Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > Z39589 > S1051 > ~19996272-C-T > FGC14899 > FGC14901

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
30949
FGC
5MZY9
18005457-C-T 15893577-C-T FGC14920 P7_Gap Y++
19080260-T-C 16968380-T-C FGC14923 YY++
9105286-C-T 9267677-C-T FGC14905 Y+*
8598395-C-A 8730354-C-A FGC14903 YY++
8302915-G-A 8434874-G-A FGC14902 YY++
16287227-G-A 14175347-G-A FGC14914 YY++
16791459-C-T 14679579-C-T FGC14916 YY++
16796092-G-A 14684212-G-A FGC14917 YY++
2890107-G-A 3022066-G-A FGC14900 YY++
16835486-A-C 14723606-A-C FGC14918 YY++
13843075-G-A 11722369-G-A FGC14907 +*
18069459-G-T 15957579-G-T FGC14921 YY++
18641213-A-T 16529333-A-T FGC14922 YY++
19140100-C-T 17028220-C-T FGC14924 YY++
13678453-GGAATGGAAAGGAATA-G 11522777-GGAATGGAAAGGAATA-G +**
19197886-G-A 17086006-G-A FGC14926 YY++
20819070-T-C 18657184-T-C FGC14927 P4_Gap ++
21186715-CAGAGGTCACT-C 19024829-CAGAGGTCACT-C +**
21783193-A-C 19621307-A-C FGC14930 YY++
14728975-C-T 12617043-C-T FGC14913 YY++
22722922-T-G 20561036-T-G FGC14931 YY++
24398316-C-G 22252169-C-G FGC14932 Y++
14555370-A-G 12443571-A-G FGC14912 YY+*
14318049-T-C 12197343-T-C FGC14910 YY++
14214652-G-T 12093946-G-T FGC14909 YY++
9148529-A-T 9310920-A-T FGC82285 Y+**
15857699-G-A 13745819-G-A CTS4843 **
3185827-T-C 3317786-T-C **
22666119-G-T 20504233-G-T FGC45403 **
22468416-A-G 20306530-A-G FGC82286 DYZ19 *****
18040669-C-A 15928789-C-A **
13463586-C-A 11307910-C-A **
22173133-G-T 20011247-G-T **
8913562-G-T 9045521-G-T **
13646552-AGAATG-A 11490876-AGAATG-A **
14385471-C-A 12264767-C-A **
20617737-G-GA 18455851-G-GA S190 P4_Prx 8×A*****
28253559-G-A 26107412-G-A A10492 P1_b4 ***
28253574-G-A 26107427-G-A P1_b4 ***
28253572-G-A 26107425-G-A P1_b4 ***
28253570-T-A 26107423-T-A P1_b4 ***
28253569-T-A 26107422-T-A P1_b4 ***
28253568-T-A 26107421-T-A P1_b4 ***
28253566-T-A 26107419-T-A P1_b4 ***
28253561-T-C 26107414-T-C P1_b4 ***
28253552-G-A 26107405-G-A P1_b4 ***
28253556-G-A 26107409-G-A P1_b4 ***
28364100-A-G 26217953-A-G P1_gr2 ***
28225632-A-G 26079485-A-G P1_b4 ***
28180774-G-C 26034627-G-C P1_b4 ***
28156907-G-A 26010760-G-A P1_b4 ***
28145176-A-C 25999029-A-C P1_b4 ***
28090628-T-G 25944481-T-G P1_Y2 ***
28071904-G-A 25925757-G-A P1_Y2 ***
27602867-G-T 25456720-G-T P1_Y2 ***
28253578-C-T 26107431-C-T P1_b4 ***
27873300-T-C 25727153-T-C P1_Y2 ***
28015141-C-A 25868994-C-A P1_Y2 ***
28793136-T-G 26646989-T-G ***
27534262-A-G 25388115-A-G P1_Y2 ***
28802826-A-G 26656679-A-G ***
28797902-G-C 26651755-G-C ***
28797901-T-A 26651754-T-A ***
28797900-G-C 26651753-G-C ***
28797898-A-G 26651751-A-G ***
27585886-T-A 25439739-T-A P1_Y2 ***
28793140-T-G 26646993-T-G ***
28793126-G-A 26646979-G-A ***
28406906-G-A 26260759-G-A P1_gr2 ***
28793121-G-T 26646974-G-T ***
28793120-T-G 26646973-T-G ***
28788048-G-A 26641901-G-A ***
28764794-G-C 26618647-G-C ***
28632291-C-A 26486144-C-A ***
28622663-C-A 26476516-C-A ***
28542952-C-A 26396805-C-A ***
28516884-G-A 26370737-G-A ***
27602864-A-T 25456717-A-T P1_Y2 ***
27745639-C-A 25599492-C-A P1_Y2 ***
28007988-G-T 25861841-G-T P1_Y2 ***
27793198-G-T 25647051-G-T P1_Y2 ***
27778206-T-C 25632059-T-C P1_Y2 ***
27778207-G-A 25632060-G-A P1_Y2 ***
27778208-G-A 25632061-G-A P1_Y2 ***
27778209-G-T 25632062-G-T P1_Y2 ***
27780532-C-A 25634385-C-A P1_Y2 ***
27889245-T-A 25743098-T-A P1_Y2 ***
27792160-A-C 25646013-A-C P1_Y2 ***
27807456-G-T 25661309-G-T P1_Y2 ***
27889247-G-A 25743100-G-A P1_Y2 ***
27837937-A-T 25691790-A-T P1_Y2 ***
27842562-G-T 25696415-G-T P1_Y2 ***
27854898-T-A 25708751-T-A P1_Y2 ***
27889243-G-T 25743096-G-T P1_Y2 ***
27889228-T-G 25743081-T-G P1_Y2 ***
27889219-T-G 25743072-T-G P1_Y2 ***
27889215-C-G 25743068-C-G P1_Y2 ***
27889206-T-G 25743059-T-G P1_Y2 ***
27778205-T-C 25632058-T-C P1_Y2 ***
27778204-A-C 25632057-A-C P1_Y2 ***
27976967-T-A 25830820-T-A P1_Y2 ***
27761269-T-G 25615122-T-G P1_Y2 ***
27965836-C-A 25819689-C-A P1_Y2 ***
27958797-C-A 25812650-C-A P1_Y2 ***
27957975-C-G 25811828-C-G P1_Y2 ***
27957864-T-A 25811717-T-A P1_Y2 ***
27957861-T-A 25811714-T-A P1_Y2 ***
27957860-C-A 25811713-C-A P1_Y2 ***
27937918-G-A 25791771-G-A P1_Y2 ***
27898479-G-C 25752332-G-C P1_Y2 ***
27778201-T-A 25632054-T-A P1_Y2 ***
27889252-T-G 25743105-T-G P1_Y2 ***
27889251-C-A 25743104-C-A P1_Y2 ***
27771740-C-T 25625593-C-T P1_Y2 ***
27772621-G-A 25626474-G-A P1_Y2 ***
27778198-A-C 25632051-A-C P1_Y2 ***
28807314-T-C 26661167-T-C ***
27889248-A-G 25743101-A-G P1_Y2 ***
27778199-C-A 25632052-C-A P1_Y2 ***
13430263-C-CAT 11274587-C-CAT ***
58825820-C-A 56765051-G-T ***
28807316-G-C 26661169-G-C ***
25273788-AT-A 23127641-AT-A P2_r1 21×T***
27166209-G-GA 25020062-G-GA P1_g3 11×A***
9713326-GCACA-G 9875717-GCACA-G IR3_Prx 20×CA***
58979152-AAG-GAA 56833005-AAG-GAA ***
28395566-A-AT 26249419-A-AT P1_gr2 12×T***
6308050-GCACA-G 6440009-GCACA-G IR3_Dst 9×CA***
24612840-AT-A 22466693-AT-A P3_t2 16×T***
24671142-CA-C 22524995-CA-C P3_b2 14×A***
20107299-GA-G 17995419-GA-G P5_Dst 24×A***
3550569-CAACTC-AAAAAA 3682528-CAACTC-AAAAAA ***
27311977-CA-C 25165830-CA-C P1_g3 16×A***
19739799-GA-G 17627919-GA-G P5_Prx 16×A***
25883630-CT-C 23737483-CT-C P1_Y1 17×T***
19700241-CA-C 17588361-CA-C P5_Prx 19×A***
25831940-C-CT 23685793-C-CT P1_b3 16×T***
21021632-CT-C 18859746-CT-C P4_Dst 17×T***
13468149-TTG-GTA 11312473-TTG-GTA ***
19831920-AAC-A 17720040-AAC-A P5_Prx 10×AC***
2817709-C-AA 2949668-C-AA 30×A***
4289043-GATCA-TATCG 4421002-GATCA-TATCG ***
20845409-CT-C 18683523-CT-C P4_Dst 13×T***
9215572-GT-G 9377963-GT-G ***
9671339-CT-C 9833730-CT-C IR3_Prx 14×T***
9656115-TGAGCAGCAGAGGGAGGAGCTGG-T 9818506-TGAGCAGCAGAGGGAGGAGCTGG-T IR3_Prx ***
9575622-AT-A 9738013-AT-A IR3_Prx 10×T***
9566727-C-CA 9729118-C-CA IR3_Prx 13×A***
9535155-AT-A 9697546-AT-A IR3_Prx 17×T***
9529142-CT-C 9691533-CT-C IR3_Prx 15×T***
9336682-G-GA 9499073-G-GA 10×A***
9227529-GAA-G 9389920-GAA-G 13×A***
9215562-AGGC-GGGG 9377953-AGGC-GGGG ***
5194004-CT-C 5325963-CT-C ***
9075183-CTTATC-TTTTTT 9237574-CTTATC-TTTTTT ***
8702810-GTTTTT-G 8834769-GTTTTT-G 21×T***
8555547-T-TTTTGTG 8687506-T-TTTTGTG ***
7414303-AAG-A 7546262-AAG-A ***
7270276-C-TT 7402235-C-TT 25×T***
6960237-TAAAA-T 7092196-TAAAA-T 15×A***
6335208-CA-C 6467167-CA-C IR3_Dst 17×A***
6279798-CA-C 6411757-CA-C IR3_Dst 13×A***
13505190-GAC-TAT 11349514-GAC-TAT ***
13484928-ATG-TTC 11329252-ATG-TTC ***
28807317-A-T 26661170-A-T ***
58822242-T-G 56768629-A-C ***
58848108-T-G 56742763-A-C ***
58830344-C-G 56760527-G-C ***
58830343-C-G 56760528-G-C ***
58826974-G-C 56763897-C-G ***
27382640-G-T 25236493-G-T P1_g3 ***
58825819-A-G 56765052-T-C ***
58824886-T-A 56765985-A-T ***
58822244-T-A 56768627-A-T ***
58821950-T-C 56768921-A-G ***
58848254-A-G 56742617-T-C ***
58821949-T-A 56768922-A-T ***
58821948-A-G 56768923-T-C ***
58821947-C-A 56768924-G-T ***
58821946-C-T 56768925-G-A ***
58820520-C-T 56770351-G-A ***
28816144-G-T 26669997-G-T ***
28816141-T-G 26669994-T-G ***
28815132-T-C 26668985-T-C ***
58848120-C-G 56742751-G-C ***
58848256-A-T 56742615-T-A ***
16990247-AG-A 14878367-AG-A ***
58880691-C-T 56710180-G-A ***
15491536-C-CA 13379656-C-CA ***
59030594-A-C 56884447-A-C ***
59030591-A-T 56884444-A-T ***
59022255-G-A 56876108-G-A ***
58993351-G-A 56847204-G-A ***
58982289-A-G 56836142-A-G ***
58908825-C-G 56682046-G-C ***
58908822-A-G 56682049-T-C ***
58880230-A-T 56710641-T-A ***
58856006-C-A 56734865-G-T ***
58873179-A-C 56717692-T-G ***
58873165-A-T 56717706-T-A ***
58862755-A-G 56728116-T-C ***
58856039-T-A 56734832-A-T ***
58856031-C-T 56734840-G-A ***
58856023-A-G 56734848-T-C ***
58856017-C-G 56734854-G-C ***
58856014-T-G 56734857-A-C ***
27427856-C-G 25281709-C-G P1_g3 ***
27233673-G-T 25087526-G-T P1_g3 ***
27381824-T-A 25235677-T-A P1_g3 ***
24865953-A-G 22719806-A-G IR1_R ***
25388378-A-C 23242231-A-C P2_r2 ***
25388374-T-G 23242227-T-G P2_r2 ***
25379019-G-C 23232872-G-C P2_r2 ***
25362560-A-G 23216413-A-G P2_r2 ***
25264625-G-A 23118478-G-A P2_r1 ***
25231902-T-G 23085755-T-G P2_r1 ***
25177351-T-A 23031204-T-A g1 ***
24861639-A-C 22715492-A-C IR1_R ***
25411105-C-A 23264958-C-A P2_r2 ***
24859754-C-A 22713607-C-A IR1_R ***
24791048-C-T 22644901-C-T P3_b2 ***
24783435-C-A 22637288-C-A P3_b2 ***
24781396-T-C 22635249-T-C P3_b2 ***
24778472-A-T 22632325-A-T P3_b2 ***
24778353-T-C 22632206-T-C P3_b2 ***
24778331-C-A 22632184-C-A P3_b2 ***
24766925-G-A 22620778-G-A P3_b2 ***
25411103-T-A 23264956-T-A P2_r2 ***
25422154-G-T 23276007-G-T P2_r2 ***
24739332-C-T 22593185-C-T P3_b2 ***
25679434-G-T 23533287-G-T P1_b3 ***
26292696-G-T 24146549-G-T P1_Y1 ***
26246479-A-C 24100332-A-C P1_Y1 ***
26135601-A-T 23989454-A-T P1_Y1 ***
26010312-A-G 23864165-A-G P1_Y1 ***
26010298-A-G 23864151-A-G P1_Y1 ***
25899758-C-A 23753611-C-A P1_Y1 ***
25766612-A-T 23620465-A-T P1_b3 ***
25690027-G-T 23543880-G-T P1_b3 ***
25660427-G-C 23514280-G-C P1_b3 ***
25426949-A-T 23280802-A-T P2_r2 ***
25656540-C-T 23510393-C-T P1_b3 ***
25651436-A-C 23505289-A-C P1_b3 ***
25592924-A-C 23446777-A-C P1_gr1 ***
25491449-G-A 23345302-G-A P2_r2 ***
25462473-T-C 23316326-T-C P2_r2 ***
25461157-C-A 23315010-C-A P2_r2 ***
25440100-T-C 23293953-T-C P2_r2 ***
25426960-C-A 23280813-C-A P2_r2 ***
24741664-G-T 22595517-G-T P3_b2 ***
24731520-T-A 22585373-T-A P3_b2 ***
26416265-C-A 24270118-C-A P1_Y1 ***
24607276-G-A 22461129-G-A P3_t2 ***
24680299-A-C 22534152-A-C P3_b2 ***
24680298-G-T 22534151-G-T P3_b2 ***
24680297-A-C 22534150-A-C P3_b2 ***
24680296-A-G 22534149-A-G P3_b2 ***
24680295-A-G 22534148-A-G P3_b2 ***
24677761-A-G 22531614-A-G P3_b2 ***
24655780-C-A 22509633-C-A P3_b2 ***
24640538-G-T 22494391-G-T P3_t2 ***
24587844-C-G 22441697-C-G P3_t2 ***
24680301-A-G 22534154-A-G P3_b2 ***
24579655-G-T 22433508-G-T P3_t2 ***
24566453-T-C 22420306-T-C P3_t2 ***
24553945-G-A 22407798-G-A P3_t2 ***
24549642-G-C 22403495-G-C P3_t2 ***
24432627-G-T 22286480-G-T ***
24343480-C-T 22197333-C-T P3_t1 ***
24343478-T-G 22197331-T-G P3_t1 ***
24316851-A-C 22170704-A-C P3_t1 ***
24680300-C-G 22534153-C-G P3_b2 ***
24680305-T-G 22534158-T-G P3_b2 ***
24728982-C-A 22582835-C-A P3_b2 ***
24709600-G-T 22563453-G-T P3_b2 ***
24728547-G-T 22582400-G-T P3_b2 ***
24714120-A-G 22567973-A-G P3_b2 ***
24714113-C-T 22567966-C-T P3_b2 ***
24714112-C-G 22567965-C-G P3_b2 ***
24714107-T-G 22567960-T-G P3_b2 ***
24714105-G-C 22567958-G-C P3_b2 ***
24714103-A-G 22567956-A-G P3_b2 ***
24710683-C-T 22564536-C-T P3_b2 ***
24680318-G-A 22534171-G-A P3_b2 ***
24680307-T-G 22534160-T-G P3_b2 ***
24680317-G-C 22534170-G-C P3_b2 ***
24680316-T-A 22534169-T-A P3_b2 ***
24680315-C-G 22534168-C-G P3_b2 ***
24680313-A-G 22534166-A-G P3_b2 ***
24680312-C-A 22534165-C-A P3_b2 ***
24680311-T-A 22534164-T-A P3_b2 ***
24680310-A-T 22534163-A-T P3_b2 ***
24680309-C-A 22534162-C-A P3_b2 ***
26416264-C-T 24270117-C-T P1_Y1 ***
26416267-G-A 24270120-G-A P1_Y1 ***
27375822-A-T 25229675-A-T P1_g3 ***
27033046-C-T 24886899-C-T P1_r4 ***
27151300-A-C 25005153-A-C P1_g3 ***
27149695-T-A 25003548-T-A P1_g3 ***
27131569-T-G 24985422-T-G P1_g3 ***
27080501-A-T 24934354-A-T P1_r4 ***
27080494-G-T 24934347-G-T P1_r4 ***
27035425-G-T 24889278-G-T P1_r4 ***
27033051-G-T 24886904-G-T P1_r4 ***
27033049-A-C 24886902-A-C P1_r4 ***
27030486-T-C 24884339-T-C P1_r4 ***
27156249-A-T 25010102-A-T P1_g3 ***
26993696-G-T 24847549-G-T P1_r4 ***
26993594-A-G 24847447-A-G P1_r4 ***
26992945-C-A 24846798-C-A P1_r4 ***
26992936-C-T 24846789-C-T P1_r4 ***
26990069-C-T 24843922-C-T P1_r4 ***
26953166-G-C 24807019-G-C P1_r3 ***
26943759-A-G 24797612-A-G P1_r3 ***
26914067-G-T 24767920-G-T P1_r3 ***
27154703-T-C 25008556-T-C P1_g3 ***
27167874-T-G 25021727-T-G P1_g3 ***
26914047-C-T 24767900-C-T P1_r3 ***
27300823-T-C 25154676-T-C P1_g3 ***
27362789-C-A 25216642-C-A P1_g3 ***
27354843-A-T 25208696-A-T P1_g3 ***
27344272-T-C 25198125-T-C P1_g3 ***
27315566-G-T 25169419-G-T P1_g3 ***
27315343-A-C 25169196-A-C P1_g3 ***
27311995-T-G 25165848-T-G P1_g3 ***
27300998-T-A 25154851-T-A P1_g3 ***
27300845-G-T 25154698-G-T P1_g3 ***
27300099-A-G 25153952-A-G P1_g3 ***
27217562-A-T 25071415-A-T P1_g3 ***
27299097-T-A 25152950-T-A P1_g3 ***
27271119-G-A 25124972-G-A P1_g3 ***
27256433-G-A 25110286-G-A P1_g3 ***
27234696-G-T 25088549-G-T P1_g3 ***
9725539-CT-C 9887930-CT-C IR3_Prx ***
27233583-A-C 25087436-A-C P1_g3 ***
27231451-G-A 25085304-G-A P1_g3 ***
27217588-T-A 25071441-T-A P1_g3 ***
26914064-C-T 24767917-C-T P1_r3 ***
26914044-C-T 24767897-C-T P1_r3 ***
26416269-C-A 24270122-C-A P1_Y1 ***
26416329-C-A 24270182-C-A P1_Y1 ***
26416342-C-A 24270195-C-A P1_Y1 ***
26416341-C-A 24270194-C-A P1_Y1 ***
26416340-G-A 24270193-G-A P1_Y1 ***
26416339-C-A 24270192-C-A P1_Y1 ***
26416337-C-A 24270190-C-A P1_Y1 ***
26416336-T-A 24270189-T-A P1_Y1 ***
26416335-C-A 24270188-C-A P1_Y1 ***
26416332-T-A 24270185-T-A P1_Y1 ***
26416328-G-A 24270181-G-A P1_Y1 ***
26416344-G-A 24270197-G-A P1_Y1 ***
26416327-T-A 24270180-T-A P1_Y1 ***
26416326-G-A 24270179-G-A P1_Y1 ***
26416325-G-A 24270178-G-A P1_Y1 ***
26416324-G-A 24270177-G-A P1_Y1 ***
26416323-T-A 24270176-T-A P1_Y1 ***
26416322-C-A 24270175-C-A P1_Y1 ***
26416321-G-A 24270174-G-A P1_Y1 ***
26416320-G-A 24270173-G-A P1_Y1 ***
26416343-T-A 24270196-T-A P1_Y1 ***
26416345-T-A 24270198-T-A P1_Y1 ***
26912594-T-C 24766447-T-C P1_r3 ***
26529480-G-T 24383333-G-T P1_g2 ***
26902359-G-A 24756212-G-A P1_r3 ***
26902356-G-A 24756209-G-A P1_r3 ***
26902353-T-A 24756206-T-A P1_r3 ***
26902340-G-A 24756193-G-A P1_r3 ***
26902334-T-C 24756187-T-C P1_r3 ***
26884393-C-G 24738246-C-G P1_r3 ***
26884356-T-G 24738209-T-G P1_r3 ***
26529496-G-T 24383349-G-T P1_g2 ***
26416360-G-A 24270213-G-A P1_Y1 ***
26416348-T-A 24270201-T-A P1_Y1 ***
26416359-T-A 24270212-T-A P1_Y1 ***
26416358-T-A 24270211-T-A P1_Y1 ***
26416357-T-A 24270210-T-A P1_Y1 ***
26416356-C-A 24270209-C-A P1_Y1 ***
26416353-G-A 24270206-G-A P1_Y1 ***
26416351-C-A 24270204-C-A P1_Y1 ***
26416350-C-A 24270203-C-A P1_Y1 ***
26416349-C-A 24270202-C-A P1_Y1 ***
9700802-AAT-A 9863193-AAT-A IR3_Prx ***
13453414-TATTTCATG-CATTCCATT 11297738-TATTTCATG-CATTCCATT ***
9732895-CAAA-C 9895286-CAAA-C IR3_Prx 20×A***
27780449-C-CA 25634302-C-CA P1_Y2 18×A***
27994688-TA-T 25848541-TA-T P1_Y2 13×A***
27957956-AGACTGAGGCTTATTTCT-CTGTCTCTTATACACATC 25811809-AGACTGAGGCTTATTTCT-CTGTCTCTTATACACATC P1_Y2 ***
27881475-CT-C 25735328-CT-C P1_Y2 12×T***
27868124-C-CA 25721977-C-CA P1_Y2 13×A***
27808854-T-TA 25662707-T-TA P1_Y2 10×A***
27794677-CATATATATAT-C 25648530-CATATATATAT-C P1_Y2 12×AT***
27791904-C-CTCTTCT 25645757-C-CTCTTCT P1_Y2 25×TCT***
27760365-G-GT 25614218-G-GT P1_Y2 9×T***
28010760-TGGTA-CTGTC 25864613-TGGTA-CTGTC P1_Y2 ***
27760106-CA-C 25613959-CA-C P1_Y2 16×A***
27739907-G-GA 25593760-G-GA P1_Y2 10×A***
27719028-CCTGG-C 25572881-CCTGG-C P1_Y2 5×CTGG***
27665355-AAT-A 25519208-AAT-A P1_Y2 ***
27583000-CTT-C 25436853-CTT-C P1_Y2 22×T***
27550462-CT-C 25404315-CT-C P1_Y2 13×T***
27477668-T-TA 25331521-T-TA P1_Y2 8×A***
27433614-TAG-T 25287467-TAG-T P1_g3 ***
28010653-AAATTCCT-GTGTATAA 25864506-AAATTCCT-GTGTATAA P1_Y2 ***
28033129-CAAAAA-C 25886982-CAAAAA-C P1_Y2 17×A***
27427485-CA-C 25281338-CA-C P1_g3 8×A***
28585643-GTTAT-G 26439496-GTTAT-G ***
58821862-GATTCC-G 56768990-TAATGG-T ***
58820412-TA-C 56770458-TA-G ***
28805345-CA-AT 26659198-CA-AT ***
28803845-AG-TA 26657698-AG-TA ***
28802841-TTGG-GCGA 26656694-TTGG-GCGA ***
28802831-ATTGAG-GTGGAC 26656684-ATTGAG-GTGGAC ***
28788027-GGAG-TGAA 26641880-GGAG-TGAA ***
28585667-CTG-GTA 26439520-CTG-GTA ***
28545693-CTAC-TTTA 26399546-CTAC-TTTA ***
28103658-GT-G 25957511-GT-G P1_Y2 ***
28453895-C-CA 26307748-C-CA P1_gr2 14×A***
28406839-CA-C 26260692-CA-C P1_gr2 16×A***
28384346-TAAAAATGTATAAAGTAAAAAAATTATAGTA-T 26238199-TAAAAATGTATAAAGTAAAAAAATTATAGTA-T P1_gr2 ***
28359941-GACAAAA-G 26213794-GACAAAA-G P1_gr2 ***
28230906-TATTCATACAGTTGACTGGAAA-T 26084759-TATTCATACAGTTGACTGGAAA-T P1_b4 ***
28228315-C-CA 26082168-C-CA P1_b4 11×A***
28180717-AG-A 26034570-AG-A P1_b4 ***
28103948-TC-T 25957801-TC-T P1_Y2 ***
27427815-GA-G 25281668-GA-G P1_g3 14×A***
27412865-ATG-A 25266718-ATG-A P1_g3 17×TG***
58822803-AT-A 56768060-CA-C ***
25651595-TCTTC-T 23505448-TCTTC-T P1_b3 ***
26179768-AAC-A 24033621-AAC-A P1_Y1 ***
26167728-GTATA-G 24021581-GTATA-G P1_Y1 12×TA***
26102968-CTTTA-TTTTT 23956821-CTTTA-TTTTT P1_Y1 ***
25940445-CTT-C 23794298-CTT-C P1_Y1 17×T***
25781074-G-GT 23634927-G-GT P1_b3 12×T***
25689959-T-TA 23543812-T-TA P1_b3 13×A***
25675939-TA-T 23529792-TA-T P1_b3 10×A***
25675782-TA-T 23529635-TA-T P1_b3 12×A***
25626843-AAG-A 23480696-AAG-A P1_b3 ***
26277532-CT-C 24131385-CT-C P1_Y1 ***
25466562-AGGGA-GGGGG 23320415-AGGGA-GGGGG P2_r2 ***
25466146-G-GA 23319999-G-GA P2_r2 12×A***
25462499-TCTT-AGACA 23316352-TCTT-AGACA P2_r2 ***
25462474-TTGGTTACTGTAGCTTAGTA-GTCGGCAGCGTCAGATGTGT 23316327-TTGGTTACTGTAGCTTAGTA-GTCGGCAGCGTCAGATGTGT P2_r2 ***
25460841-A-AG 23314694-A-AG P2_r2 ***
25452458-GT-G 23306311-GT-G P2_r2 13×T***
25445578-CTGTATATATATATATATATATA-C 23299431-CTGTATATATATATATATATATA-C P2_r2 ***
25426962-A-AT 23280815-A-AT P2_r2 10×T***
26269442-GA-G 24123295-GA-G P1_Y1 14×A***
26416270-TCCCCA-T 24270123-TCCCCA-T P1_Y1 ***
27357557-TAA-T 25211410-TAA-T P1_g3 14×A***
27033095-C-CT 24886948-C-CT P1_r4 17×T***
27357387-AGACAGTGAT-CGGCAGCGTC 25211240-AGACAGTGAT-CGGCAGCGTC P1_g3 ***
27315588-G-GA 25169441-G-GA P1_g3 10×A***
27233561-CAAA-C 25087414-CAAA-C P1_g3 ***
27232906-CT-C 25086759-CT-C P1_g3 ***
27214310-CT-C 25068163-CT-C P1_g3 10×T***
27186323-GA-G 25040176-GA-G P1_g3 19×A***
27181012-TG-T 25034865-TG-T P1_g3 ***
27173659-G-AAA 25027512-G-AAA P1_g3 13×A***
27029157-AT-A 24883010-AT-A P1_r4 ***
26541535-TA-T 24395388-TA-T P1_g2 21×A***
26992907-GT-G 24846760-GT-G P1_r4 24×T***
26990934-CT-C 24844787-CT-C P1_r4 17×T***
26942264-G-GA 24796117-G-GA P1_r3 ***
26912706-CA-C 24766559-CA-C P1_r3 14×A***
26900285-AAG-A 24754138-AAG-A P1_r3 ***
26890135-GATATATAT-G 24743988-GATATATAT-G P1_r3 20×AT***
26880197-TC-T 24734050-TC-T P1_r3 ***
26834526-C-CAAGA 24688379-C-CAAGA P1_g2 ***
58822245-TC-T 56768624-CG-C ***
58823386-TATC-CATT 56767482-GATA-AATG ***
25403566-TG-T 23257419-TG-T P2_r2 ***
20084452-CTTTCTTTC-TTTTTTTTTTTT 17972572-CTTTCTTTC-TTTTTTTTTTTT P5_Dst ***
22361071-CTA-AG 20199185-CTA-AG DYZ19 ***
13709505-AGCTCCAATGGAATGGAG-GGC 11553829-AGCTCCAATGGAATGGAG-GGC ***
23505519-C-AAA 21343633-C-AAA ***
24096551-AATAAAAGCT-TAAGAGACAG 21950404-AATAAAAGCT-TAAGAGACAG P3_b1 ***
13833405-TTGATTA-CAGATTG 11712699-TTGATTA-CAGATTG ***
4288981-AAACAA-GAAC 4420940-AAACAA-GAAC ***
9745961-GGTAGCTAGGC-TATAAGAGACA 9908352-GGTAGCTAGGC-TATAAGAGACA ***
13472112-CGCACGCGCA-TGCATGCGAG 11316436-CGCACGCGCA-TGCATGCGAG ***
20508989-TAGAGAGAGAGAG-AGATGTGTATA 18347103-TAGAGAGAGAGAG-AGATGTGTATA P5_Dst 8×AG***
13809821-TTGGACTT-ATG 11689115-TTGGACTT-ATG ***
20087301-CAGACAGTCCATGTGAGT-GATGTGTATAAGAGACA 17975421-CAGACAGTCCATGTGAGT-GATGTGTATAAGAGACA P5_Dst ***
20434280-TA-T 18272394-TA-T P5_Dst 18×A***
13811031-TTCGAATGGAA-CTTGAATGGAT 11690325-TTCGAATGGAA-CTTGAATGGAT ***
16162115-G-AA 14050235-G-AA P8_Dst ***
23435202-C-TT 21273316-C-TT ***
26228681-CTTTCTTTC-TTTTTT 24082534-CTTTCTTTC-TTTTTT P1_Y1 ***
22520812-G-AA 20358926-G-AA ***
22970310-T-AA 20808424-T-AA ***
58824883-CC-A 56765987-GG-T ***
13810172-AA-TG 11689466-AA-TG ***
25207874-G-AAA 23061727-G-AAA P2_r1 ***
13143656-AC-GG 10633142-AC-GG ***
26060208-GACT-A 23914061-GACT-A P1_Y1 ***
21556943-GTC-TT 19395057-GTC-TT ***
58974437-ATTCGA-T 56828290-ATTCGA-T ***
58976110-TAC-CAT 56829963-TAC-CAT ***
22504956-TG-AGT 20343070-TG-AGT DYZ19 ***
58974458-ATCA-TTCC 56828311-ATCA-TTCC ***
25333827-TAGC-AAAA 23187680-TAGC-AAAA P2_r1 ***
20428562-TG-AA 18266676-TG-AA P5_Dst ***
19829294-ACTTTC-TTT 17717414-ACTTTC-TTT P5_Prx ***
22293342-TT-G 20131456-TT-G DYZ19 ***
26902321-GAAATAG-AAAA 24756174-GAAATAG-AAAA P1_r3 ***
13825036-AAC-CAGA 11704330-AAC-CAGA ***
19979863-GC-T 17867983-GC-T P5_Prx ***
22268536-CTTTAC-ATTGGT 20106650-CTTTAC-ATTGGT DYZ19 ***
9941298-TAA-CAG 10103689-TAA-CAG ***
27971764-CACAAAG-AAAA 25825617-CACAAAG-AAAA P1_Y2 ***
19052443-GAAAG-AAAAA 16940563-GAAAG-AAAAA ***
26914069-ATTAAGTTCTAC-T 24767922-ATTAAGTTCTAC-T P1_r3 ***
58823397-ATTTTATTGCATTAGATTCTATTCCATTGGATTACT-GTTTTATTGCATTAGATTCTA 56767439-AGTAATCCAATGGAATAGAATCTAATGCAATAAAAT-TAGAATCTAATGCAATAAAAC ***
14743174-G-AA 12631242-G-AA ***
58825521-CTTCCATTCGATTCCA-C 56765327-CAATGGAATGGAATCG-C ***
58973830-GATTT-TATTC 56827683-GATTT-TATTC ***
58979908-GT-CA 56833761-GT-CA ***
58979661-TTTAC-ATTAT 56833514-TTTAC-ATTAT ***
58979543-ATCAA-GTCAC 56833396-ATCAA-GTCAC ***
58978989-GCCAG-TCCAC 56832842-GCCAG-TCCAC ***
58977628-CTCCC-TTCCA 56831481-CTCCC-TTCCA ***
58977617-TCTCCAC-ATTCAAT 56831470-TCTCCAC-ATTCAAT ***
58976766-ACATTCTATAA-CCACAACATTC 56830619-ACATTCTATAA-CCACAACATTC ***
58976492-TTG-CTC 56830345-TTG-CTC ***
58972058-AT-CA 56825911-AT-CA ***
58982081-AAT-CAC 56835934-AAT-CAC ***
58910665-ATTCCATTCCATTCCATTCCATTTCATATTG-A 56680162-TGAATGGAATGGAACAATATGAAATGGAATG-T ***
58882846-TC-T 56708023-CG-C ***
58873167-TA-AT 56717703-TA-AT ***
58862994-GATTTG-CATTAT 56727872-CAAATC-ATAATG ***
58862488-GCATTC-G 56728358-CAATGG-C 4×CATTC***
58831311-G-GATTCCATTCCTTTCC 56759534-T-TGGAATGGAATGGAAA ***
58829600-GTACGAT-TTTCGAA 56761265-ATCGTAC-TTCGAAA ***
58825903-CCCATT-C 56764945-AGGAAT-A 4×CCATT***
58981931-CTGCAT-GTCCAC 56835784-CTGCAT-GTCCAC ***
58982115-CCAT-ACAC 56835968-CCAT-ACAC ***
19892861-ATTTCTTG-TTTTTTT 17780981-ATTTCTTG-TTTTTTT P5_Prx ***
59030571-TTTAT-AATATA 56884424-TTTAT-AATATA ***
13865775-GAATCGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAAT-CTATCGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAGGCGAAA 11745069-GAATCGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAAT-CTATCGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAATGGAGGCGAAA ***
9591034-G-AA 9753425-G-AA IR3_Prx 12×A***
5785701-C-AA 5917660-C-AA 14×A***
9403543-G-TT 9565934-G-TT ***
9307401-TGTGTGTG-AGTT 9469792-TGTGTGTG-AGTT ***
16107436-GTTTCAG-TTTTTTTTTT 13995556-GTTTCAG-TTTTTTTTTT P8_Prx ***
7387383-CTTTCTTTCTTCTA-TTTTTTTTTTTTTTT 7519342-CTTTCTTTCTTCTA-TTTTTTTTTTTTTTT ***
4976809-G-AA 5108768-G-AA ***
2795555-ATTTG-TTTT 2927514-ATTTG-TTTT ***
58982279-GT-AC 56836132-GT-AC ***
18688521-C-AA 16576641-C-AA ***
26100508-AGT-A 23954361-AGT-A P1_Y1 ***
20757362-AT-A 18595476-AT-A P4_Prx 32×T***
58993292-CA-TG 56847145-CA-TG ***
58988582-C-CT 56842435-C-CT ***
58983207-TCA-CCG 56837060-TCA-CCG ***
58983182-CTAC-GCAT 56837035-CTAC-GCAT ***
58982322-GCT-CCA 56836175-GCT-CCA ***
25412886-CT-C 23266739-CT-C P2_r2 ***
25312610-AAG-A 23166463-AAG-A P2_r1 ***
9798063-GTTTT-G 9960454-GTTTT-G 17×T***
13731762-TC-GG 11576086-TC-GG ***
13825065-ATGCAATGG-GTATAATTT 11704359-ATGCAATGG-GTATAATTT ***
13819959-T-TGAATGGAATG 11699253-T-TGAATGGAATG 14×GAATG***
13809794-AAGTGGAA-GACTGGGG 11689088-AAGTGGAA-GACTGGGG ***
13809728-ATAAA-CAATT 11689022-ATAAA-CAATT ***
13803166-AA-TG 11682460-AA-TG ***
13799165-C-TGAAAGCAATG 11678459-C-TGAAAGCAATG ***
13799151-TAAT-GAAG 11678445-TAAT-GAAG ***
13723359-GTCA-CTCG 11567683-GTCA-CTCG ***
13847132-ATCAAAA-TCGAATG 11726426-ATCAAAA-TCGAATG ***
13722651-AC-TG 11566975-AC-TG ***
13716685-T-TGGAAA 11561009-T-TGGAAA ***
13714719-AGGAA-TGGAC 11559043-AGGAA-TGGAC ***
13714172-CACTC-TACTG 11558496-CACTC-TACTG ***
13714041-CA-GG 11558365-CA-GG ***
13714019-ATGGACTCGAATGGAGAA-CTCGATCAGAACGGACTG 11558343-ATGGACTCGAATGGAGAA-CTCGATCAGAACGGACTG ***
13714007-C-CAATGA 11558331-C-CAATGA ***
13709578-CA-TT 11553902-CA-TT ***
13846570-CAG-TAA 11725864-CAG-TAA ***
13858499-AGT-GGA 11737793-AGT-GGA ***
13702690-CA-C 11547014-CA-C ***
16772435-ATTTT-A 14660555-ATTTT-A 17×T***
18455834-G-GTC 16343954-G-GTC P6_Dst ***
18429196-C-CAA 16317316-C-CAA P6_Dst 17×A***
18012134-AT-A 15900254-AT-A P7_Dst 11×T***
17989585-TAC-T 15877705-TAC-T P7_Prx 9×AC***
17648009-CAAAAAA-C 15536129-CAAAAAA-C 17×A***
17361058-C-CAA 15249178-C-CAA 25×A***
17128526-TTTCAAAATC-CTTTTAAAAA 15016646-TTTCAAAATC-CTTTTAAAAA ***
16909178-CTTTT-C 14797298-CTTTT-C 16×T***
16340147-G-AA 14228267-G-AA 22×A***
13859477-CTCGAAAG-ATCAAATA 11738771-CTCGAAAG-ATCAAATA ***
16164521-AC-TA 14052641-AC-TA P8_Dst ***
16157801-ATG-GAA 14045921-ATG-GAA P8_Dst ***
16157793-ACTTTCC-GAAGGAA 14045913-ACTTTCC-GAAGGAA P8_Dst ***
16157672-CAACTTAGTCAATAACTAGCCTTCAAAATAAAT-GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG 14045792-CAACTTAGTCAATAACTAGCCTTCAAAATAAAT-GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG P8_Dst ***
15320664-G-AGAA 13208764-GGAAGAGGAA-G 18×GAA***
13861578-GGATTGGAGTGGA-CGAATGAACTGGG 11740872-GGATTGGAGTGGA-CGAATGAACTGGG ***
13861483-CAAG-TGAA 11740777-CAAG-TGAA ***
13859491-TCT-ACG 11738785-TCT-ACG ***
13704404-TACTCA-GAATGG 11548728-TACTCA-GAATGG ***
13701778-TGAATC-ACAAGA 11546102-TGAATC-ACAAGA ***
18490252-CT-C 16378372-CT-C P6_Dst 11×T***
13203958-CATTATGGATGACCACCCCGCCTC-TGATAATGGTGATAATGACGGTAT 11048282-CATTATGGATGACCACCCCGCCTC-TGATAATGGTGATAATGACGGTAT ***
13456090-TA-AT 11300414-TA-AT ***
13456016-GTTGAT-G 11300340-GTTGAT-G ***
13455657-GG-TC 11299981-GG-TC ***
24112750-G-C 21966603-G-C P3_b1 ***
13453405-TA-AT 11297729-TA-AT ***
13453123-T-TCATTCCATTC 11297447-T-TCATTCCATTC 14×CATTC***
13447763-TC-CA 11292087-TC-CA ***
13253523-GGAT-AGAC 11097847-GGAT-AGAC ***
10104537-GAACTATGTCGGA-TATCCACTTTCAG 10266928-GAACTATGTCGGA-TATCCACTTTCAG ***
13466461-AAATG-TAAAT 11310785-AAATG-TAAAT ***
10043477-TG-CA 10205868-TG-CA ***
10012701-CTGG-TTGT 10175092-CTGG-TTGT ***
9995971-TG-CA 10158362-TG-CA ***
9987528-AGAGCG-GGAACA 10149919-AGAGCG-GGAACA ***
9952535-TGC-CGT 10114926-TGC-CGT ***
9945024-CAGAT-TAGAC 10107415-CAGAT-TAGAC ***
9941347-CC-TT 10103738-CC-TT ***
9936818-AG-CA 10099209-AG-CA ***
13463768-G-TC 11308092-G-TC ***
13468192-CTTAT-GTTAC 11312516-CTTAT-GTTAC ***
13701770-CATT-TATG 11546094-CATT-TATG ***
13484967-CTGT-TTGC 11329291-CTGT-TTGC ***
13701338-GAACTC-CGAACG 11545662-GAACTC-CGAACG ***
13701321-ATGGAAGGGAATA-TTTGAACAGATTG 11545645-ATGGAAGGGAATA-TTTGAACAGATTG ***
13700228-ATG-GTA 11544552-ATG-GTA ***
13697388-C-CTATGGAATGGAATGGAATGGAATGG 11541712-C-CTATGGAATGGAATGGAATGGAATGG ***
13691232-CGC-GGG 11535556-CGC-GGG ***
13487755-AACCCCCCGGCCA-CACCCCCCAGCCG 11332079-AACCCCCCGGCCA-CACCCCCCAGCCG ***
13485852-CACCG-TACCA 11330176-CACCG-TACCA ***
13485613-AATG-GATT 11329937-AATG-GATT ***
13484389-CAAT-AAAC 11328713-CAAT-AAAC ***
13472128-TG-CT 11316452-TG-CT ***
13480942-CTGGGTGATCA-ATAAGAGACAG 11325266-CTGGGTGATCA-ATAAGAGACAG ***
13480641-TGC-AGA 11324965-TGC-AGA ***
13480632-TTCCT-CTCCC 11324956-TTCCT-CTCCC ***
13480582-CCA-GCG 11324906-CCA-GCG ***
13479048-AGGCA-CGGCG 11323372-AGGCA-CGGCG ***
13478187-CACCGGGGCGGC-TGCCTGGGCAG 11322511-CACCGGGGCGGC-TGCCTGGGCAG ***
13473684-CT-GA 11318008-CT-GA ***
13473678-AC-A 11318002-AC-A ***
18462594-C-CAT 16350714-C-CAT P6_Dst ***
19339964-CGGAA-TTCTT 17228084-CGGAA-TTCTT ***
25303350-GA-G 23157203-GA-G P2_r1 ***
24025717-GA-G 21879570-GA-G ***
24577903-AG-A 22431756-AG-A P3_t2 ***
24555038-GT-G 22408891-GT-G P3_t2 14×T***
24336793-C-TT 22190646-C-TT P3_t1 20×T***
24295863-CT-C 22149716-CT-C P3_t1 17×T***
24235386-GG-TT 22089239-GG-TT P3_b1 ***
24096349-CA-C 21950202-CA-C P3_b1 16×A***
24045400-CCCCCC-GAGACA 21899253-CCCCCC-GAGACA ***
24045304-ATT-A 21899157-ATT-A ***
23900998-C-CTAA 21739112-C-CTAA ***
24658480-CTTT-C 22512333-CTTT-C P3_b2 14×T***
23897027-GCCAG-ACCAT 21735141-GCCAG-ACCAT ***
23666260-AAGTGT-A 21504374-AAGTGT-A ***
23267044-C-CTT 21105158-C-CTT 13×T***
22503218-TC-T 20341332-TC-T DYZ19 ***
22503151-CAGAA-AAGAG 20341265-CAGAA-AAGAG DYZ19 ***
22490958-AT-GA 20329072-AT-GA DYZ19 ***
22448697-TC-T 20286811-TC-T DYZ19 ***
22427194-CT-AG 20265308-CT-AG DYZ19 ***
24587845-TGCTG-AGACA 22441698-TGCTG-AGACA P3_t2 ***
24711544-GT-G 22565397-GT-G P3_b2 11×T***
22358173-TTTCG-GTTCA 20196287-TTTCG-GTTCA DYZ19 ***
24830466-CAACAAC-AAAAAAA 22684319-CAACAAC-AAAAAAA P3_b2 ***
25300961-GA-G 23154814-GA-G P2_r1 ***
25289839-G-GT 23143692-G-GT P2_r1 8×T***
25288412-T-TA 23142265-T-TA P2_r1 17×A***
25272972-G-GA 23126825-G-GA P2_r1 19×A***
24966789-GTCAC-CTGAAA 22820642-GTCAC-CTGAAA g1 ***
24895715-GTTG-TTTT 22749568-GTTG-TTTT g1 ***
24895633-GA-G 22749486-GA-G g1 17×A***
24860018-C-AAAA 22713871-C-AAAA IR1_R 27×A***
24796652-GT-G 22650505-GT-G P3_b2 8×T***
24712699-GTAA-G 22566552-GTAA-G P3_b2 ***
24778646-CAG-TCT 22632499-CAG-TCT P3_b2 ***
24778641-AGAC-CTGT 22632494-AGAC-CTGT P3_b2 ***
24760630-T-TA 22614483-T-TA P3_b2 15×A***
24760000-T-TTA 22613853-T-TTA P3_b2 11×TA***
24754928-TAA-T 22608781-TAA-T P3_b2 15×A***
24739651-CT-C 22593504-CT-C P3_b2 13×T***
24731521-GG-CA 22585374-GG-CA P3_b2 ***
24718255-AGGAGAGAATAT-GTATAAGAGACA 22572108-AGGAGAGAATAT-GTATAAGAGACA P3_b2 ***
22365272-ATGTGTCCAG-A 20203386-ATGTGTCCAG-A DYZ19 ***
22341580-CA-TG 20179694-CA-TG DYZ19 ***
19647571-CT-C 17535691-CT-C P5_Prx 16×T***
20194878-A-AT 18032992-A-AT P5_Dst 10×T***
20230740-AAT-GAC 18068854-AAT-GAC P5_Dst ***
20230695-GTATG-CTATA 18068809-GTATG-CTATA P5_Dst ***
20230667-TTT-CTG 18068781-TTT-CTG P5_Dst ***
20213749-ATT-A 18051863-ATT-A P5_Dst 14×T***
20210969-AC-A 18049083-AC-A P5_Dst ***
20207102-CA-C 18045216-CA-C P5_Dst 10×A***
20197205-G-GA 18035319-G-GA P5_Dst 14×A***
20195017-CA-C 18033131-CA-C P5_Dst ***
20142001-A-AT 18030121-A-AT P5_Dst 9×T***
20318892-TAA-T 18157006-TAA-T P5_Dst 27×A***
20130900-G-GT 18019020-G-GT P5_Dst 9×T***
20110561-GA-G 17998681-GA-G P5_Dst 20×A***
20096718-C-CA 17984838-C-CA P5_Dst 10×A***
20084495-CTTTC-TTTTT 17972615-CTTTC-TTTTT P5_Dst ***
20022467-TC-T 17910587-TC-T P5_Prx ***
19868141-GCTTC-TTTTT 17756261-GCTTC-TTTTT P5_Prx ***
19811648-TC-AA 17699768-TC-AA P5_Prx ***
19682363-G-GAAAT 17570483-G-GAAAT P5_Prx ***
20252819-AAG-A 18090933-AAG-A P5_Dst ***
20345145-GC-G 18183259-GC-G P5_Dst ***
22295980-GGTCC-TGTCT 20134094-GGTCC-TGTCT DYZ19 ***
20917254-CAA-C 18755368-CAA-C P4_Dst 14×A***
22284901-CTTCT-C 20123015-CTTCT-C DYZ19 ***
22247015-GATAAGTC-TATGTCTA 20085129-GATAAGTC-TATGTCTA DYZ19 ***
22241181-TAA-CAT 20079295-TAA-CAT DYZ19 ***
22237314-CC-AA 20075428-CC-AA DYZ19 ***
21503994-ATTTTTT-A 19342108-ATTTTTT-A 19×T***
21306618-GAAAGAAAG-AAAAAAAAA 19144732-GAAAGAAAG-AAAAAAAAA ***
20951304-TA-T 18789418-TA-T P4_Dst 12×A***
20920178-CA-C 18758292-CA-C P4_Dst 14×A***
20872423-TCTGA-CCTGG 18710537-TCTGA-CCTGG P4_Dst ***
20347544-ATTAT-A 18185658-ATTAT-A P5_Dst 5×TTAT***
20859789-GAA-G 18697903-GAA-G P4_Dst 13×A***
20717091-GAACG-AAAAA 18555205-GAACG-AAAAA P4_Prx ***
20717075-CACAACAAC-AAAAAAAAA 18555189-CACAACAAC-AAAAAAAAA P4_Prx ***
20650558-AT-A 18488672-AT-A P4_Prx 17×T***
20588355-G-GA 18426469-G-GA P5_Dst 9×A***
20420267-GA-G 18258381-GA-G P5_Dst ***
20404505-CTC-TTT 18242619-CTC-TTT P5_Dst ***
20348015-A-ATT 18186129-A-ATT P5_Dst 11×T***
24157146-A-G 22010999-A-G P3_b1 ***
23750420-A-C 21588534-A-C ***
24096549-G-T 21950402-G-T P3_b1 ***
13143892-C-A 10633378-C-A ***
13143903-T-C 10633389-T-C ***
13143901-A-C 10633387-A-C ***
13143900-C-A 10633386-C-A ***
13143896-A-T 10633382-A-T ***
13143895-C-A 10633381-C-A ***
13143894-C-G 10633380-C-G ***
13143893-A-G 10633379-A-G ***
13143891-A-C 10633377-A-C ***
13143908-T-A 10633394-T-A ***
13143890-C-A 10633376-C-A ***
13143889-T-G 10633375-T-G ***
13143885-C-T 10633371-C-T ***
13143020-A-C 10632506-A-C ***
13140563-C-A 10630049-C-A ***
13140112-A-G 10629598-A-G ***
13140111-A-T 10629597-A-T ***
13140110-C-T 10629596-C-T ***
13143905-T-A 10633391-T-A ***
13143909-G-A 10633395-G-A ***
13140108-T-A 10629594-T-A ***
13253414-G-T 11097738-G-T ***
13351008-A-T 11195332-A-T ***
13331215-T-G 11175539-T-G ***
13329338-C-G 11173662-C-G ***
13323527-T-C 11167851-T-C ***
13308920-C-A 11153244-C-A ***
13287471-T-C 11131795-T-C ***
13275983-C-T 11120307-C-T ***
13275918-C-T 11120242-C-T ***
13253412-C-T 11097736-C-T ***
13143910-C-A 10633396-C-A ***
13253410-C-T 11097734-C-T ***
13253409-C-T 11097733-C-T ***
13214821-G-T 11059145-G-T ***
13209900-C-A 11054224-C-A ***
13208090-A-T 11052414-A-T ***
13143913-T-G 10633399-T-G ***
13143912-C-A 10633398-C-A ***
13143911-A-C 10633397-A-C ***
13140109-C-T 10629595-C-T ***
13140105-C-T 10629591-C-T ***
13421156-A-G 11265480-A-G ***
9942959-A-T 10105350-A-T ***
9995980-A-G 10158371-A-G ***
9995964-C-A 10158355-C-A ***
9991965-A-G 10154356-A-G ***
9963199-A-G 10125590-A-G ***
9961489-C-A 10123880-C-A ***
9956771-T-C 10119162-T-C ***
9951489-A-T 10113880-A-T ***
9943729-G-T 10106120-G-T ***
9941348-C-T 10103739-C-T FT219826 ***
10033816-C-A 10196207-C-A ***
9941347-C-T 10103738-C-T ***
9941049-C-A 10103440-C-A ***
9934990-A-G 10097381-A-G ***
9915664-A-C 10078055-A-C ***
9911317-G-A 10073708-G-A ***
9909155-G-T 10071546-G-T ***
9909136-A-C 10071527-A-C ***
9868176-C-T 10030567-C-T ***
10025204-C-G 10187595-C-G ***
10043084-A-T 10205475-A-T ***
13140103-T-G 10629589-T-G ***
10104568-N-T 10266959-N-T ***
10104598-N-A 10266989-N-A ***
10104595-N-T 10266986-N-T ***
10104594-N-T 10266985-N-T ***
10104592-N-G 10266983-N-G ***
10104585-N-A 10266976-N-A ***
10104573-N-A 10266964-N-A ***
10104572-N-A 10266963-N-A ***
10104571-N-A 10266962-N-A ***
10104566-N-G 10266957-N-G ***
10043444-A-T 10205835-A-T ***
10104560-N-A 10266951-N-A ***
10104557-N-A 10266948-N-A ***
10104555-N-A 10266946-N-A ***
10104547-G-C 10266938-G-C ***
10068756-C-G 10231147-C-G ***
10043505-T-C 10205896-T-C ***
10043454-C-T 10205845-C-T ***
10043449-C-G 10205840-C-G ***
13385691-T-A 11230015-T-A ***
13430952-T-C 11275276-T-C ***
9744655-T-G 9907046-T-G ***
13703889-G-T 11548213-G-T BY211155 ***
13714092-G-A 11558416-G-A ***
13708771-C-A 11553095-C-A ***
13706971-T-C 11551295-T-C ***
13706968-A-G 11551292-A-G ***
13706967-G-A 11551291-G-A ***
13705377-A-C 11549701-A-C ***
13703891-A-G 11548215-A-G ***
13703888-T-A 11548212-T-A ***
13722948-G-T 11567272-G-T ***
13703886-A-G 11548210-A-G ***
13703884-G-T 11548208-G-T ***
13703883-T-A 11548207-T-A ***
13703881-A-C 11548205-A-C ***
13703880-C-G 11548204-C-G ***
13703879-C-T 11548203-C-T ***
13703878-T-A 11548202-T-A ***
13703877-C-A 11548201-C-A ***
13714290-G-C 11558614-G-C ***
13722951-T-A 11567275-T-A ***
13699761-A-T 11544085-A-T ***
13723005-A-G 11567329-A-G ***
13723026-T-C 11567350-T-C ***
13723023-T-G 11567347-T-G ***
13723022-G-A 11567346-G-A ***
13723021-A-T 11567345-A-T ***
13723019-A-C 11567343-A-C ***
13723016-C-T 11567340-C-T ***
13723014-G-A 11567338-G-A ***
13723009-G-A 11567333-G-A ***
13723002-G-C 11567326-G-C ***
13722952-G-C 11567276-G-C ***
13723001-T-C 11567325-T-C ***
13723000-T-C 11567324-T-C ***
13722987-G-C 11567311-G-C ***
13722981-T-A 11567305-T-A ***
13722968-G-C 11567292-G-C ***
13722966-T-G 11567290-T-G ***
13722956-T-C 11567280-T-C FGC83198 ***
13722953-G-A 11567277-G-A ***
13701727-C-A 11546051-C-A ***
13699760-G-T 11544084-G-T ***
13430973-C-T 11275297-C-T ***
13468015-T-A 11312339-T-A ***
13511441-T-A 11355765-T-A ***
13497691-A-G 11342015-A-G ***
13496454-A-C 11340778-A-C ***
13496355-T-A 11340679-T-A ***
13484939-C-T 11329263-C-T ***
13480941-C-T 11325265-C-T ***
13469124-A-C 11313448-A-C ***
13469119-G-C 11313443-G-C ***
13468003-A-G 11312327-A-G ***
13511446-G-T 11355770-G-T ***
13467999-T-G 11312323-T-G ***
13467995-A-T 11312319-A-T ***
13467981-A-G 11312305-A-G ***
13461125-C-T 11305449-C-T ***
13460490-T-A 11304814-T-A ***
13460471-A-T 11304795-A-T ***
13437261-C-G 11281585-C-G ***
13430985-G-C 11275309-G-C ***
13511443-A-T 11355767-A-T ***
13511448-G-A 11355772-G-A ***
13681031-T-C 11525355-T-C ***
13594264-C-A 11438588-C-A ***
13681030-G-C 11525354-G-C ***
13681027-A-T 11525351-A-T ***
13681025-C-G 11525349-C-G ***
13681017-A-T 11525341-A-T ***
13681016-G-A 11525340-G-A ***
13681015-G-A 11525339-G-A ***
13681014-T-C 11525338-T-C ***
13623888-T-C 11468212-T-C ***
13593879-G-T 11438203-G-T ***
13511453-T-A 11355777-T-A ***
13578348-C-A 11422672-C-A ***
13551208-A-G 11395532-A-G ***
13511464-G-T 11355788-G-T ***
13511463-A-G 11355787-A-G ***
13511461-G-T 11355785-G-T ***
13511456-A-G 11355780-A-G ***
13511455-G-T 11355779-G-T ***
13511454-T-A 11355778-T-A ***
9745959-C-T 9908350-C-T ***
9716820-G-A 9879211-G-A IR3_Prx ***
13723032-C-T 11567356-C-T ***
25169133-G-A 23022986-G-A g1 ***
58908927-C-G 56681944-G-C ***
26201799-A-T 24055652-A-T P1_Y1 ***
26168157-T-A 24022010-T-A P1_Y1 ***
26100509-G-T 23954362-G-T P1_Y1 35×T***
25321313-G-A 23175166-G-A P2_r1 ***
25302907-C-G 23156760-C-G P2_r1 ***
25207822-C-CAA 23061675-C-CAA P2_r1 51×A***
24966793-C-A 22820646-C-A g1 ***
24654495-C-CT 22508348-C-CT P3_b2 15×T***
24966791-C-A 22820644-C-A g1 ***
24966789-G-C 22820642-G-C g1 ***
24218754-A-C 22072607-A-C P3_b1 ***
24097288-A-G 21951141-A-G P3_b1 ***
22505835-C-T 20343949-C-T FGC82287 DYZ19 ******
22447292-A-G 20285406-A-G DYZ19 ***
22439368-C-A 20277482-C-A BY218663 DYZ19 ***
22430023-A-G 20268137-A-G DYZ19 ***
13703875-A-G 11548199-A-G ***
19683841-CA-C 17571961-CA-C P5_Prx 14×A***
22307079-A-C 20145193-A-C DYZ19 ***
14989248-G-A 12877333-G-A ***
22502886-G-T 20341000-G-T DYZ19 ***
3271445-C-T 3403404-C-T 10×T***
22360065-C-G 20198179-C-G DYZ19 ***
14557934-T-C 12446135-T-C Y5030 ***
10041399-C-T 10203790-C-T ***
23901044-T-C 21739158-T-C ***
23901041-T-C 21739155-T-C ***
13511457-C-A 11355781-C-A ***
10041393-G-C 10203784-G-C ***
22368886-TG-T 20207000-TG-T DYZ19 ***
9956763-T-A 10119154-T-A ***
3148420-C-T 3280379-C-T 18×T***
23900993-T-C 21739107-T-C ***
9075183-C-T 9237574-C-T ***
16855400-T-G 14743520-T-G ***
2718881-C-T 2850840-C-T FT74248 21×T***
21026423-G-GT 18864537-G-GT P4_Dst 8×T***
22368922-G-T 20207036-G-T DYZ19 ***
22333652-A-C 20171766-A-C DYZ19 ******
22303353-A-T 20141467-A-T DYZ19 ***
2693432-C-A 2825391-C-A ***
20084485-C-T 17972605-C-T P5_Dst ***
6211772-A-G 6343731-A-G IR3_Dst ***
6167451-AT-A 6299410-AT-A IR3_Dst 10×T***
58975376-G-C 56829229-G-C ***
24860018-C-CAAA 22713871-C-CAAA IR1_R 27×A***
13723327-G-C 11567651-G-C ***
20362220-AT-A 18200334-AT-A P5_Dst 22×T***
22358557-C-G 20196671-C-G DYZ19 ***
28812760-G-A 26666613-G-A ***
20084480-C-T 17972600-C-T P5_Dst ***
13692132-G-A 11536456-G-A ***
20084470-C-T 17972590-C-T P5_Dst ***
13451979-ACACCACTCCACTGCT-A 11296303-ACACCACTCCACTGCT-A ***
13860755-A-G 11740049-A-G ***
13446873-C-T 11291197-C-T ***
22363261-TG-T 20201375-TG-T DYZ19 ***
13430256-C-T 11274580-C-T ***
22297850-AG-A 20135964-AG-A DYZ19 ***
13825210-A-C 11704504-A-C ***
6293558-GAGACTCAATTAAAAAA-G 6425517-GAGACTCAATTAAAAAA-G IR3_Dst ***
13714019-A-C 11558343-A-C ***
22303349-AC-A 20141463-AC-A DYZ19 ***
13862160-C-A 11741454-C-A ***
22292877-G-T 20130991-G-T DYZ19 ******
22276000-A-T 20114114-A-T DYZ19 ***
22266838-T-G 20104952-T-G DYZ19 ***
22233320-G-A 20071434-G-A BY213539 DYZ19 ***
20715163-T-C 18553277-T-C P4_Prx ******
19732287-C-T 17620407-C-T P5_Prx ***
19006158-T-A 16894278-T-A ***
16679092-G-T 14567212-G-T ***
13862146-G-T 11741440-G-T ***
13811173-GC-G 11690467-GC-G ***
13862145-A-T 11741439-A-T ***
13862130-G-T 11741424-G-T ***
13862103-A-G 11741397-A-G ***
13859914-G-GTAATC 11739208-G-GTAATC ***
13838840-G-C 11718134-G-C ***
13838793-A-G 11718087-A-G ***
13838788-A-T 11718082-A-T ***
13821147-T-G 11700441-T-G FT231249 ***
2699591-C-A 2831550-C-A ***
9708107-A-T 9870498-A-T IR3_Prx ***
8619564-T-A 8751523-T-A br1 ***
8974691-C-A 9137082-C-A ***
8725100-T-C 8857059-T-C ***
8713135-C-A 8845094-C-A ***
8676946-C-A 8808905-C-A ***
8619574-G-C 8751533-G-C br1 ***
8619573-A-G 8751532-A-G br1 ***
8619566-C-T 8751525-C-T br1 ***
8619565-T-G 8751524-T-G br1 ***
8514293-C-A 8646252-C-A ***
9088167-T-C 9250558-T-C ***
8385206-G-T 8517165-G-T ***
8112464-C-T 8244423-C-T ***
7705626-G-T 7837585-G-T ***
7501225-T-G 7633184-T-G IR1_L ***
7445651-C-A 7577610-C-A ***
7445312-A-G 7577271-A-G ***
7409428-C-A 7541387-C-A ***
7336335-C-A 7468294-C-A ***
9048212-A-G 9210603-A-G ***
9165557-G-T 9327948-G-T ***
7248753-C-A 7380712-C-A ***
9304614-G-T 9467005-G-T ***
9691307-T-C 9853698-T-C IR3_Prx ***
9602637-C-A 9765028-C-A IR3_Prx ***
9386182-C-A 9548573-C-A ***
9325265-T-C 9487656-T-C ***
9325254-A-C 9487645-A-C ***
9325247-T-C 9487638-T-C ***
9325208-C-G 9487599-C-G ***
9304875-A-G 9467266-A-G ***
9304613-C-A 9467004-C-A ***
9172375-A-C 9334766-A-C ***
9304612-G-T 9467003-G-T ***
9304610-A-C 9467001-A-C ***
9304608-G-C 9466999-G-C ***
9304605-G-A 9466996-G-A ***
9304174-A-T 9466565-A-T ***
9229089-A-C 9391480-A-C ***
9222814-C-T 9385205-C-T ***
9215993-A-G 9378384-A-G ***
7277672-C-T 7409631-C-T ***
7182973-G-T 7314932-G-T ***
2738690-C-A 2870649-C-A ***
5240867-C-A 5372826-C-A ***
6093821-A-C 6225780-A-C ***
6085612-C-A 6217571-C-A ***
5851893-C-A 5983852-C-A ***
5851537-G-A 5983496-G-A ***
5690225-C-A 5822184-C-A ***
5650526-C-A 5782485-C-A ***
5458807-A-G 5590766-A-G ***
5267041-A-T 5399000-A-T ***
5191205-T-C 5323164-T-C ***
6133844-C-T 6265803-C-T ***
4382439-G-A 4514398-G-A ***
3790900-A-C 3922859-A-C ***
3592578-C-A 3724537-C-A ***
3409414-A-C 3541373-A-C ***
3366669-C-A 3498628-C-A ***
3275879-A-G 3407838-A-G ***
3185873-G-T 3317832-G-T ***
2740700-C-A 2872659-C-A ***
6103075-C-G 6235034-C-G ***
6133847-G-A 6265806-G-A ***
7170125-C-A 7302084-C-A ***
6930711-C-A 7062670-C-A ***
7162854-C-A 7294813-C-A ***
7160865-G-A 7292824-G-A ***
7105046-C-A 7237005-C-A ***
7099139-C-A 7231098-C-A ***
7034474-C-A 7166433-C-A 17×A***
7034473-T-A 7166432-T-A ***
7000286-G-T 7132245-G-T ***
6996824-C-A 7128783-C-A ***
6807415-C-A 6939374-C-A ***
6133848-A-G 6265807-A-G ***
6774128-C-A 6906087-C-A ***
6772056-C-A 6904015-C-A ***
6644810-C-A 6776769-C-A ***
6459966-T-C 6591925-T-C ***
6360591-G-A 6492550-G-A ***
6356858-G-T 6488817-G-T ***
6145984-A-C 6277943-A-C IR3_Dst ***
6145919-G-T 6277878-G-T IR3_Dst ***
13723029-A-C 11567353-A-C ***
13723033-A-G 11567357-A-G ***
24050818-G-C 21904671-G-C P3_b1 ***
20872405-G-A 18710519-G-A P4_Dst ***
20886839-C-G 18724953-C-G P4_Dst ***
20886836-A-G 18724950-A-G P4_Dst ***
20886825-C-G 18724939-C-G P4_Dst ***
20886818-T-A 18724932-T-A P4_Dst ***
20886814-T-A 18724928-T-A P4_Dst ***
20886813-G-A 18724927-G-A P4_Dst ***
20886812-T-A 18724926-T-A P4_Dst ***
20872202-C-T 18710316-C-T P4_Dst ***
20886855-A-C 18724969-A-C P4_Dst ***
20863681-A-T 18701795-A-T P4_Dst ***
20861250-G-T 18699364-G-T P4_Dst ***
20856347-G-A 18694461-G-A P4_Dst ***
20854398-C-A 18692512-C-A P4_Dst ***
20849609-T-C 18687723-T-C P4_Dst ***
20843517-G-T 18681631-G-T P4_Dst ***
20774158-C-A 18612272-C-A P4_Prx ***
20747972-G-T 18586086-G-T P4_Prx ***
20886850-G-A 18724964-G-A P4_Dst ***
20898381-T-G 18736495-T-G P4_Dst ***
20631449-A-C 18469563-A-C P4_Prx ***
21268938-C-A 19107052-C-A ***
22228037-G-T 20066151-G-T DYZ19 ***
22227975-A-G 20066089-A-G DYZ19 ***
22199422-C-A 20037536-C-A ***
22168024-C-A 20006138-C-A ***
21775154-C-A 19613268-C-A ***
21746379-C-A 19584493-C-A ***
21379430-G-C 19217544-G-C ***
21269170-C-A 19107284-C-A ***
21263601-C-A 19101715-C-A ***
20913656-T-A 18751770-T-A P4_Dst ***
21241713-T-C 19079827-T-C ***
21153836-G-T 18991950-G-T ***
21022808-C-A 18860922-C-A P4_Dst ***
21021613-G-T 18859727-G-T P4_Dst ***
21021604-C-T 18859718-C-T P4_Dst ***
20989893-C-A 18828007-C-A P4_Dst ***
20948130-A-C 18786244-A-C P4_Dst ***
20946773-T-C 18784887-T-C P4_Dst ***
20703689-A-C 18541803-A-C P4_Prx ***
20593053-T-C 18431167-T-C P5_Dst ***
22236450-G-T 20074564-G-T DYZ19 ***
20111784-G-C 17999904-G-C P5_Dst ***
20218031-A-C 18056145-A-C P5_Dst ***
20215591-T-C 18053705-T-C P5_Dst ***
20214452-G-A 18052566-G-A P5_Dst ***
20210575-G-C 18048689-G-C P5_Dst ***
20210574-T-A 18048688-T-A P5_Dst ***
20210573-A-T 18048687-A-T P5_Dst ***
20210571-C-T 18048685-C-T P5_Dst ***
20141018-C-A 18029138-C-A P5_Dst ***
20096588-G-T 17984708-G-T P5_Dst ***
20241262-A-T 18079376-A-T P5_Dst ***
20091730-A-G 17979850-A-G P5_Dst ***
20087807-T-G 17975927-T-G P5_Dst ***
20087400-G-T 17975520-G-T P5_Dst ***
20084797-C-A 17972917-C-A P5_Dst ***
20084465-C-T 17972585-C-T BY212108 P5_Dst ***
20062548-C-T 17950668-C-T P5_Prx ***
20013309-A-G 17901429-A-G P5_Prx ***
19924531-T-C 17812651-T-C P5_Prx ***
20230681-A-G 18068795-A-G P5_Dst ***
20253323-C-T 18091437-C-T P5_Dst ***
20588327-G-T 18426441-G-T P5_Dst ***
20428558-T-A 18266672-T-A P5_Dst ***
20510476-C-A 18348590-C-A P5_Dst ***
20507918-G-T 18346032-G-T P5_Dst ***
20497560-A-T 18335674-A-T P5_Dst ***
20494988-T-C 18333102-T-C P5_Dst ***
20479705-A-G 18317819-A-G P5_Dst ***
20458753-G-T 18296867-G-T P5_Dst ***
20442337-G-T 18280451-G-T P5_Dst ***
20432781-C-A 18270895-C-A P5_Dst ***
20420271-G-A 18258385-G-A P5_Dst ***
20314504-G-C 18152618-G-C P5_Dst ***
20420240-A-G 18258354-A-G P5_Dst ***
20420237-C-G 18258351-C-G P5_Dst ***
20386692-C-A 18224806-C-A P5_Dst ***
20368757-G-T 18206871-G-T P5_Dst ***
20340133-T-G 18178247-T-G P5_Dst ***
20318875-A-T 18156989-A-T P5_Dst ***
20318873-C-T 18156987-C-T P5_Dst ***
20314506-G-C 18152620-G-C P5_Dst ***
22234039-G-C 20072153-G-C DYZ19 ***
22244779-A-T 20082893-A-T DYZ19 ***
19924524-C-T 17812644-C-T P5_Prx ***
23465740-G-T 21303854-G-T FT119764 ***
23671749-T-A 21509863-T-A ***
23666270-A-C 21504384-A-C ***
23658852-A-G 21496966-A-G ***
23658846-A-T 21496960-A-T ***
23656178-G-T 21494292-G-T ***
23602393-C-A 21440507-C-A ***
23574316-G-T 21412430-G-T ***
23401656-G-T 21239770-G-T ***
23671752-C-G 21509866-C-G ***
23401647-G-A 21239761-G-A ***
23368672-C-A 21206786-C-A ***
23286109-A-T 21124223-A-T ***
23255184-C-A 21093298-C-A ***
23098137-C-A 20936251-C-A ***
22892556-C-A 20730670-C-A ***
22836544-C-A 20674658-C-A ***
22690885-C-T 20528999-C-T ***
23671751-G-A 21509865-G-A ***
23736652-C-A 21574766-C-A ***
22649484-A-G 20487598-A-G ***
24032843-A-G 21886696-A-G ***
24047018-C-T 21900871-C-T ***
24046956-G-A 21900809-G-A ***
24046818-G-T 21900671-G-T ***
24046637-C-A 21900490-C-A ***
24045399-T-A 21899252-T-A ***
24045394-T-G 21899247-T-G ***
24044685-A-T 21898538-A-T ***
24035028-A-G 21888881-A-G ***
24032693-C-A 21886546-C-A ***
23737262-T-G 21575376-T-G ***
24028713-G-T 21882566-G-T ***
24026090-G-T 21879943-G-T ***
24009487-C-A 21863340-C-A ***
23872366-T-C 21710480-T-C ***
23850285-G-T 21688399-G-T ***
23836853-G-T 21674967-G-T ***
2817709-C-CA 2949668-C-CA 30×A***
23743686-A-T 21581800-A-T ***
22682611-C-A 20520725-C-A ***
22491006-A-G 20329120-A-G DYZ19 ***
22244780-A-G 20082894-A-G DYZ19 ***
22245681-A-G 20083795-A-G DYZ19 ***
22300096-T-C 20138210-T-C DYZ19 ***
22283318-G-A 20121432-G-A DYZ19 ***
22275697-T-C 20113811-T-C DYZ19 ***
22269588-T-G 20107702-T-G DYZ19 ***
22256210-C-A 20094324-C-A DYZ19 ***
22250226-T-G 20088340-T-G DYZ19 ***
22250224-G-T 20088338-G-T DYZ19 ***
22245682-C-T 20083796-C-T DYZ19 ***
22244793-A-T 20082907-A-T DYZ19 ***
22341618-G-T 20179732-G-T DYZ19 ***
22244792-C-T 20082906-C-T DYZ19 ***
22244791-A-C 20082905-A-C DYZ19 ***
22244789-G-T 20082903-G-T DYZ19 ***
22244787-C-G 20082901-C-G DYZ19 ***
22244786-T-A 20082900-T-A DYZ19 ***
22244783-A-C 20082897-A-C DYZ19 ***
22244782-A-C 20082896-A-C DYZ19 ***
22244781-G-T 20082895-G-T DYZ19 ***
22336106-C-T 20174220-C-T DYZ19 ***
22341619-T-A 20179733-T-A DYZ19 ***
22453361-T-A 20291475-T-A DYZ19 ***
22362119-T-C 20200233-T-C DYZ19 ***
22453358-G-C 20291472-G-C DYZ19 ***
22452046-T-A 20290160-T-A DYZ19 ***
22452044-A-T 20290158-A-T DYZ19 ***
22427191-A-G 20265305-A-G DYZ19 ***
22427189-T-G 20265303-T-G DYZ19 ***
22365324-G-T 20203438-G-T DYZ19 ***
22362125-T-A 20200239-T-A DYZ19 ***
22362124-A-C 20200238-A-C DYZ19 ***
22362112-T-C 20200226-T-C DYZ19 ***
22345697-T-A 20183811-T-A DYZ19 ***
22361100-G-T 20199214-G-T DYZ19 ***
22360070-T-A 20198184-T-A DYZ19 ***
22360068-C-T 20198182-C-T DYZ19 ***
22360067-T-A 20198181-T-A DYZ19 ***
22360064-A-T 20198178-A-T DYZ19 ***
22358195-A-T 20196309-A-T DYZ19 ***
22352945-C-T 20191059-C-T DYZ19 ***
22352944-C-G 20191058-C-G DYZ19 ***
19924529-T-G 17812649-T-G P5_Prx ***
19924522-G-T 17812642-G-T P5_Prx ***
13723037-A-G 11567361-A-G ***
15912052-T-C 13800172-T-C ***
16041772-C-A 13929892-C-A ***
16023083-C-A 13911203-C-A ***
15995099-C-A 13883219-C-A ***
15975023-C-A 13863143-C-A ***
15944350-C-A 13832470-C-A ***
15941458-T-C 13829578-T-C ***
15912054-T-C 13800174-T-C ***
15912051-A-T 13800171-A-T ***
16072983-G-A 13961103-G-A ***
15801633-C-A 13689753-C-A ***
15733746-G-A 13621866-G-A ***
15699936-C-A 13588056-C-A ***
15546232-C-A 13434352-C-A ***
15412926-C-T 13301046-C-T ***
15411279-C-A 13299399-C-A ***
15406720-C-A 13294840-C-A ***
15379806-C-A 13267926-C-A ***
16071730-A-T 13959850-A-T 17×T***
16095443-A-G 13983563-A-G ***
15323560-C-A 13211678-C-A ***
16157816-C-G 14045936-C-G P8_Dst ***
16612351-C-A 14500471-C-A FT261075 ***
16571852-C-A 14459972-C-A ***
16506924-A-T 14395044-A-T ***
16503810-C-A 14391930-C-A ***
16412837-C-A 14300957-C-A ***
16243066-T-C 14131186-T-C ***
16232163-A-G 14120283-A-G ***
16180412-A-G 14068532-A-G ***
16157814-A-G 14045934-A-G P8_Dst ***
16118320-T-A 14006440-T-A P8_Prx ***
16157813-G-A 14045933-G-A P8_Dst ***
16157811-T-A 14045931-T-A P8_Dst ***
16157810-T-A 14045930-T-A P8_Dst ***
16157808-T-A 14045928-T-A P8_Dst ***
16157807-T-A 14045927-T-A P8_Dst ***
16157806-G-A 14045926-G-A P8_Dst ***
16157805-C-G 14045925-C-G P8_Dst ***
16148183-C-T 14036303-C-T P8_Dst 27×T***
15365221-C-T 13253341-C-T ***
15305613-T-C 13193712-T-C ***
16720510-G-T 14608630-G-T ***
13745839-G-A 11590163-G-A ***
13847133-T-C 11726427-T-C ***
13809687-T-G 11688981-T-G ***
13809683-G-A 11688977-G-A ***
13809636-A-C 11688930-A-C ***
13809635-A-G 11688929-A-G ***
13809633-G-C 11688927-G-C ***
13809631-A-G 11688925-A-G ***
13803179-G-T 11682473-G-T ***
13733869-G-C 11578193-G-C ***
13858777-A-T 11738071-A-T ***
13731782-G-A 11576106-G-A ***
13728534-T-C 11572858-T-C ***
13723306-G-T 11567630-G-T ***
13723305-T-G 11567629-T-G ***
13723303-A-G 11567627-A-G ***
13723302-A-C 11567626-A-C 4×AATGG***
13723041-G-T 11567365-G-T ***
13723038-A-T 11567362-A-T ***
13857633-A-G 11736927-A-G ***
14025468-C-T 11904762-C-T ***
15302485-G-T 13190584-G-T ***
14537077-C-A 12425278-C-A ***
15068898-C-A 12956989-C-A ***
15036358-G-A 12924446-G-A ***
14779753-C-A 12667823-C-A ***
14721848-C-A 12609916-C-A ***
14652296-G-T 12540361-G-T ***
14649778-G-A 12537843-G-A ***
14620062-C-A 12508260-C-A ***
14598945-G-T 12487145-G-T ***
14464316-C-A 12343589-C-A ***
14050745-C-A 11930039-C-A ***
14462786-C-A 12342059-C-A ***
14402534-C-A 12281831-C-A ***
14401942-C-A 12281239-C-A ***
14397841-G-A 12277137-G-A ***
14380027-G-C 12259323-G-C ***
14373449-G-A 12252745-G-A BY95310 ***
14264431-C-A 12143725-C-A ***
14241732-C-A 12121026-C-A ***
16710338-C-A 14598458-C-A ***
16868573-C-A 14756693-C-A ***
19924521-T-G 17812641-T-G P5_Prx ***
18429240-G-C 16317360-G-C P6_Dst ***
18491585-T-G 16379705-T-G P6_Dst ***
18467557-A-T 16355677-A-T P6_Dst ***
18467553-T-C 16355673-T-C P6_Dst ***
18467550-G-T 16355670-G-T P6_Dst ***
18467549-A-C 16355669-A-C P6_Dst ***
18465450-T-C 16353570-T-C P6_Dst ***
18443296-G-T 16331416-G-T P6_Dst ***
18439561-C-A 16327681-C-A P6_Dst ***
18401619-C-A 16289739-C-A P6_Gap ***
18604937-C-A 16493057-C-A ***
18388354-C-A 16276474-C-A P6_Gap ***
18370708-C-A 16258828-C-A P6_Prx ***
18329827-C-A 16217947-C-A P6_Prx ***
18316580-G-A 16204700-G-A P6_Prx ***
18316558-G-A 16204678-G-A P6_Prx ***
18305538-G-C 16193658-G-C P6_Prx ***
18305536-T-G 16193656-T-G P6_Prx ***
18305534-T-G 16193654-T-G P6_Prx ***
18511241-T-A 16399361-T-A P6_Dst ***
18630756-C-A 16518876-C-A ***
18305532-T-A 16193652-T-A P6_Prx ***
19346658-C-A 17234778-C-A ***
19924520-G-T 17812640-G-T P5_Prx ***
19775296-G-A 17663416-G-A P5_Prx ***
19749293-C-A 17637413-C-A P5_Prx ***
19706469-G-A 17594589-G-A P5_Prx ***
19684076-A-C 17572196-A-C P5_Prx ***
19684001-G-T 17572121-G-T P5_Prx ***
19605756-G-T 17493876-G-T P5_Prx ***
19391329-C-A 17279449-C-A ***
19271463-G-C 17159583-G-C ***
18697996-G-A 16586116-G-A ***
19122233-C-A 17010353-C-A ***
19112666-C-A 17000786-C-A ***
19035907-A-T 16924027-A-T ***
19031537-C-A 16919657-C-A ***
18955769-T-A 16843889-T-A ***
18856928-G-A 16745048-G-A ***
18853218-C-A 16741338-C-A ***
18753379-G-T 16641499-G-T ***
18305533-G-A 16193653-G-A P6_Prx ***
18305531-A-T 16193651-A-T P6_Prx ***
16881521-C-A 14769641-C-A ***
17505738-C-A 15393858-C-A ***
17950773-G-A 15838893-G-A ***
17923112-G-A 15811232-G-A ***
17915952-C-T 15804072-C-T ***
17692106-C-A 15580226-C-A ***
17691936-C-A 15580056-C-A ***
17633191-C-A 15521311-C-A ***
17597953-C-A 15486073-C-A ***
17515291-C-A 15403411-C-A ***
17461861-C-A 15349981-C-A ***
18050097-A-G 15938217-A-G ***
17440872-C-A 15328992-C-A F21778 ***
17372022-C-A 15260142-C-A ***
17313300-G-C 15201420-G-C ***
17151294-T-C 15039414-T-C ***
17092690-C-A 14980810-C-A ***
17004446-C-A 14892566-C-A ***
16978332-C-T 14866452-C-T ***
16929527-A-G 14817647-A-G ***
18050093-T-A 15938213-T-A ***
18108700-C-A 15996820-C-A ***
18305530-C-A 16193650-C-A P6_Prx ***
18305517-A-G 16193637-A-G P6_Prx ***
18305528-T-G 16193648-T-G P6_Prx ***
18305525-G-T 16193645-G-T P6_Prx ***
18305523-A-G 16193643-A-G P6_Prx ***
18305522-T-A 16193642-T-A P6_Prx ***
18305521-T-C 16193641-T-C P6_Prx ***
18305520-G-T 16193640-G-T P6_Prx ***
18305519-A-G 16193639-A-G P6_Prx ***
18305518-A-C 16193638-A-C P6_Prx ***
18305516-G-A 16193636-G-A P6_Prx ***
18194202-C-A 16082322-C-A ***
18305515-G-C 16193635-G-C P6_Prx ***
18305514-A-G 16193634-A-G P6_Prx ***
18305513-T-G 16193633-T-G P6_Prx ***
18305512-G-C 16193632-G-C P6_Prx ***
18305511-A-T 16193631-A-T P6_Prx ***
18305509-G-C 16193629-G-C P6_Prx ***
18305507-A-G 16193627-A-G P6_Prx ***
18253160-A-C 16141280-A-C ***
25964919-GTA-TT 23818772-GTA-TT P1_Y1 ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Haplotype Progression

The data below reveals the progression of changes in the haplotype. The bottom row is the haplotype for this man and above him are the inferred ancestral haplotypes for various upstream blocks. These inferred haplotypes are very much a work in progress, and any suggested modifications are appreciated. I think we can use our vast collection of haplotype data to refine these haplotypes. Mutations made from each upstream block are shown in sequence. The cell color is determined by the block in which the mutation took place.

DYS393
DYS390
DYS19
DYS391
DYS385
DYS426
DYS388
DYS439
DYS389i
DYS392
DYS389ii
DYS458
DYS459
DYS455
DYS454
DYS447
DYS437
DYS448
DYS449
DYS464
DYS460
Y-GATA-H4
YCAII
DYS456
DYS607
DYS576
DYS570
CDY
DYS442
DYS438
DYS531
DYS578
DYF395S1
DYS590
DYS537
DYS641
DYS472
DYF406S1
DYS511
DYS425
DYS413
DYS557
DYS594
DYS436
DYS490
DYS534
DYS450
DYS444
DYS481
DYS520
DYS446
DYS617
DYS568
DYS487
DYS572
DYS640
DYS492
DYS565
DYS710
DYS485
DYS632
DYS495
DYS540
DYS714
DYS716
DYS717
DYS505
DYS556
DYS549
DYS589
DYS522
DYS494
DYS533
DYS636
DYS575
DYS638
DYS462
DYS452
DYS445
Y-GATA-A10
DYS463
DYS441
Y-GGAAT-1B07
DYS525
DYS712
DYS593
DYS650
DYS532
DYS715
DYS504
DYS513
DYS561
DYS552
DYS726
DYS635
DYS587
DYS643
DYS497
DYS510
DYS434
DYS461
DYS435
FTY371
FTY303
FTY10
FTY284
FTY219
FTY324
FTY327
FTY394
DYS538
FTY220
FTY254
FTY19
FTY4
DYS577
FTY24
FTY346
FTY160
FTY62
FTY400
FTY114
FTY246
FTY26
FTY368
FTY173
FTY209
FTY337
FTY81
FTY387
FTY361
FTY330
FTY65
FTY168
FTY171
FTY136
FTY53
FTY40
FTY386
FTY100
FTY152
FTY55
FTY297
FTY370
FTY103
FTY64
FTY174
FTY313
FTY362
FTY342
FTY161
FTY374
FTY316
FTY101
FTY204
DYS477
FTY192
DYS502
FTY341
DYS493
FTY1
FTY227
DYS499
FTY391
FTY353
FTY332
FTY163
DYS483
FTY172
FTY180
DYS581
FTY179
FTY188
FTY369
FTY70
FTY63
DYS508
FTY347
FTY83
FTY277
FTY276
FTY195
FTY109
FTY356
FTY215
FTY105
FTY123
FTY242
FTY214
FTY132
FTY262
FTY333
FTY208
DYF398B
FTY43
FTY166
FTY13
FTY11
DYS584
DYS608
FTY95
FTY151
FTY388
FTY256
DYS580
FTY234
FTY268
FTY139
FTY27
FTY75
DYS512
FTY329
FTY320
FTY7
FTY247
FTY211
DYS474
FTY39
FTY376
FTY37
FTY373
DYS475
FTY138
FTY288
FTY264
FTY93
FTY380
FTY18
FTY115
DYS569
FTY390
FTY46
FTY243
FTY322
FTY281
FTY153
FTY181
FTY184
FTY359
FTY121
FTY74
FTY279
DYS530
FTY45
DYS573
DYS542
FTY36
FTY304
FTY203
FTY291
FTY142
FTY191
FTY183
FTY141
FTY299
FTY193
FTY124
FTY16
FTY236
FTY185
FTY378
FTY225
FTY397
FTY3
FTY67
FTY182
FTY334
DYS623
FTY348
FTY357
FTY275
FTY306
FTY383
FTY253
FTY285
DYS645
FTY17
FTY85
DYS598
FTY375
FTY325
FTY12
FTY365
FTY35
FTY237
FTY238
FTY305
FTY56
FTY129
FTY352
FTY292
FTY154
DYS539
FTY301
FTY366
FTY231
DYS618
FTY216
FTY82
FTY393
FTY155
FTY68
FTY32
FTY265
FTY300
FTY143
FTY201
FTY199
FTY86
FTY98
FTY144
DYS541
DYS507
FTY20
FTY116
FTY308
FTY177
FTY89
FTY158
FTY22
FTY84
FTY186
FTY396
FTY91
FTY29
FTY78
FTY229
FTY260
FTY250
FTY364
DYS476
FTY221
FTY57
FTY377
FTY384
DYS466
FTY363
FTY137
FTY69
FTY72
FTY251
FTY2
FTY217
FTY257
FTY120
FTY25
FTY252
FTY33
FTY42
FTY54
FTY372
DYS480
FTY176
FTY76
FTY66
FTY197
FTY385
FTY270
FTY298
FTY198
FTY117
DYS544
FTY159
FTY232
FTY156
FTY343
FTY296
FTY311
FTY344
FTY178
FTY367
FTY73
FTY112
FTY295
DYS616
FTY338
FTY196
FTY157
FTY162
DYS551
FTY148
FTY94
FTY52
FTY131
FTY9
FTY194
FTY8
FTY318
FTY317
FTY99
FTY289
FTY169
FTY51
FTY345
FTY398
FTY111
FTY273
FTY382
FTY47
FTY30
FTY147
DYS615
FTY302
FTY354
FTY326
FTY88
FTY248
FTY267
FTY170
FTY60
DYS453
FTY249
FTY167
DYS624
FTY134
FTY235
FTY145
FTY14
FTY80
FTY50
DYS514
FTY340
DYS585
DYS516
FTY293
FTY207
FTY278
FTY210
DYS523
FTY269
FTY530
FTY1156
FTY1070
FTY906
FTY1004
FTY331
FTY31
FTY226
FTY335
DYS583
FTY339
FTY113
FTY280
FTY255
FTY59
DYS620
FTY349
FTY130
FTY119
DYF398A
FTY58
FTY127
FTY321
FTY92
FTY392
DYF392
FTY290
FTY312
FTY135
FTY150
FTY294
FTY244
FTY48
FTY282
DYS489
FTY272
FTY239
FTY258
FTY49
DYS574
FTY41
FTY905
FTY1103
FTY502
FTY743
FTY443
FTY670
FTY883
DYS631
FTY1042
FTY510
DYS389B
FTY512
FTY837
DYS642
FTY407
FTY935
FTY563
FTY1016
FTY1091
FTY1049
FTY1155
DYS602
FTY587
FTY635
FTY904
DYS543
FTY1148
FTY861
FTY742
FTY433
FTY1039
FTY71
FTY259
FTY108
FTY336
FTY44
FTY233
FTY274
FTY34
FTY942
FTY1068
FTY945
FTY1051
FTY658
FTY625
FTY800
FTY818
FTY971
FTY509
FTY1025
FTY835
FTY984
DYS637
FTY832
FTY689
FTY998
FTY520
FTY445
FTY809
FTY428
FTY562
FTY897
FTY1064
FTY1088
FTY1052
DYF405
FTY310
FTY189
DYS488
FTY283
FTY28
FTY578
DYS484
FTY858
FTY596
FTY915
FTY446
FTY452
FTY1006
FTY612
FTY507
FTY614
FTY824
FTY1055
FTY690
FTY2318
FTY981
FTY946
FTY1040
DYS718
FTY15
FTY2025
DYS685u1
DYS596u5
FTY1511
FTY769
FTY923
FTY1167
FTY415
FTY505
FTY241
FTY2263
FTY517
FTY2180
FTY775
DYS567
FTY444
FTY691
FTY1120
FTY223
DYF393u3
FTY1850
FTY645
FTY696
FTY1166
FTY991
FTY912
DYS551u4
FTY447
DYS518u3
FTY875
DYS536u1
FTY585
FTY896
FTY731
FTY401
FTY2011
FTY665
FTY814
FTY2050
DYS626u3
FTY750
FTY471
FTY985
FTY589
FTY420
FTY921
FTY457
FTY657
FTY1110
FTY485
FTY315
FTY1852
FTY1107
FTY489
FTY522
FTY654
FTY110
FTY881
DYS470
FTY534
FTY1101
FTY1933
FTY936
FTY772
FTY1047
FTY2351
FTY680
FTY2254
FTY1030
FTY2083
FTY287
FTY797
FTY2366
FTY951
FTY774
FTY1116
DYS621
FTY885
FTY1012
DYF394u1
FTY888
FTY648
FTY725
FTY643
FTY927
FTY1022
DYS559
FTY933
FTY633
FTY900
FTY1848
FTY478
FTY533
FTY467
FTY1900
FTY421
DYS612u5
DYS595
FTY668
FTY1028
DYS579
FTY646
FTY1026
FTY801
FTY432
FTY2301
FTY466
FTY531
FTY1083
FTY997
FTY1114
FTY830
FTY655
FTY910
FTY1143
FTY572
DYS506
DYS558u2
FTY1127
FTY712
FTY634
FTY499
FTY1094
FTY724
FTY535
FTY552
FTY430
FTY588
DYS609
FTY961
FTY813
FTY656
FTY839
FTY882
FTY789
FTY459
FTY1037
FTY435
FTY1157
FTY1546
FTY2242
FTY720
DYS614u10
FTY887
FTY473
FTY816
FTY1060
FTY472
FTY943
FTY1482
FTY565
DYS629
FTY891
FTY438
DYS582
FTY468
FTY649
FTY606
FTY792
FTY1087
FTY895
DYS614u3
FTY574
FTY1556
FTY560
FTY694
FTY1097
DYS518u6
FTY876
FTY2443
FTY990
FTY934
FTY465
FTY1046
FTY1312
FTY751
FTY1915
FTY678
FTY419
FTY958
FTY456
DYS592u1
FTY1172
FTY416
FTY650
FTY808
FTY1542
DYS721u1
FTY746
FTY2233
FTY892
FTY845
FTY1034
FTY498
DYF382u1
FTY637
DYS588
FTY947
DYS543u3
FTY644
DYS703
DYS649
FTY212
FTY781
FTY1106
FTY592
FTY848
FTY940
FTY903
FTY1081
FTY952
DYS706u2
FTY1084
FTY700
FTY482
DYS625u7
FTY960
FTY586
FTY1330
FTY1119
FTY1762
FTY1010
FTY417
FTY716
DYS627u3
FTY1942
FTY1067
FTY841
FTY1031
FTY1082
FTY1023
FTY475
FTY222
FTY962
FTY423
FTY664
DYS517u1
FTY1076
FTY1557
FTY1154
DYS681
FTY1002
DYS706u1
FTY1174
FTY986
FTY651
FTY886
FTY1078
DYS546u4
FTY1092
FTY2471
FTY1111
FTY461
FTY323
FTY1013
FTY506
FTY550
FTY767
FTY721
DYS548
FTY559
DYS705
FTY640
FTY613
FTY402
FTY2426
FTY755
P312/S1161324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123315916122626191211131210912121011113012132413101020151913241712152412231810141791211
L21/S1451324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
Raburn1324141111-14121212131329169-911112415193015-15-15-17111119-191515191736-37121211915-1681010810101223-23161012121581222201412111311121212

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 309491028809373793377434247
Kit: 5MZY9*16000000100000008300000
Used in age calculations16000000100000008300000
Counts of SNPs1921
Variant counts last updated 2020-09-08 02:39:27.

* BED data not available. Using default values.


Big Tree Main Page