Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > ZZ10 > Z253 > BY4086 > FGC17436 > Z17693 > A10980

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
174932
16478950-T-G 14367070-T-G BY23969 YY+
8502516-C-T 8634475-C-T BY23586 YY+
22470001-G-C 20308115-G-C BY24581 DYZ19 +
13834028-TATGGAATGGA-T 11713322-TATGGAATGGA-T 7×ATGGA+
22272110-G-C 20110224-G-C BY24413 DYZ19 +
22270174-G-A 20108288-G-A DYZ19 +
22133337-AAAAT-A 19971451-AAAAT-A +
22031459-T-C 19869573-T-C BY24355 YY+
21569331-G-T 19407445-G-T YY+
21231656-T-C 19069770-T-C YY+
7643541-AGGAAG-A 7775500-AGGAAG-A 16×GGAAG+
19439379-G-T 17327499-G-T BY24231 YY+
19078127-G-C 16966247-G-C BY24187 YY+
22792165-G-T 20630279-G-T BY24698 YY+
18953582-T-C 16841702-T-C BY24168 YY+
8021828-C-T 8153787-C-T BY23534 YY+
19024610-T-C 16912730-T-C BY24178 YY+
8844962-G-A 8976921-G-A YY+
16851240-T-C 14739360-T-C YY+
13973488-G-T 11852782-G-T BY23791 YY+
14981830-TTTCC-T 12869906-T-TTTCC 16×TTCC+
15561177-TC-T 13449297-TC-T +
9039043-T-C 9201434-T-C Y+
16791195-A-T 14679315-A-T BY23989 YY8×T+
16389030-G-A 14277150-G-A BY23962 YY+
17467209-T-C 15355329-T-C BY24056 YY+
9848396-G-A 10010787-G-A Z7662 YY+
18872866-T-C 16760986-T-C YY+
20927099-G-GTT 18765213-G-GTT P4_Dst 35×T**
17467039-T-C 15355159-T-C PR2501 **
13740622-G-A 11584946-G-A **
15424570-G-A 13312690-G-A PR5472 **
13856438-T-G 11735732-T-G **
13839860-GGAGCC-G 11719154-GGAGCC-G **
20927153-G-T 18765267-G-T P4_Dst **
13143909-G-C 10633395-G-C **
13740617-G-T 11584941-G-T **
13740616-A-T 11584940-A-T **
22492913-C-G 20331027-C-G DYZ19 **
22492917-C-A 20331031-C-A DYZ19 **
22490338-G-C 20328452-G-C DYZ19 **
3016261-T-C 3148220-T-C **
13600703-G-A 11445027-G-A **
7002594-G-C 7134553-G-C CTS764 **
10003365-C-G 10165756-C-G Z1750 **
13858125-T-G 11737419-T-G **
13568808-G-T 11413132-G-T **
7093334-G-C 7225293-G-C **
13612691-C-A 11457015-C-A **
13855392-C-G 11734686-C-G ***
13855387-T-G 11734681-T-G ***
13855386-T-G 11734680-T-G ***
13855381-T-G 11734675-T-G ***
13803188-G-A 11682482-G-A ***
13855379-G-A 11734673-G-A ***
13545130-T-G 11389454-T-G ***
13623911-CATAT-C 11468235-CATAT-C 10×AT***
13855376-A-G 11734670-A-G ***
13855366-A-G 11734660-A-G ***
13855236-A-G 11734530-A-G ***
13855207-A-G 11734501-A-G ***
13855077-T-G 11734371-T-G ***
13853722-G-A 11733016-G-A ***
13648879-A-G 11493203-A-G ***
13855411-C-G 11734705-C-G ***
13855421-A-G 11734715-A-G ***
13654418-A-C 11498742-A-C ***
13458838-T-C 11303162-T-C ***
13867002-A-G 11746296-A-G ***
13866698-T-A 11745992-T-A ***
13139534-T-A 10629020-T-A ***
13865711-A-C 11745005-A-C ***
13863593-G-T 11742887-G-T ***
13863362-TGTAAC-T 11742656-TGTAAC-T ***
13140440-T-C 10629926-T-C ***
13140580-C-T 10630066-C-T ***
13143307-C-T 10632793-C-T ***
13469068-A-G 11313392-A-G ***
13855446-C-G 11734740-C-G ***
13861175-A-G 11740469-A-G ***
13861165-A-G 11740459-A-G ***
13472276-A-C 11316600-A-C S14070 ***
13486129-G-A 11330453-G-A ***
13859319-T-G 11738613-T-G ***
13858642-G-A,C 11737936-G-A,C ***
13858589-G-A 11737883-G-A ***
13486132-T-C 11330456-T-C ***
13857383-A-C 11736677-A-C ***
13652888-T-G 11497212-T-G ***
13662118-C-G 11506442-C-G ***
13803218-G-A 11682512-G-A ***
13817645-C-G 11696939-C-G ***
13824939-G-C 11704233-G-C ***
13824917-T-C 11704211-T-C ***
13824869-A-G 11704163-A-G ***
13821079-GAATGC-G 11700373-GAATGC-G ***
13821011-G-A 11700305-G-A ***
13818690-A-G 11697984-A-G ***
13818092-C-G 11697386-C-G ***
13818087-A-T 11697381-A-T ***
13818077-C-G 11697371-C-G ***
13817643-A-C 11696937-A-C ***
13828026-GGGATTGAATCGTATA-G 11707320-GGGATTGAATCGTATA-G ***
13817532-C-CAAATG 11696826-C-CAAATG ***
13817530-G-C 11696824-G-C ***
13817525-A-G 11696819-A-G ***
13817507-A-G 11696801-A-G ***
13817502-A-G 11696796-A-G ***
13814566-T-G 11693860-T-G ***
13809923-C-G 11689217-C-G ***
13809837-T-A 11689131-T-A ***
13804448-A-C 11683742-A-C ***
13803185-C-T 11682479-C-T ***
13833544-C-G 11712838-C-G ***
13853706-T-A 11733000-T-A ***
13848411-C-T 11727705-C-T FGC42925 ***
13853705-G-T 11732999-G-T ***
13853646-C-T 11732940-C-T ***
13679946-G-T 11524270-G-T ***
13799199-T-C 11678493-T-C ***
13850626-A-G 11729920-A-G ***
13850620-A-G 11729914-A-G ***
13850608-C-A 11729902-C-A ***
13850585-AGAAAT-G 11729879-AGAAAT-G ***
13850186-C-G 11729480-C-G ***
13842143-G-A 11721437-G-A ***
13803178-G-A 11682472-G-A ***
13801392-T-C 11680686-T-C ***
13801418-G-A 11680712-G-A ***
13839848-A-G 11719142-A-G ***
13839633-T-C 11718927-T-C ***
13833591-A-G 11712885-A-G ***
13803154-AC-A 11682448-AC-A ***
13803156-T-C 11682450-T-C ***
13803157-C-T 11682451-C-T ***
13803163-G-A 11682457-G-A ***
13870005-C-A 11749299-C-A ***
13823315-T-A 11702609-T-A ***
13870029-C-A 11749323-C-A ***
28798928-C-T 26652781-C-T FGC68604 ***
58848239-G-C 56742632-C-G ***
58846063-G-GCATTC 56744796-C-CGGAAT ***
58833932-C-A 56756939-G-T ***
58819367-C-G 56771504-G-C ***
28801734-A-G 26655587-A-G ***
28800344-A-C 26654197-A-C ***
28799862-G-A 26653715-G-A ***
28799861-T-A 26653714-T-A FGC30504 ZS5309 ***
28799855-ATGGCG-A 26653708-ATGGCG-A ***
28798993-T-A 26652846-T-A ***
28788108-T-G 26641961-T-G ***
58876814-G-C 56714057-C-G ***
28788103-T-G 26641956-T-G ***
28788095-G-A 26641948-G-A ***
28788085-G-A 26641938-G-A ***
28787483-A-G 26641336-A-G ***
28784686-G-A 26638539-G-A ***
28784604-C-G 26638457-C-G ***
27873324-CT-C 25727177-CT-C P1_Y2 20×T***
27864383-CTT-C 25718236-CTT-C P1_Y2 22×T***
26991332-G-C 24845185-G-C P1_r4 ***
26748552-G-T 24602405-G-T P1_g2 ***
26509133-A-G 24362986-A-G P1_Y1 ***
58876794-C-G 56714077-G-C ***
58969436-C-A 56823289-C-A ***
26282900-TAC-T 24136753-TAC-T P1_Y1 20×AC***
13856412-A-C,G 11735706-A-C,G ***
14879536-CTGTG-C,CT 12767606-CTGTG-C,CT 16×TG***
13458075-GCATTC-C,G 11302399-GCATTC-C,G 9×CATTC***
13858590-CAAGTG-C,G 11737884-CAAGTG-C,G ***
13809913-A-G,T 11689207-A-G,T ***
13849187-A-AAATGG,G 11728481-A-AAATGG,G 10×AATGG***
58976242-G-C,T 56830095-G-C,T ***
9774385-T-TTC 9936776-T-TTC 5×TTTC***
58976811-G-C,T 56830664-G-C,T ***
13451191-T-C,TCCATTCTATTCCACTCCATTCCACTCCATTC 11295515-T-C,TCCATTCTATTCCACTCCATTCCACTCCATTC ***
13856266-G-A,T 11735560-G-A,T ***
13859792-T-A,C 11739086-T-A,C ***
58976117-C-T 56829970-C-T ***
58981087-T-C 56834940-T-C ***
58977403-C-T 56831256-C-T ***
58977398-G-C,T 56831251-G-C,T ***
58977383-A-T 56831236-A-T ***
58977378-C-T 56831231-C-T ***
58977218-C-A 56831071-C-A ***
58977130-G-A,GCTCTA 56830983-G-A,GCTCTA ***
58976840-C-T 56830693-C-T ***
58976387-T-C 56830240-T-C ***
58976382-T-C 56830235-T-C ***
58976341-T-A 56830194-T-A ***
26478108-A-AAAAGAAAGAAAG 24331961-A-AAAAGAAAGAAAG P1_Y1 19×AAAG***
26242866-A-G 24096719-A-G P1_Y1 ***
13870031-G-A 11749325-G-A ***
18165150-T-TA 16053270-T-TA 9×A***
19948181-C-CCCTCCTTTCTTT,CCCTTCTTTCTTT 17836301-C-CCCTCCTTTCTTT,CCCTTCTTTCTTT P5_Prx 21×CTTT***
19787820-G-GT 17675940-G-GT P5_Prx 11×T***
19036703-G-GTTT 16924823-G-GTTT 40×T***
18892336-C-G 16780456-C-G ***
18892315-T-A 16780435-T-A ***
18892205-AT-A 16780325-AT-A ***
18892198-C-T 16780318-C-T ***
18892196-A-T 16780316-A-T ***
18378959-CTT-C 16267079-CTT-C P6_Prx 28×T***
18374128-G-A 16262248-G-A P6_Prx ***
17319984-A-G 15208104-A-G ***
20104257-GA-G 17992377-GA-G P5_Dst ***
17319976-A-G 15208096-A-G ***
17319968-G-A 15208088-G-A ***
13139464-G-A 10628950-G-A ***
16408114-CCACA-C 14296234-CCACA-C 19×CA***
13870143-A-C 11749437-A-C ***
13870134-T-A 11749428-T-A ***
13870128-A-C 11749422-A-C ***
13870110-GA-G 11749404-GA-G ***
13870068-A-C 11749362-A-C ***
13870050-G-T 11749344-G-T ***
13870032-T-C 11749326-T-C ***
19985769-G-A 17873889-G-A P5_Prx ***
20231594-A-G 18069708-A-G P5_Dst 14×GGAG***
25345746-A-G 23199599-A-G P2_r1 ***
22421068-T-G 20259182-T-G DYZ19 ***
25333856-CT-C 23187709-CT-C P2_r1 32×T***
25200907-G-GAA 23054760-G-GAA g1 ***
25010078-C-A 22863931-C-A g1 ***
24799418-T-G 22653271-T-G P3_b2 ***
24121750-C-T 21975603-C-T P3_b1 ***
24106080-A-G 21959933-A-G P3_b1 ***
22505075-C-G 20343189-C-G DYZ19 ***
22503330-A-C 20341444-A-C DYZ19 ***
22461584-G-T 20299698-G-T DYZ19 ***
22438303-T-A 20276417-T-A DYZ19 ***
22421393-A-C 20259507-A-C DYZ19 ***
22421062-A-C 20259176-A-C DYZ19 ***
20697185-G-A 18535299-G-A P4_Prx ***
22358004-G-C 20196118-G-C DYZ19 ***
22337792-C-T 20175906-C-T DYZ19 ***
22334967-A-T 20173081-A-T DYZ19 ***
22305799-T-C 20143913-T-C DYZ19 ***
22303945-C-A 20142059-C-A BY25056 DYZ19 ***
22287503-A-G 20125617-A-G DYZ19 ***
22272319-A-G 20110433-A-G DYZ19 ***
22272276-T-G 20110390-T-G DYZ19 ***
22243098-G-C 20081212-G-C DYZ19 ***
22238310-C-A 20076424-C-A DYZ19 ***
22217410-A-T 20055524-A-T DYZ19 ***
13139501-T-A 10628987-T-A ***
13104782-T-C 10594268-T-C ***
13139460-T-A 10628946-T-A ***
13850638-C-A 11729932-C-A ***
28785586-G-T 26639439-G-T ***
22481632-G-A 20319746-G-A DYZ19 ***
22481631-A-T 20319745-A-T DYZ19 ***
22243099-T-A 20081213-T-A DYZ19 ***
18344529-TTG-T 16232649-TTG-T P6_Prx 13×TG***
13866891-A-C 11746185-A-C ***
13866878-T-C 11746172-T-C ***
13858439-A-G 11737733-A-G ***
13858139-T-A 11737433-T-A ***
13853733-G-A 11733027-G-A ***
13851476-A-G 11730770-A-G ***
13839921-C-G 11719215-C-G ***
28788038-T-G 26641891-T-G ***
13833152-G-A 11712446-G-A ***
13832550-A-G 11711844-A-G ***
13832471-C-A,G 11711765-C-A,G ***
13818637-C-G 11697931-C-G ***
13818145-C-A 11697439-C-A ***
13817517-C-G 11696811-C-G ***
13808834-C-G 11688128-C-G ***
13799430-G-A 11678724-G-A ***
13485753-G-T 11330077-G-T ***
13472294-T-C 11316618-T-C ***
13472262-G-A 11316586-G-A ***
28785590-T-A 26639443-T-A ***
28788080-G-A 26641933-G-A ***
13447737-T-C 11292061-T-C ***
13856708-A-G 11736002-A-G 5×AATGG***
13137984-G-T 10627470-G-T BY34487 ***
13137968-C-A 10627454-C-A ***
28787284-GAGTGGAGTGC-G 26641137-GAGTGGAGTGC-G ***
28800234-G-A 26654087-G-A ***
28799161-G-A 26653014-G-A ***
22435755-T-C 20273869-T-C DYZ19 ***
13870125-A-G 11749419-A-G ***
13838316-C-G 11717610-C-G ***
13838314-C-A 11717608-C-A ***
28801719-A-G 26655572-A-G ***
20631937-T-TAC 18470051-T-TAC P4_Prx 21×AC***
13855391-A-G 11734685-A-G ***
28799895-C-G 26653748-C-G 5×TGGAA***
13838703-T-A 11717997-T-A ***
13805055-T-C 11684349-T-C ***
13690804-A-T 11535128-A-T ***
28801724-C-A 26655577-C-A ***
58883940-C-T 56706931-G-A ***
13836437-A-T 11715731-A-T ***
58979255-C-T 56833108-C-T ***
58978329-G-C 56832182-G-C 4×CATTC***
58978289-T-C 56832142-T-C ***
58846098-A-C 56744773-T-G ***
28818236-C-G 26672089-C-G ***
28800229-G-A 26654082-G-A ***
13447766-C-T 11292090-C-T ***
13447731-C-A 11292055-C-A ***
13138275-G-C 10627761-G-C ***
10023676-C-T 10186067-C-T ***
13824952-A-T 11704246-A-T ***
13824930-T-A 11704224-T-A ***
13818132-A-G 11697426-A-G ***
13818091-A-T 11697385-A-T ***
13817348-T-G 11696642-T-G ***
13808585-T-G 11687879-T-G ***
13803228-C-G 11682522-C-G ***
13803212-G-A 11682506-G-A ***
13701442-TTCAA-T 11545766-TTCAA-T ***
13647990-T-G 11492314-T-G ***
13453978-C-A 11298302-C-A ***
9030408-A-AG 9192799-A-AG 17×GAAAG***
13836293-A-G 11715587-A-G ***
6265215-TAC-T 6397174-TAC-T IR3_Dst ***
25447269-GGTA-G 23301122-GGTA-G P2_r2 9×GTA***
13814012-T-G 11693306-T-G ***
58819378-C-G 56771493-G-C ***
13677674-C-G 11521998-C-G ***
26089061-CA-C 23942914-CA-C P1_Y1 20×A***
13450077-T-C 11294401-T-C ***
6298490-AAC-A 6430449-AAC-A IR3_Dst 10×AC***
28785759-A-G 26639612-A-G ***
22446107-C-CT 20284221-C-CT DYZ19 ***
13867282-C-G 11746576-C-G ***
13857561-G-T 11736855-G-T ***
13832645-C-A 11711939-C-A ***
13836299-T-G 11715593-T-G ***
13142048-C-T 10631534-C-T ***
13824962-A-T 11704256-A-T ***
13140485-T-C 10629971-T-C ***
13140430-T-C 10629916-T-C ***
13138729-C-T 10628215-C-T ***
13138314-C-T 10627800-C-T ***
13138253-G-C 10627739-G-C ***
13138230-G-C 10627716-G-C ***
13818096-A-T 11697390-A-T ***
13447209-C-T 11291533-C-T ***
10008590-T-C 10170981-T-C ***
10008566-C-T 10170957-C-T ***
10008554-TCCAAGGTCCTC-T 10170945-TCCAAGGTCCTC-T ***
58972845-C-A 56826698-C-A ***
13856628-A-G 11735922-A-G ***
28800314-G-A 26654167-G-A ***
13854428-A-G 11733722-A-G ***
13839631-C-G 11718925-C-G ***
58978332-T-C 56832185-T-C ***
13856432-C-G 11735726-C-G ***
26834745-G-A 24688598-G-A P1_g2 12×AAGA***
13857413-C-T 11736707-C-T ***
58982983-C-T 56836836-C-T ***
25709386-G-GTTT 23563239-G-GTTT P1_b3 31×T***
13857921-C-G 11737215-C-G ***
13856660-T-A 11735954-T-A 5×TGGAA***
13856642-A-G 11735936-A-G ***
13138266-G-C 10627752-G-C ***
13140470-C-T 10629956-C-T ***
13139458-T-A 10628944-T-A ***
25462345-GAC-G 23316198-GAC-G P2_r2 22×AC***
13866929-T-G 11746223-T-G ***
58981088-G-C 56834941-G-C ***
58981078-G-C 56834931-G-C ***
58976348-C-T 56830201-C-T ***
58976257-T-C 56830110-T-C ***
28801627-A-G 26655480-A-G ***
28801613-C-A 26655466-C-A ***
28799118-A-G 26652971-A-G ***
28799108-T-G 26652961-T-G ***
28788098-C-G 26641951-C-G ***
28788063-C-G 26641916-C-G ***
22446803-T-C 20284917-T-C DYZ19 ***
13832501-T-A,G 11711795-T-A,G ***
13870130-C-G 11749424-C-G ***
13858066-A-G 11737360-A-G ***
13857583-A-G 11736877-A-G ***
13857571-G-T 11736865-G-T ***
13855475-A-T 11734769-A-T ***
13855471-T-G 11734765-T-G BY33739 ***
13853221-C-T 11732515-C-T Z37576 ***
13832411-C-A 11711705-C-A ***
13808606-A-G 11687900-A-G ***
13677955-C-A 11522279-C-A ***
22502673-G-C 20340787-G-C DYZ19 ***
13137994-C-T 10627480-C-T ***
22272284-A-G 20110398-A-G DYZ19 ***
58972729-C-G 56826582-C-G ***
6347671-G-A 6479630-G-A 4×GAAA***
13139455-C-T 10628941-C-T ***
13139435-T-C 10628921-T-C ***
13139424-T-C 10628910-T-C ***
13138209-CCCATT-C,T 10627695-CCCATT-C,T ***
13137959-C-T 10627445-C-T ***
13137419-C-T 10626905-C-T ***
13844874-A-G 11724168-A-G ***
10023644-G-T 10186035-G-T ***
10019453-AAGG-A,AGAGA 10181844-AAGG-A,AGAGA ***
9774377-C-CTT 9936768-C-CTT ***
9320610-C-A 9483001-C-A ***
13810889-C-CAATGG,G 11690183-C-CAATGG,G 9×AATGG***
13137268-G-A 10626754-G-A ***
13824908-C-T 11704202-C-T ***
28798989-G-T 26652842-G-T ***
13870070-A-G 11749364-A-G ***
13859770-A-G 11739064-A-G ***
13859737-G-A 11739031-G-A ***
13858128-A-T 11737422-A-T ***
13858121-G-A 11737415-G-A ***
13804427-C-T 11683721-C-T ***
13799520-A-G 11678814-A-G ***
13799509-A-G 11678803-A-G ***
13799471-G-T 11678765-G-T ***
13139411-C-A 10628897-C-A ***
13848463-C-T 11727757-C-T ***
58912904-T-A 56677967-A-T ***
13141273-G-A 10630759-G-A ***
22481762-G-A 20319876-G-A DYZ19 ***
13835255-T-A,G 11714549-T-A,G ***
13702818-C-A 11547142-C-A ***
13459238-T-C 11303562-T-C ***
13805179-A-C 11684473-A-C ***
28784516-A-G 26638369-A-G ***
13857380-A-G 11736674-A-G ***
13818107-T-G 11697401-T-G ***
13450476-T-C 11294800-T-C ***
58977221-A-C 56831074-A-C ***
28800321-C-G 26654174-C-G ***
22481783-A-T 20319897-A-T DYZ19 ***
13870141-C-G 11749435-C-G S15185 ***
13654364-T-G 11498688-T-G ***
13870131-A-G 11749425-A-G ***
13870098-A-C 11749392-A-C ***
13870055-G-C 11749349-G-C ***
13870003-C-A 11749297-C-A ***
13869999-T-A 11749293-T-A ***
13868869-C-T 11748163-C-T ***
13856652-C-G 11735946-C-G ***
13856637-C-G 11735931-C-G ***
13839648-T-C 11718942-T-C ***
13832413-C-G 11711707-C-G ***
13804442-G-T 11683736-G-T ***
13700992-G-T 11545316-G-T ***
13856705-G-A 11735999-G-A ***
13821160-C-A 11700454-C-A ***
58844552-T-A 56746319-A-T ***
13862374-T-G 11741668-T-G ***
28799036-C-A 26652889-C-A ***
28799034-T-G 26652887-T-G ***
28798987-G-A 26652840-G-A ***
28798982-T-A 26652835-T-A ***
28798977-G-A 26652830-G-A ***
28798972-G-A 26652825-G-A ***
28798967-G-A 26652820-G-A ***
28798959-G-T 26652812-G-T ***
28798930-A-G 26652783-A-G ***
22481703-G-A 20319817-G-A DYZ19 ***
13862382-T-A 11741676-T-A ***
13862373-G-T 11741667-G-T ***
13824912-T-A 11704206-T-A ***
13862359-T-G 11741653-T-G ***
13861167-G-A 11740461-G-A ***
13856643-A-G 11735937-A-G ***
13854442-T-G 11733736-T-G ***
13817506-C-T 11696800-C-T ***
13805215-C-T 11684509-C-T ***
13729959-C-G 11574283-C-G ***
13454103-T-A 11298427-T-A ***
13138290-T-C 10627776-T-C ***
13138281-T-C 10627767-T-C ***
13138256-A-C 10627742-A-C ***
6226104-C-T 6358063-C-T IR3_Dst ***
58981073-T-A,G 56834926-T-A,G ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

ERROR: There was an error querying the server about the notes for this person.



Big Tree Main Page