Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > DF21/S192 > FGC3213 > ZZ1 > S3058 > S424 > S426 > S190 > FGC3215 > Z36747 > Y16487 > Y16486 > BY4583 > BY6580

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
68005
FB38
68005-A
BigY3
68005
18534161-C-T 16422281-C-T P6_Dst A*
20972668-G-GT 18810782-G-GT P4_Dst 8×T***A*
17662167-GTAGATAGATAGATAGATAGA-G 15550287-GTAGATAGATAGATAGATAGA-G 16×TAGA***+*
22268870-G-T 20106984-G-T DYZ19 ****
25000049-G-A 22853902-G-A g1 ****
22530046-A-G 20368160-A-G Y78162 Y***
10663137-TG-CA,CG *
10894532-TCTCG-ACTCC *
13470559-AG-CA 11314883-AG-CA *
13489619-ACCCCCACCACCACCCACCACCCCCG-CCACACCACCCTCACCACCCACCCCCA,CGTCCTCACCCTCACCACCCACCCCCG 11333943-ACCCCCACCACCACCCACCACCCCCG-CCACACCACCCTCACCACCCACCCCCA,CGTCCTCACCCTCACCACCCACCCCCG *
13549882-GTGTGTGTGTGTGTGTGTGTGTGTGTC-ATGTGTGTGTGTGTGTGTGTGTGTG 11394206-GTGTGTGTGTGTGTGTGTGTGTGTGTC-ATGTGTGTGTGTGTGTGTGTGTGTG *
19042179-C-CA,CAA 16930299-C-CA,CAA 17×A*
22239031-TCTGT-CCTGA,TCTGA 20077145-TCTGT-CCTGA,TCTGA DYZ19 *
22359611-TGAAT-CATAG,TAAAG 20197725-TGAAT-CATAG,TAAAG DYZ19 *
22511467-GTTTT-GTTTC,TTTC 20349581-GTTTT-GTTTC,TTTC DYZ19 *
56855229-TAAAAATAA-AATTTT *
56861065-C-A,AGTTCAAAAATTAACCATATAGACGGACAA *
18325701-ATT-A 16213821-ATT-A P6_Prx 27×T**
26912706-CA-C 24766559-CA-C P1_r3 14×A**
59013640-TTTTTTTT-A 56867493-TTTTTTTT-A **
23049011-G-T 20887125-G-T Z4690 M9374 FTA13305 **
28602441-G-A 26456294-G-A CTS12525 **
7342387-C-A 7474346-C-A **
22357298-TG-GT 20195412-TG-GT DYZ19 **
18297504-AATATATATAT-A 16185624-AATATATATAT-A P6_Prx 16×AT**
21766960-GA-G **
27082228-A-T 24936081-A-T P1_r4 **
5354970-G-A 5486929-G-A **
5813876-C-T 5945835-C-T *****
9328999-A-G 9491390-A-G **
10624333-T-A ****
13628050-T-C 11472374-T-C *****
19887307-CACACA-C 17775427-CACACA-C P5_Prx **
20295204-AT-A 18133318-AT-A P5_Dst ****
23049008-A-T 20887122-A-T **
23049039-T-C 20887153-T-C ****
23049046-A-G 20887160-A-G ****
28448274-A-AG 26302127-A-AG P1_gr2 **
28486688-C-T 26340541-C-T *****
24328-T-C **
19926955-CTTT-C 17815075-CTTT-C P5_Prx 23×T**
13257285-ATATAT-A 11101609-ATATAT-A **
25524693-CT-A 23378546-CT-A P1_gr1 33×T**
6133973-T-A 6265932-T-A **
6133987-T-A 6265946-T-A **
6300816-T-C 6432775-T-C IR3_Dst **
8176524-A-G 8308483-A-G **
8288838-AG-T 8420797-AG-T **
9416731-G-TT 9579122-G-TT 23×T**
9595306-G-C 9757697-G-C IR3_Prx **
16145824-C-T 14033944-C-T P8_Dst **
16340147-G-TA 14228267-G-TA 22×A**
17835913-T-C 15724033-T-C **
17901358-C-T 15789478-C-T **
20446887-A-G 18285001-A-G P5_Dst **
20478953-C-AA 18317067-C-AA P5_Dst 15×A**
20567826-G-T 18405940-G-T P5_Dst **
20954363-ATCTGG-TATGT 18792477-ATCTGG-TATGT P4_Dst **
21014814-A-G 18852928-A-G P4_Dst **
21018094-CT-C 18856208-CT-C P4_Dst 9×T**
22329984-T-A 20168098-T-A DYZ19 **
23049008-AGCG-TGCT 20887122-AGCG-TGCT **
21765322-T-C **
21774819-G-A **
24597813-CTTT-C 22451666-CTTT-C P3_t2 22×T**
24685990-G-C 22539843-G-C P3_b2 **
24685996-A-G 22539849-A-G P3_b2 **
26893556-C-A 24747409-C-A P1_r3 **
27080259-AT-A 24934112-AT-A P1_r4 11×T**
27242101-G-T 25095954-G-T P1_g3 **
27457796-T-C 25311649-T-C P1_Y2 **
27624773-T-C 25478626-T-C P1_Y2 **
27653160-G-T 25507013-G-T P1_Y2 **
27653585-A-G 25507438-A-G P1_Y2 **
27664620-GT-G 25518473-GT-G P1_Y2 10×T**
27765145-T-TA 25618998-T-TA P1_Y2 11×A**
27797663-A-G 25651516-A-G P1_Y2 **
27843778-C-T 25697631-C-T P1_Y2 **
27930790-C-A 25784643-C-A P1_Y2 **
27945356-G-T 25799209-G-T P1_Y2 **
27965994-A-G 25819847-A-G P1_Y2 **
28421066-C-T 26274919-C-T P1_gr2 **
56678028-GGG-AGA **
25402857-C-CT 23256710-C-CT P2_r2 20×T***
26990078-T-TA 24843931-T-TA P1_r4 11×A***
25441211-ATT-A,AT 23295064-ATT-A,AT P2_r2 22×T***
26359590-C-CA 24213443-C-CA P1_Y1 22×A***
27778164-CT-C 25632017-CT-C P1_Y2 12×T***
26905497-CAA-C 24759350-CAA-C P1_r3 19×A***
22309582-G-A 20147696-G-A DYZ19 ***
26946206-TAAA-T 24800059-TAAA-T P1_r3 25×A***
20360957-AT-A 18199071-AT-A P5_Dst 10×T***
22444394-C-T 20282508-C-T ZS3151 DYZ19 ***
22239041-A-C 20077155-A-C DYZ19 ***
26400702-C-T 24254555-C-T P1_Y1 ***
22258136-C-A 20096250-C-A BY24917 DYZ19 ***
13522019-G-A 11366343-G-A FT255332 ***
28180701-CA-C 26034554-CA-C P1_b4 16×A***
10036195-T-C 10198586-T-C BY32676 ***
22272313-T-A 20110427-T-A DYZ19 ***
22272327-A-G 20110441-A-G DYZ19 ***
22275589-T-A 20113703-T-A BY38178 DYZ19 ***
22459758-G-A 20297872-G-A DYZ19 ***
24626441-A-AT 22480294-A-AT P3_t2 10×T***
9589945-C-CT 9752336-C-CT IR3_Prx 10×T***
22258143-TGC-AGT 20096257-TGC-AGT DYZ19 ***
26645980-T-TA 24499833-T-TA P1_g2 10×A***
10013311-GCC-ACA 10175702-GCC-ACA ***
6359095-CA-C 6491054-CA-C 30×A***
22272351-C-A 20110465-C-A FT454449 DYZ19 ***
22490685-G-T 20328799-G-T DYZ19 ***
25504650-C-CT 23358503-C-CT P1_gr1 17×T***
22483308-G-C 20321422-G-C DYZ19 ***
22357695-AC-CT 20195809-AC-CT DYZ19 ***
10055774-CAA-C 10218165-CAA-C 15×A***
15324319-CTTT-C,CT 13212437-CTTT-C,CT 25×T***
22263597-T-C 20101711-T-C DYZ19 ***
4778178-CAAAA-C 4910137-CAAAA-C 15×A***
27633812-T-C 25487665-T-C P1_Y2 ***
22242410-AAT-CAC 20080524-AAT-CAC DYZ19 ***
24579808-TTG-T 22433661-TTG-T P3_t2 ***
17920914-C-T 15809034-C-T ***
16482359-TTATA-T 14370479-TTATA-T 9×TA***
4814130-T-TA 4946089-T-TA 9×A***
25513258-C-CA 23367111-C-CA P1_gr1 17×A***
17821825-GAA-G,GA 15709945-GAA-G,GA 17×A***
28069955-A-AT 25923808-A-AT P1_Y2 13×T***
10013278-CCTGCT-TCTGCA 10175669-CCTGCT-TCTGCA ***
22485120-T-C 20323234-T-C DYZ19 ***
5931916-CTTTT-C 6063875-CTTTT-C 32×T***
5828966-AACAC-A,AAC 5960925-AACAC-A,AAC 22×AC***
22479451-A-T 20317565-A-T DYZ19 ***
22488169-GG-AA 20326283-GG-AA DYZ19 ***
22807900-A-T 20646014-A-T ***
7003134-A-G 7135093-A-G ***
4196934-CAA-C,CAAA 4328893-CAA-C,CAAA 16×A***
13349381-C-T 11193705-C-T ***
13392642-C-G 11236966-C-G ***
13884529-CAAAAAA-C 11763823-CAAAAAA-C 17×A***
15834689-T-C 13722809-T-C ******
17125310-A-G 15013430-A-G ******
18612759-GTATATA-G,GTA 16500879-GTATATA-G,GTA 15×TA***
20915515-A-AG 18753629-A-AG P4_Dst ***
20301074-C-T 18139188-C-T BY188078 P5_Dst ***
16679097-GAAT-TAA 14567217-GAAT-TAA ***
10889271-TCCATTCCATTCCATTCCATT-GCCATGCCATG ***
28350130-C-T 26203983-C-T P1_gr2 ***
28372441-G-GC 26226294-G-GC P1_gr2 ***
27569444-TGA-T 25423297-TGA-T P1_Y2 ***
28353057-T-C 26206910-T-C P1_gr2 ***
28353065-G-A 26206918-G-A P1_gr2 ***
28353080-A-G 26206933-A-G P1_gr2 ***
24643282-CAA-C 22497135-CAA-C P3_t2 28×A***
22483259-A-T 20321373-A-T DYZ19 ***
22483289-CTGCCGAC-GTGCAGAA 20321403-CTGCCGAC-GTGCAGAA DYZ19 ***
27468101-CA-C 25321954-CA-C P1_Y2 12×A***
22485066-G-A 20323180-G-A DYZ19 ***
27454760-CT-C 25308613-CT-C P1_Y2 23×T***
27465023-T-G 25318876-T-G P1_Y2 ***
28388483-A-T 26242336-A-T P1_gr2 ***
6133963-T-A 6265922-T-A ***
6780870-CA-C,CAA 6912829-CA-C,CAA 26×A***
7003468-A-G 7135427-A-G ***
7003475-A-G 7135434-A-G ***
7443260-T-A 7575219-T-A ***
7534392-GTTTTTTTTTTTTTGT-GTTTTTTTTTTTTTG,TTTTTTTTTTTTTTTT 7666351-GTTTTTTTTTTTTTGT-GTTTTTTTTTTTTTG,TTTTTTTTTTTTTTTT 13×T***
7717633-CCC-TCCT,TCCTTCCC 7849592-CCC-TCCT,TCCTTCCC ***
7939493-AAAAA-G 8071452-AAAAA-G ***
8498338-CAA-C,CAAA 8630297-CAA-C,CAAA 16×A***
9361194-A-CAC 9523585-A-CAC ***
9535640-G-T 9698031-G-T IR3_Prx ***
9545283-A-G 9707674-A-G IR3_Prx ***
9566302-T-C 9728693-T-C IR3_Prx ***
9572104-G-T 9734495-G-T IR3_Prx ***
9590558-CTT-C 9752949-CTT-C IR3_Prx 13×T***
9598731-A-C 9761122-A-C IR3_Prx ***
9602282-TTTTAT-GTTTTTAA 9764673-TTTTAT-GTTTTTAA IR3_Prx ***
9621337-G-T 9783728-G-T IR3_Prx ***
9624367-A-G 9786758-A-G IR3_Prx ***
9625866-AGT-A 9788257-AGT-A IR3_Prx 9×GT***
9625919-C-G 9788310-C-G IR3_Prx ***
9634097-G-A 9796488-G-A IR3_Prx ***
9669488-A-T 9831879-A-T IR3_Prx ***
9694044-A-G 9856435-A-G IR3_Prx ***
9694356-A-G 9856747-A-G IR3_Prx ***
10785259-G-A,GTTCCA ***
10921912-CAACTCT-GAATTCC ***
13452394-TTCAAATACACTCCTTGC-GTCAAATCCACTCCATGA 11296718-TTCAAATACACTCCTTGC-GTCAAATCCACTCCATGA ***
16146057-A-G 14034177-A-G P8_Dst ***
17920875-GA-TT 15808995-GA-TT ***
17920906-C-T 15809026-C-T ***
18455830-T-C 16343950-T-C P6_Dst ***
18461101-T-C 16349221-T-C P6_Dst ***
18513994-T-C 16402114-T-C P6_Dst ***
18516769-A-G 16404889-A-G P6_Dst ***
19409391-CA-AA,C 17297511-CA-AA,C 22×A***
20074317-C-T 17962437-C-T P5_Dst ***
20074328-C-T 17962448-C-T P5_Dst ***
20081568-A-T 17969688-A-T P5_Dst ***
20102112-C-T 17990232-C-T P5_Dst ***
20130574-A-G 18018694-A-G P5_Dst ***
20211425-C-T 18049539-C-T P5_Dst ***
20214697-T-C 18052811-T-C P5_Dst ***
20224196-T-C 18062310-T-C P5_Dst ***
20268104-C-CT 18106218-C-CT P5_Dst ***
20270628-A-G 18108742-A-G P5_Dst ***
20280850-G-A 18118964-G-A P5_Dst ***
20289555-C-A 18127669-C-A P5_Dst ***
20349069-T-C 18187183-T-C P5_Dst ***
20368108-CT-C,CTT 18206222-CT-C,CTT P5_Dst 22×T***
20373713-C-T 18211827-C-T P5_Dst ***
20378812-G-A 18216926-G-A P5_Dst ***
20405546-T-C 18243660-T-C P5_Dst ***
20414301-G-A 18252415-G-A P5_Dst ***
20417685-C-A 18255799-C-A P5_Dst ***
20429011-A-G 18267125-A-G P5_Dst ***
20442094-TTGC-GTGA 18280208-TTGC-GTGA P5_Dst ***
20442148-T-C 18280262-T-C P5_Dst ***
20448933-TAT-CAC 18287047-TAT-CAC P5_Dst ***
20450702-T-C 18288816-T-C P5_Dst ***
20491568-T-C 18329682-T-C P5_Dst ***
20492817-T-C 18330931-T-C P5_Dst ***
20500107-T-A 18338221-T-A P5_Dst ***
20515506-A-G 18353620-A-G P5_Dst ***
20524247-A-G 18362361-A-G P5_Dst ***
20559702-T-C 18397816-T-C P5_Dst ***
20576171-G-T 18414285-G-T P5_Dst ***
20580269-C-A 18418383-C-A P5_Dst ***
20601516-T-C 18439630-T-C P5_Dst ***
20609485-C-T 18447599-C-T P5_Dst ***
20645857-T-TA 18483971-T-TA P4_Prx ***
20757362-ATT-A,AT 18595476-ATT-A,AT P4_Prx 32×T***
20848244-A-ATT 18686358-A-ATT P4_Dst 19×T***
20848962-A-G 18687076-A-G P4_Dst ***
20870647-G-T 18708761-G-T P4_Dst ***
20872434-AT-A,ATT 18710548-AT-A,ATT P4_Dst 25×T***
20886452-A-G 18724566-A-G P4_Dst ***
20915508-TC-T 18753622-TC-T P4_Dst ***
20917413-A-G 18755527-A-G P4_Dst ***
20948737-T-C 18786851-T-C P4_Dst ***
20949724-TA-T 18787838-TA-T P4_Dst ***
20954020-G-A 18792134-G-A P4_Dst ***
20965256-C-CT 18803370-C-CT P4_Dst ***
20969436-G-A 18807550-G-A P4_Dst ***
20993420-T-C 18831534-T-C P4_Dst ***
21023111-T-C 18861225-T-C P4_Dst ***
21464187-G-A,GGAAAGAAA 19302301-G-A,GGAAAGAAA 12×GAAA***
21617605-CAA-C,CAAA 19455719-CAA-C,CAAA 23×A***
22238940-AGTG-GGTA 20077054-AGTG-GGTA DYZ19 ***
22263579-ATG-TTC 20101693-ATG-TTC DYZ19 ***
22310568-G-T 20148682-G-T DYZ19 ***
22357386-T-A 20195500-T-A DYZ19 ***
22357568-T-C 20195682-T-C DYZ19 ***
22483216-T-A 20321330-T-A DYZ19 ***
22483246-GT-AC 20321360-GT-AC DYZ19 ***
22485091-ATTG-TTTA 20323205-ATTG-TTTA DYZ19 ***
22486969-TTTCC-ATTCT 20325083-TTTCC-ATTCT DYZ19 ***
22489853-G-C 20327967-G-C DYZ19 ***
22511545-ATTAC-CTTAA,CTTAC 20349659-ATTAC-CTTAA,CTTAC DYZ19 ***
23505519-C-AAA,AC 21343633-C-AAA,AC ***
24011531-GC-G 21865384-GC-G ***
24020314-T-C 21874167-T-C ***
24508168-T-C 22362021-T-C ***
24532561-A-G 22386414-A-G P3_t2 ***
24559224-GT-G 22413077-GT-G P3_t2 ***
24571027-G-A 22424880-G-A P3_t2 ***
24594380-G-C 22448233-G-C P3_t2 ***
24600670-CA-C,CAA 22454523-CA-C,CAA P3_t2 16×A***
24605917-G-T 22459770-G-T P3_t2 ***
24612000-A-G 22465853-A-G P3_t2 ***
24615390-G-C 22469243-G-C P3_t2 ***
24616984-C-T 22470837-C-T P3_t2 ***
24618046-G-T 22471899-G-T P3_t2 ***
24628444-A-G 22482297-A-G P3_t2 ***
24628616-T-C 22482469-T-C P3_t2 ***
24629206-A-G 22483059-A-G P3_t2 ***
24685969-C-T 22539822-C-T P3_b2 ***
24697576-C-A 22551429-C-A P3_b2 ***
24739651-CTT-C,CT 22593504-CTT-C,CT P3_b2 13×T***
25369221-GG-AA 23223074-GG-AA P2_r2 ***
25487704-C-G 23341557-C-G P2_r2 ***
25661799-G-A 23515652-G-A P1_b3 ***
26478108-AAAAG-A,AAAAGAAAGAAAGAAAGAAAG 24331961-AAAAG-A,AAAAGAAAGAAAGAAAGAAAG P1_Y1 19×AAAG***
26499952-ATT-A 24353805-ATT-A P1_Y1 20×T***
26720248-CAA-C,CA 24574101-CAA-C,CA P1_g2 21×A***
26893672-C-T 24747525-C-T P1_r3 ***
27062945-G-A 24916798-G-A P1_r4 11×GTA***
27212318-C-T 25066171-C-T P1_g3 ***
27222063-G-A 25075916-G-A P1_g3 ***
27234776-C-A 25088629-C-A P1_g3 ***
27242105-C-A 25095958-C-A P1_g3 ***
27250179-T-C 25104032-T-C P1_g3 ***
27281761-T-C 25135614-T-C P1_g3 ***
27305584-T-C 25159437-T-C P1_g3 ***
27312495-G-T 25166348-G-T P1_g3 ***
27375800-AT-A,ATT 25229653-AT-A,ATT P1_g3 19×T***
27420703-AT-A 25274556-AT-A P1_g3 9×T***
27420792-C-T 25274645-C-T P1_g3 ***
27433636-G-A 25287489-G-A P1_g3 ***
27445737-C-T 25299590-C-T P1_Y2 ***
27458178-ACTCACA-GCTCCACG 25312031-ACTCACA-GCTCCACG P1_Y2 ***
27458194-C-T 25312047-C-T P1_Y2 ***
27461725-T-C 25315578-T-C P1_Y2 ***
27486611-A-C 25340464-A-C P1_Y2 ***
27493085-T-C 25346938-T-C P1_Y2 ***
27493094-C-CCT 25346947-C-CCT P1_Y2 ***
27493100-AAG-A 25346953-AAG-A P1_Y2 ***
27494165-G-A 25348018-G-A P1_Y2 ***
27498458-G-A 25352311-G-A P1_Y2 ***
27498464-G-A 25352317-G-A P1_Y2 ***
27503690-A-G 25357543-A-G P1_Y2 ***
27524238-C-T 25378091-C-T P1_Y2 ***
27530901-GAAT-AAAA 25384754-GAAT-AAAA P1_Y2 ***
27547034-T-C 25400887-T-C P1_Y2 ***
27564432-C-T 25418285-C-T P1_Y2 ***
27573714-T-C 25427567-T-C P1_Y2 ***
27575934-CTT-C 25429787-CTT-C P1_Y2 19×T***
27579778-T-C 25433631-T-C P1_Y2 ***
27593681-G-A 25447534-G-A P1_Y2 ***
27609685-G-A 25463538-G-A P1_Y2 ***
27615647-GA-G 25469500-GA-G P1_Y2 ***
27625912-T-C 25479765-T-C P1_Y2 ***
27639759-G-A 25493612-G-A P1_Y2 ***
27642701-T-C 25496554-T-C P1_Y2 ***
27646844-C-G 25500697-C-G P1_Y2 ***
27653213-A-G 25507066-A-G P1_Y2 ***
27671264-G-A 25525117-G-A P1_Y2 ***
27675364-G-A 25529217-G-A P1_Y2 ***
27701774-A-T 25555627-A-T P1_Y2 ***
27710791-T-C 25564644-T-C P1_Y2 ***
27711400-T-C 25565253-T-C P1_Y2 ***
27714033-TAG-T,TAGAG 25567886-TAG-T,TAGAG P1_Y2 15×AG***
27745186-G-A 25599039-G-A P1_Y2 ***
27758680-A-AT 25612533-A-AT P1_Y2 ***
27794247-T-C 25648100-T-C P1_Y2 ***
27795066-T-TATACAC 25648919-T-TATACAC P1_Y2 ***
27802908-G-A 25656761-G-A P1_Y2 ***
27868220-C-A 25722073-C-A P1_Y2 ***
27890104-C-T 25743957-C-T P1_Y2 ***
27899329-A-G 25753182-A-G P1_Y2 ***
27938902-C-T 25792755-C-T P1_Y2 ***
27963992-A-G 25817845-A-G P1_Y2 ***
27971936-A-G 25825789-A-G P1_Y2 ***
27980628-T-C 25834481-T-C P1_Y2 ***
28006053-C-T 25859906-C-T P1_Y2 ***
28051890-A-G 25905743-A-G P1_Y2 ***
28065155-CTT-C 25919008-CTT-C P1_Y2 15×T***
28069350-T-A 25923203-T-A P1_Y2 ***
28072298-G-T 25926151-G-T P1_Y2 ***
28093581-A-C 25947434-A-C P1_Y2 ***
28147152-G-GCA 26001005-G-GCA P1_b4 13×CA***
28232793-G-C 26086646-G-C P1_b4 ***
28353167-A-G 26207020-A-G P1_gr2 ***
28376384-A-G 26230237-A-G P1_gr2 ***
28377806-A-G 26231659-A-G P1_gr2 ***
28380088-C-T 26233941-C-T P1_gr2 ***
28387183-C-A 26241036-C-A P1_gr2 ***
28387200-C-A 26241053-C-A P1_gr2 ***
28395344-TAA-T 26249197-TAA-T P1_gr2 17×A***
28397109-C-A 26250962-C-A P1_gr2 ***
28416973-A-G 26270826-A-G P1_gr2 ***
28440674-C-T 26294527-C-T P1_gr2 ***
28452010-C-A 26305863-C-A P1_gr2 ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.