS490
DYS534
DYS450
DYS444
DYS481
DYS520
DYS446
DYS617
DYS568
DYS487
DYS572
DYS640
DYS492
DYS565
DYS710
DYS485
DYS632
DYS495
DYS540
DYS714
DYS716
DYS717
DYS505
DYS556
DYS549
DYS589
DYS522
DYS494
DYS533
DYS636
DYS575
DYS638
DYS462
DYS452
DYS445
Y-GATA-A10
DYS463
DYS441
Y-GGAAT-1B07
DYS525
DYS712
DYS593
DYS650
DYS532
DYS715
DYS504
DYS513
DYS561
DYS552
DYS726
DYS635
DYS587
DYS643
DYS497
DYS510
DYS434
DYS461
DYS435
P312/S1161324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123315916122626191211131210912121011113012132413101020151913241712152412231810141791211
L21/S1451324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
Smith1324141011-14121212131329179-1011112515192915-15-15-17111119-231715181837-38111211915-1681010810101222-231610121214812222013121113111112123515916122526201211131210913121011113012132413101020151712241612152412231810141791211

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: B155481066138677094647781934
Kit: B15548964331278548547749951
Used in age calculations1066138678548547781934
Counts of SNPs2217
Variant counts last updated 2019-05-11 10:44:36.



Big Tree Main Page