Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > FGC11134 > FGC12055 > ZZ44 > A9871 > BY9001 > 14353590-G-A > BY12234 > BY9002 > Y54500

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY3
332685
FTDNA
332685
BigY2
332685
Manual
Edits
20040458-G-C 17928578-G-C P5_Prx A*
20040463-T-G 17928583-T-G BY51858 P5_Prx A*
20040466-G-C 17928586-G-C BY212060 P5_Prx A*
20040474-G-C 17928594-G-C BY196756 P5_Prx A*
18374449-T-TC 16262569-T-TC P6_Prx A*
28817641-G-A 26671494-G-A A*A*
3357222-A-AT 3489181-A-AT 10×TA*
56832224-C-G A*
20040442-A-C 17928562-A-C P5_Prx A*
56836716-C-T A*
13450909-T-A 11295233-T-A A*
28017186-T-TA 25871039-T-TA P1_Y2 10×AA*
26110031-T-A 23963884-T-A P1_Y1 A*
56830567-T-A A*
56831419-C-T A*
17878491-C-A 15766611-C-A Y53856 YY+++
22008215-C-T 19846329-C-T Y57507 YY+**
17916123-A-G 15804243-A-G FT154474 YY+
17339229-GAA-G 15227349-GAA-G 13×A*
13855621-C-A 11734915-C-A **
13448841-T-C 11293165-T-C **
14989246-G-A 12877331-G-A FTB48411 **
19138058-C-CTA 17026178-C-CTA 10×TA**
19517642-C-A 17405762-C-A FGC72903FGC72927 **
25246436-C-T 23100289-C-T P2_r1 **
19937234-C-A 17825354-C-A P5_Prx **
14230241-GTAA-G 12109535-GTAA-G 6×TAA**
16522348-C-A 14410468-C-A **
20815408-CAT-C 18653522-CAT-C P4_Gap 22×AT**
24600442-C-T 22454295-C-T A20538 P3_t2 18×TCTT**
27916433-G-A 25770286-G-A P1_Y2 **
8636857-C-A 8768816-C-A BY2907BY2944 **
13464212-A-C 11308536-A-C **
17918770-C-A 15806890-C-A **
18906137-C-T 16794257-C-T Z39634 **
6734680-CTTTTT-C 6866639-CTTTTT-C 21×T**
8631383-CTTTTT-C 8763342-CTTTTT-C 26×T**
28759463-C-T 26613316-C-T FGC8840Y22125 FGC49699 **
19465551-C-A 17353671-C-A **
28369982-T-TTATA 26223835-T-TTATA P1_gr2 17×TA**
15320646-G-A 13208752-G-A **
22868830-CA-C 20706944-CA-C 10×A**
10999883-C-T **
10755481-C-T **
4271321-C-A 4403280-C-A **
10785294-A-C **
10744375-A-C **
3651343-G-T 3783302-G-T **
56685608-A-G **
19407606-CTTTT-C 17295726-CTTTT-C 17×T**
17512585-C-A 15400705-C-A **
17175330-C-A 15063450-C-A **
13478121-A-T 11322445-A-T **
18756294-C-A 16644414-C-A **
16507072-C-A 14395192-C-A **
21446309-A-T 19284423-A-T **
56822678-G-T **
24508340-C-A 22362193-C-A **
3866259-GA-G 3998218-GA-G 13×A**
24595385-A-C 22449238-A-C P3_t2 **
10669451-T-C **
11674512-T-C **
13921528-C-A 11800822-C-A **
28514480-C-A 26368333-C-A **
21919381-G-T 19757495-G-T **
10776499-T-A **
11014499-C-T **
9416889-G-A 9579280-G-A FT76002 **
21700595-GAAAA-G 19538709-GAAAA-G 17×A**
14568221-C-A 12456421-C-A **
21639037-C-A 19477151-C-A **
10682479-C-T **
20364227-T-TC 18202341-T-TC P5_Dst **
18378960-T-TC 16267080-T-TC P6_Prx **
16507067-C-A 14395187-C-A **
21464468-C-A 19302582-C-A **
27967256-G-GTA 25821109-G-GTA P1_Y2 **
5864807-C-A 5996766-C-A **
15773396-C-A 13661516-C-A **
15392453-A-G 13280573-A-G **
20775175-GA-G 18613289-GA-G P4_Prx 10×A**
26253786-T-C 24107639-T-C P1_Y1 **
2768027-G-T 2899986-G-T **
2775447-C-A 2907406-C-A **
2810392-GA-G 2942351-GA-G **
2908029-C-A 3039988-C-A **
3017547-A-T 3149506-A-T **
3033649-G-T 3165608-G-T **
3122577-C-A 3254536-C-A **
3270202-AT-A 3402161-AT-A **
3330915-C-A 3462874-C-A **
3610606-C-A 3742565-C-A **
3622359-C-A 3754318-C-A **
3622972-G-T 3754931-G-T **
3836883-C-A 3968842-C-A **
3843641-T-G 3975600-T-G **
4065141-A-G 4197100-A-G **
4081614-C-A 4213573-C-A **
4110459-C-A 4242418-C-A **
4133289-T-C 4265248-T-C **
4201591-C-A 4333550-C-A **
4367177-G-T 4499136-G-T **
4770483-G-A 4902442-G-A **
4832617-G-T 4964576-G-T **
4873665-A-C 5005624-A-C **
4920132-C-A 5052091-C-A **
5080669-A-G 5212628-A-G **
5163936-A-G 5295895-A-G **
5171258-C-A 5303217-C-A **
5200558-A-C 5332517-A-C **
5219067-T-C 5351026-T-C **
5385068-G-A 5517027-G-A **
5443931-C-A 5575890-C-A **
5449900-C-T 5581859-C-T **
5472009-A-T 5603968-A-T **
5721124-C-A 5853083-C-A **
5739812-A-G 5871771-A-G **
5775691-A-G 5907650-A-G **
5834314-C-A 5966273-C-A **
5887668-A-G 6019627-A-G **
6113649-G-A 6245608-G-A BY59126 **
6166945-G-A 6298904-G-A BY59372 IR3_Dst **
6347599-G-A 6479558-G-A **
6465013-C-A 6596972-C-A BY60256 **
6510129-CTTGTTTGAGTT-C 6642088-CTTGTTTGAGTT-C **
7017260-C-A 7149219-C-A **
7035279-C-A 7167238-C-A **
7044424-C-A 7176383-C-A **
7107648-C-A 7239607-C-A **
7115503-C-A 7247462-C-A **
7142782-C-A 7274741-C-A **
7156997-A-G 7288956-A-G **
7183780-G-C 7315739-G-C **
7222609-CT-C 7354568-CT-C **
7223415-C-T 7355374-C-T **
7246097-C-T 7378056-C-T **
7310695-C-A 7442654-C-A **
7339040-C-A 7470999-C-A **
7426227-C-A 7558186-C-A **
7590595-G-T 7722554-G-T **
7666168-C-A 7798127-C-A **
7894567-C-A 8026526-C-A **
7897601-G-T 8029560-G-T **
7990672-C-T 8122631-C-T **
8051922-G-A 8183881-G-A **
8052363-G-A 8184322-G-A **
8270770-C-A 8402729-C-A **
8343365-C-A 8475324-C-A **
8385257-C-A 8517216-C-A **
8479505-C-A 8611464-C-A **
8661066-C-G 8793025-C-G **
8734943-C-A 8866902-C-A **
8736903-C-A 8868862-C-A **
8746336-C-A 8878295-C-A **
8879575-T-C 9011534-T-C **
9056437-C-A **
9444819-T-C 9607210-T-C **
9444859-T-G 9607250-T-G **
9444899-A-G 9607290-A-G **
9461716-G-A 9624107-G-A **
9462234-C-T 9624625-C-T **
9528722-G-T 9691113-G-T **
9557585-A-AG 9719976-A-AG IR3_Prx **
9873814-G-T 10036205-G-T **
9996122-G-C 10158513-G-C **
10019725-C-A 10182116-C-A **
10669410-ATTTCATTCAT-C **
10669445-A-ACTCC **
10669446-T-TC **
10669457-T-C **
10682527-C-CACTTCAATCT **
10747062-G-T **
10747097-C-T **
10776513-A-C **
10785272-C-CTGTT **
10785273-C-CAGGTTA **
10821997-C-A **
10835546-C-A **
10864628-C-A FT434599 **
10958333-C-CTG **
10958334-CAT-C **
10992722-C-G **
13195753-C-A 11040077-C-A **
13245250-C-A 11089574-C-A **
13305742-C-A 11150066-C-A **
13456427-C-A 11300751-C-A **
13459823-A-G 11304147-A-G **
13478101-C-A 11322425-C-A **
13478104-G-A 11322428-G-A **
13478112-A-T 11322436-A-T **
13521505-C-A 11365829-C-A **
13625235-A-T 11469559-A-T **
13659391-G-C 11503715-G-C **
13671426-C-A 11515750-C-A **
13696124-G-A 11540448-G-A **
11650644-A-T **
11652902-C-A **
11671496-G-A **
13878582-G-T 11757876-G-T FTB77826 **
13919232-A-T 11798526-A-T **
13935313-C-A 11814607-C-A **
13936327-C-A 11815621-C-A **
13938724-T-C 11818018-T-C **
13993426-C-A 11872720-C-A **
13999245-C-T 11878539-C-T **
14038211-T-G 11917505-T-G **
14071452-C-A 11950746-C-A **
14072950-G-T 11952244-G-T **
14153065-A-T 12032359-A-T **
14158153-C-A 12037447-C-A **
14178025-C-A 12057319-C-A **
14187968-C-A 12067262-C-A **
14195831-AT-A 12075125-AT-A **
14281148-A-G 12160442-A-G **
14283763-A-G 12163057-A-G **
14344001-C-A 12223296-C-A **
14395565-C-A 12274861-C-A **
14424194-C-A 12303469-C-A **
14448277-C-A 12327550-C-A **
14505407-A-T 12393612-A-T **
14505972-T-C 12394177-T-C **
14511461-A-G 12399666-A-G **
14549434-C-A 12437635-C-A **
14552569-G-A 12440770-G-A **
14559129-C-A 12447330-C-A **
14561278-A-C 12449479-A-C **
14718346-C-T 12606414-C-T **
14780819-C-A 12668889-C-A **
14805973-C-A 12694044-C-A **
14805981-T-C 12694052-T-C **
14823977-C-A 12712044-C-A **
14880294-A-G 12768364-A-G **
14992838-G-T 12880923-G-T **
14992840-A-G 12880925-A-G **
14992845-A-G 12880930-A-G **
14992847-A-G 12880932-A-G **
15212594-G-T 13100680-G-T **
15259277-C-A 13147361-C-A **
15321355-AG-A 13209473-AG-A **
15334078-C-A 13222196-C-A **
15402480-C-A 13290600-C-A **
15402951-A-T 13291071-A-T **
15596489-G-T 13484609-G-T **
15676869-C-T 13564989-C-T FGC31253 **
15680072-A-T 13568192-A-T **
15684178-C-A 13572298-C-A **
15685153-AAC-A 13573273-AAC-A **
15686378-G-T 13574498-G-T **
15698547-C-A 13586667-C-A **
15733871-C-A 13621991-C-A **
15791192-C-A 13679312-C-A **
15862429-C-A 13750549-C-A **
15916312-C-A 13804432-C-A **
15944272-C-A 13832392-C-A **
15975237-C-G 13863357-C-G **
16016993-T-C 13905113-T-C **
16029502-C-A 13917622-C-A **
16041165-T-C 13929285-T-C **
16052057-A-T 13940177-A-T **
16171369-C-A 14059489-C-A **
16342546-GA-G 14230666-GA-G **
16490849-C-A 14378969-C-A **
16549566-TC-T 14437686-TC-T **
16706775-C-A 14594895-C-A **
16707000-A-G 14595120-A-G **
16707464-A-G 14595584-A-G **
16729139-T-C 14617259-T-C **
16777615-G-C 14665735-G-C **
16980109-T-G 14868229-T-G **
17013082-C-A 14901202-C-A **
17071177-A-G 14959297-A-G **
17175243-T-C 15063363-T-C **
17175259-A-C 15063379-A-C **
17279342-A-T 15167462-A-T **
17313206-G-C 15201326-G-C **
17376289-G-A 15264409-G-A **
17380716-C-A 15268836-C-A **
17492036-C-G 15380156-C-G **
17515255-C-A 15403375-C-A **
17589124-C-A 15477244-C-A **
17622726-C-A 15510846-C-A **
17692043-CTGTCA-C 15580163-CTGTCA-C **
17860192-C-A 15748312-C-A **
17870959-T-C 15759079-T-C FT76828 **
17918758-C-A 15806878-C-A **
18020396-C-A 15908516-C-A **
18086028-G-T 15974148-G-T **
18134031-C-T 16022151-C-T **
18145610-T-G 16033730-T-G **
18147538-G-TT 16035658-G-TT **
18150682-C-A 16038802-C-A **
18154479-C-A 16042599-C-A **
18194166-A-T 16082286-A-T **
18194217-C-A 16082337-C-A **
18389975-C-A 16278095-C-A P6_Gap **
18455379-A-AG 16343499-A-AG P6_Dst **
18464739-AT-A 16352859-AT-A P6_Dst **
18625291-G-T 16513411-G-T **
18629443-C-G 16517563-C-G **
18758784-T-A 16646904-T-A **
18769507-A-G 16657627-A-G **
18902951-G-T 16791071-G-T **
18906097-C-A 16794217-C-A **
18907989-A-G 16796109-A-G **
19040307-C-A 16928427-C-A **
19053293-C-T 16941413-C-T **
19059903-C-A 16948023-C-A **
19223192-C-A 17111312-C-A **
19284081-C-A 17172201-C-A **
19425619-C-A 17313739-C-A **
19535677-C-A 17423797-C-A **
19592313-T-TC 17480433-T-TC P5_Prx **
19775216-C-A 17663336-C-A P5_Prx **
20548660-C-A 18386774-C-A P5_Dst **
20557595-C-G 18395709-C-G P5_Dst **
21072262-C-A 18910376-C-A **
21079142-C-A 18917256-C-A **
21154121-C-A 18992235-C-A BY130729 **
21163531-A-T 19001645-A-T **
21265224-A-T 19103338-A-T **
21296551-C-A 19134665-C-A FT56237 **
21329445-C-A 19167559-C-A **
21346379-C-A 19184493-C-A **
21775068-C-A 19613182-C-A **
21895617-C-G 19733731-C-G **
22034848-C-A 19872962-C-A **
22063953-C-A 19902067-C-A **
22075665-C-A 19913779-C-A **
22075840-T-C 19913954-T-C **
22520787-T-C 20358901-T-C **
22722488-C-A 20560602-C-A **
22730349-C-A 20568463-C-A **
22734332-G-T 20572446-G-T **
22800227-C-A 20638341-C-A **
23187738-A-G 21025852-A-G **
23311147-T-TTTC 21149261-T-TTTC 15×TTTC**
23316104-T-G 21154218-T-G **
23439988-C-A 21278102-C-A **
23442693-C-A 21280807-C-A **
23742514-C-A 21580628-C-A **
23786874-C-A 21624988-C-A **
23882014-G-T 21720128-G-T **
23890258-G-A 21728372-G-A **
23890284-G-A 21728398-G-A **
23890295-C-T 21728409-C-T **
23890301-G-T 21728415-G-T **
23890351-T-C 21728465-T-C **
24241205-C-CAA 22095058-C-CAA P3_b1 **
24385524-C-A 22239377-C-A **
24403573-G-T 22257426-G-T **
24415959-G-T 22269812-G-T **
24432793-G-A 22286646-G-A **
24614165-T-C 22468018-T-C P3_t2 **
25599982-T-C 23453835-T-C P1_gr1 **
27829339-A-G 25683192-A-G BY226911 P1_Y2 **
27990889-G-T 25844742-G-T P1_Y2 **
28460911-C-A 26314764-C-A **
28514691-C-A 26368544-C-A **
28514738-T-C 26368591-T-C **
28562465-A-C 26416318-A-C **
28616115-G-T 26469968-G-T **
28622228-C-A 26476081-C-A A16925 **
28643888-T-C 26497741-T-C **
28653846-C-A 26507699-C-A Y113249 **
28660474-C-A 26514327-C-A **
28679633-C-A 26533486-C-A **
28703382-C-A 26557235-C-A **
28761520-T-C 26615373-T-C **
28784367-A-G 26638220-A-G **
28784371-G-A 26638224-G-A **
28784376-G-A 26638229-G-A **
28784405-G-GGAACT 26638258-G-GGAACT **
28784413-A-T 26638266-A-T **
28784424-T-G 26638277-T-G **
28784429-T-A 26638282-T-A **
28784433-A-T 26638286-A-T **
28784435-G-A 26638288-G-A **
28784438-A-T 26638291-A-T **
28784440-G-A 26638293-G-A **
28784458-G-T 26638311-G-T **
56822323-G-T **
56832163-C-A **
56833924-C-T **
56835731-G-T **
19914367-C-A 17802487-C-A P5_Prx **
22852199-C-CT 20690313-C-CT 16×T**
13535639-GTATATATATATATATATATATATATATATATA-G 11379963-GTATATATATATATATATATATATATATATATA-G 21×TA**
6209127-C-A 6341086-C-A IR3_Dst **
6237028-T-G 6368987-T-G IR3_Dst **
13980822-G-A 11860116-G-A **
15147205-A-G 13035292-A-G **
18261798-T-C 16149918-T-C **
19948057-G-T 17836177-G-T P5_Prx **
26228946-A-C 24082799-A-C P1_Y1 **
26407110-T-G 24260963-T-G P1_Y1 **
10018930-C-T 10181321-C-T BY41688 ***
16647523-C-G 14535643-C-G ***
19284024-C-A 17172144-C-A ***
13801148-G-C 11680442-G-C ***
6605511-TTATA-T 6737470-TTATA-T 14×TA***
8403170-GTTTGT-G 8535129-GTTTGT-G 5×TTTGT***
23978505-A-C 21832358-A-C ***
13740184-A-T 11584508-A-T ***
24252938-AC-A 22106791-AC-A P3_b1 ***
13470596-G-A 11314920-G-A ***
8491157-AC-A 8623116-AC-A 9×C***
13450106-CCACTCCACCCCATCCCATCCCATTCTATTCCATTC-C,CCACTCCATTCCATTCCATGCCATTCCATTCCATTT 11294430-CCACTCCACCCCATCCCATCCCATTCTATTCCATTC-C,CCACTCCATTCCATTCCATGCCATTCCATTCCATTT ***
13351186-CAA-C 11195510-CAA-C 20×A***
10980679-C-T ***
17842682-T-G 15730802-T-G ***
4174962-CTTT-C 4306921-CTTT-C 31×T***
10980746-T-C ***
6347733-AGAAAGAAA-A,AGAAGGAAG 6479692-AGAAAGAAA-A,AGAAGGAAG ***
7234334-C-A 7366293-C-A ***
13449399-A-C,T 11293723-A-C,T ***
8558530-CTT-C,CT 8690489-CTT-C,CT 13×T***
10658518-C-G,T ***
6402329-C-A 6534288-C-A ***
13460481-C-A 11304805-C-A ***
2753947-C-A 2885906-C-A ***
6942865-C-A 7074824-C-A ***
7076103-A-G 7208062-A-G ***
7103107-C-A 7235066-C-A ***
7222540-C-A 7354499-C-A ***
8052062-C-A 8184021-C-A ***
8384715-G-T 8516674-G-T ***
8852465-C-A 8984424-C-A ***
9645003-C-T 9807394-C-T IR3_Prx ***
9907178-G-A 10069569-G-A ***
11014396-C-A ***
11014397-C-G ***
13470536-G-T 11314860-G-T ***
13470559-A-G,T 11314883-A-G,T ***
13470639-G-A 11314963-G-A ***
13471774-C-A 11316098-C-A ***
13624334-G-A 11468658-G-A ***
14025794-G-A 11905088-G-A ***
14041814-C-A 11921108-C-A ***
14331154-TTTGC-T 12210448-TTTGC-T ***
15405124-C-A 13293244-C-A ***
15579672-G-A 13467792-G-A ***
16056547-C-A 13944667-C-A ***
16705458-G-T 14593578-G-T ***
18857565-C-T 16745685-C-T 9×T***
19108653-C-A 16996773-C-A ***
21200894-CAA-C,CAAA 19039008-CAA-C,CAAA 14×A***
21318132-C-A 19156246-C-A ***
21909900-C-A 19748014-C-A ***
23006993-A-G 20845107-A-G ***
23745188-CA-C 21583302-CA-C ***
22803983-AAT-A 20642097-AAT-A ***
13222416-GCACTGA-G,GGAAGGA 11066740-GCACTGA-G,GGAAGGA ***
15290982-CTT-C,CT 13179081-CTT-C,CT 17×T***
18761867-C-A 16649987-C-A ***
18761868-C-T 16649988-C-T ***
3548670-ATTT-A,ATT 3680629-ATTT-A,ATT 17×T***
3632441-T-C 3764400-T-C ***
4163744-G-A 4295703-G-A ***
7107084-AT-A,ATT 7239043-AT-A,ATT 14×T***
13446531-ATTCCATTCCATTCCATTCCATTCCATTC-A,ATTCCATTCCATTCCATTCCATTCCACTC 11290855-ATTCCATTCCATTCCATTCCATTCCATTC-A,ATTCCATTCCATTCCATTCCATTCCACTC ***
15834483-A-G 13722603-A-G ***
19505335-T-C 17393455-T-C ***
21276149-A-T 19114263-A-T ***
22803994-ATT-A 20642108-ATT-A 10×T***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Mutation Notes:

Kit POSITION-REF-ALT (hg19) POSITION-REF-ALT (hg38) Note
Manual27139488-C-T24993341-C-T1T
Manual19021450-T-TC16909570-T-TC43 reads show the insertion
Manual19131558-A-G17019678-A-G3A 15G