Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > FGC5494 > FGC5561 > FGC7448 > FGC5496 > S1088

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
65932
BigY2
65932
16130461-C-T 14018581-C-T P8_Prx ***A*
19575544-C-G 17463664-C-G P5_Prx Y***A*
20043507-A-C 17931627-A-C P5_Prx ***A*
20052481-T-C 17940601-T-C P5_Prx ***A*
22305238-T-A 20143352-T-A DYZ19 ***A*
24264101-C-T 22117954-C-T P3_b1 ***A*
22313872-T-A 20151986-T-A DYZ19 A*
6792183-T-C 6924142-T-C A162 YY++
7292264-G-T 7424223-G-T A163 YY+**
7661401-G-A 7793360-G-A A164 YY++
7675843-T-G 7807802-T-G A165 YY++
7686445-T-C 7818404-T-C A166 YY++
8019078-C-T 8151037-C-T A167 YY++
8160883-A-G 8292842-A-G A168 YY++
8249117-C-T 8381076-C-T A169 YY++
8434346-T-C 8566305-T-C A170 YY++
9130242-C-T 9292633-C-T A171 Y++
9469513-G-C 9631904-G-C FGC82863 +**
9984386-C-T 10146777-C-T A174 Y++
13128419-G-A 10617905-G-A FGC70945 **+
13457294-T-C 11301618-T-C FGC20238 ++
14211639-T-A 12090933-T-A A175 YY++
14339652-G-GA 12218947-G-GA 8×A++
14954037-A-C 12842111-A-C A176 YY++
15110377-T-C 12998464-T-C A177 YY++
15555142-G-A 13443262-G-A A178 YY++
16413270-T-C 14301390-T-C A179 YY++
16760373-A-T 14648493-A-T A180 YY+**
16878168-T-C 14766288-T-C A181 YY++
16904762-G-C 14792882-G-C A182 YY++
17153045-G-A 15041165-G-A A183 YY++
17390527-C-T 15278647-C-T A184 YY++
17550902-A-C 15439022-A-C A185 YY++
17993340-A-G 15881460-A-G P7_Prx Y+
18575754-C-T 16463874-C-T A186 ZS2136 YY++
20827782-C-T 18665896-C-T A187 P4_Gap ++
21101380-G-A 18939494-G-A A188 Z13583 YY++
21699426-G-A 19537540-G-A A189 YY++
21907178-G-C 19745292-G-C A190 YY++
21908527-T-G 19746641-T-G A191 YY++
22239026-A-C 20077140-A-C FGC82867 DYZ19 ***+
22478175-T-G 20316289-T-G FGC20244 DYZ19 ++
22487058-G-T 20325172-G-T BY53314 DYZ19 **+
22658520-A-AT 20496634-A-AT 8×T+
23752173-ACT-A 21590287-ACT-A ++
13853003-G-T 11732297-G-T FGC82866 +
14568-G-T FGC81784 +
14176077-T-C 12055371-T-C YY*
22323188-T-G 20161302-T-G DYZ19 **
13724812-G-T 11569136-G-T FGC82865 *****
20620913-A-T 18459027-A-T P4_Prx **
25681320-CA-C 23535173-CA-C P1_b3 **
14926502-A-T 12814567-A-T **
14926498-G-T 12814563-G-T **
2855484-G-T 2987443-G-T **
26248920-T-A 24102773-T-A P1_Y1 15×A**
28522413-G-T 26376266-G-T **
17597955-C-A 15486075-C-A **
15305843-AAATAAT-A 13193942-AAATAATAAT-A 15×AAT**
13654378-G-T 11498702-G-T FGC82864 **
14499545-C-T 12387750-C-T CTS2815 **
21162931-A-T 19001045-A-T ZS172 **
14420806-G-T 12300081-G-T **
3640805-A-T 3772764-A-T **
10861261-C-A **
10821816-T-TCACTC **
19558378-C-A 17446498-C-A **
16827540-C-A 14715660-C-A FTA31689 **
17004592-C-A 14892712-C-A **
28660623-C-A 26514476-C-A **
10756481-T-G **
3833624-T-G 3965583-T-G **
10956596-T-C **
22598797-T-A 20436911-T-A **
21115862-C-A 18953976-C-A **
21054454-C-A 18892568-C-A **
14562372-C-G 12450572-C-G **
15446747-G-T 13334867-G-T **
22598693-C-T 20436807-C-T **
10744352-G-A **
10786610-G-T **
11011066-C-A **
8230421-C-A 8362380-C-A **
14835317-A-T 12723384-A-T **
10783182-G-T **
10889847-C-A **
10800730-T-A **
10800732-G-T **
10800744-G-C **
10800750-C-A **
10800756-A-T **
10800778-T-A **
10988878-T-A **
13484734-A-G 11329058-A-G **
56875555-C-A **
14700734-C-A 12588800-C-A **
10977870-C-A **
23819036-C-A 21657150-C-A **
18738829-A-G 16626949-A-G BY43528 **
21334658-C-A 19172772-C-A **
13218993-G-A 11063317-G-A **
9732935-C-T 9895326-C-T IR3_Prx **
10885415-C-A **
5447122-C-A 5579081-C-A **
2665622-C-A 2797581-C-A **
8090878-A-C 8222837-A-C **
16575101-C-A 14463221-C-A **
10986415-A-G **
23144339-C-A 20982453-C-A **
10801577-C-A **
9945422-G-T 10107813-G-T **
19739344-A-AACG 17627464-A-AACG P5_Prx **
8080641-C-A 8212600-C-A **
10746058-C-A **
17536701-C-T 15424821-C-T FGC20241 **
14225373-C-A 12104667-C-A **
21235083-C-A 19073197-C-A **
10949643-C-A **
13475609-G-C 11319933-G-C **
11031073-C-A **
15671118-G-T 13559238-G-T **
22996045-G-T 20834159-G-T **
26140238-G-T 23994091-G-T P1_Y1 **
6976535-C-A 7108494-C-A **
10744317-C-T **
7238285-A-G 7370244-A-G **
16188169-C-T 14076289-C-T **
17663099-C-A 15551219-C-A **
14395627-C-A 12274923-C-A **
17046743-G-T 14934863-G-T **
15066059-C-A 12954151-C-A **
21163023-C-A 19001137-C-A **
10888065-C-T **
10948283-C-A **
22520787-TCAAAA-T 20358901-TCAAAA-T **
16038960-C-A 13927080-C-A **
14835322-A-T 12723389-A-T **
21325865-C-A 19163979-C-A **
10887520-G-T **
14184556-C-A 12063850-C-A **
16278529-C-A 14166649-C-A **
13996658-C-A 11875952-C-A **
10994310-G-A **
10994317-A-G **
16739286-G-T 14627406-G-T **
23311350-C-A 21149464-C-A **
15171391-C-A 13059477-C-A **
17367747-C-A 15255867-C-A **
14404925-C-A 12284222-C-A FT138425 **
23277241-C-A 21115355-C-A **
16062162-C-A 13950282-C-A **
13433577-G-T 11277901-G-T **
11015656-C-A **
15734401-C-A 13622521-C-A **
18853479-T-C 16741599-T-C **
18249972-C-A 16138092-C-A **
10860902-TTTCCA-T **
16073013-C-A 13961133-C-A **
10673985-T-A **
23128752-C-A 20966866-C-A **
16094342-C-A 13982462-C-A **
17654888-C-A 15543008-C-A **
21617677-C-A 19455791-C-A **
10766731-C-A **
6918491-G-A 7050450-G-A **
15863081-C-A 13751201-C-A **
10860134-G-T **
10673031-A-T **
16666194-C-A 14554314-C-A **
20865354-C-A 18703468-C-A P4_Dst 18×CA**
10869472-T-C **
16462511-C-A 14350631-C-A **
11026007-C-G **
21457379-T-A 19295493-T-A **
10758001-A-T **
2845818-TCTC-T 2977777-TCTC-T **
13989113-C-A 11868407-C-A **
7630414-C-A 7762373-C-A **
14835326-TA-T 12723393-TA-T **
15340465-A-T 13228584-A-T **
16050054-C-A 13938174-C-A **
26376497-C-T 24230350-C-T P1_Y1 **
17211076-C-A 15099196-C-A **
18201184-A-G 16089304-A-G **
6147445-G-T 6279404-G-T IR3_Dst **
7254475-C-A 7386434-C-A **
7160584-A-C 7292543-A-C **
2793119-C-A 2925078-C-A **
10888051-T-C **
19271580-T-C 17159700-T-C **
11007520-C-G **
28660789-C-A 26514642-C-A **
19529321-C-G 17417441-C-G **
9983358-C-A 10145749-C-A FT373734 **
10994799-C-A **
10790128-C-A **
24244680-G-T 22098533-G-T P3_b1 **
7970412-C-A 8102371-C-A **
7231046-C-A 7363005-C-A **
15397141-G-T 13285261-G-T **
23831292-G-T 21669406-G-T **
26057914-A-AT 23911767-A-AT P1_Y1 **
4064232-C-A 4196191-C-A **
10840026-C-CCATTG **
10840039-C-T **
13601141-C-A 11445465-C-A **
17646801-C-A 15534921-C-A **
10900497-C-A **
13324820-C-A 11169144-C-A **
16266111-G-A 14154231-G-A **
18094284-C-A 15982404-C-A **
17367878-C-G 15255998-C-G **
21912222-C-A 19750336-C-A **
17498922-C-A 15387042-C-A **
23136979-C-A 20975093-C-A **
10949167-C-A **
15987449-C-A 13875569-C-A **
8090891-C-A 8222850-C-A **
10950376-C-T **
10950403-A-G **
10950406-C-CTATTG **
7253995-C-A 7385954-C-A **
16221093-C-A 14109213-C-A **
16007236-C-A 13895356-C-A **
22352475-G-C 20190589-G-C DYZ19 **
4561059-A-G 4693018-A-G **
28575189-C-A 26429042-C-A **
10865462-C-A **
7082775-C-A 7214734-C-A **
21308860-C-A 19146974-C-A **
7225352-C-A 7357311-C-A **
7433797-C-A 7565756-C-A **
17379040-C-A 15267160-C-A **
10922434-C-A **
15400062-A-G 13288182-A-G **
17571937-C-A 15460057-C-A **
9634220-T-TC 9796611-T-TC IR3_Prx **
11000423-C-G **
10686302-C-A **
23569164-C-A 21407278-C-A **
11022699-C-A **
10024395-C-A 10186786-C-A **
11022440-C-A **
16429184-G-C 14317304-G-C **
15776006-G-T 13664126-G-T **
10948327-A-C **
19510056-A-C 17398176-A-C **
26228723-A-G 24082576-A-G P1_Y1 **
4242915-C-A 4374874-C-A **
2909511-C-A 3041470-C-A **
27038870-C-A 24892723-C-A P1_r4 **
6491384-C-A 6623343-C-A **
15109072-C-A 12997159-C-A **
9591035-A-AT 9753426-A-AT IR3_Prx **
22262265-T-C 20100379-T-C DYZ19 **
22598727-C-A 20436841-C-A **
10839616-C-A **
10938663-G-C **
3346989-C-A 3478948-C-A **
15680078-A-C 13568198-A-C **
28653249-C-A 26507102-C-A **
7019152-C-A 7151111-C-A **
8501714-T-C 8633673-T-C **
5524820-C-A 5656779-C-A **
15823564-C-A 13711684-C-A **
28495749-C-T 26349602-C-T FT275422 **
56848306-A-C **
10938661-G-T **
10938671-C-T **
10938672-T-G **
10938682-T-C **
10938703-C-G **
10938716-C-T **
10938721-C-T **
10938722-T-C **
10938727-T-C **
10938728-CAACTT-C **
2855496-T-A 2987455-T-A **
14384269-T-G 12263565-T-G **
14246738-C-A 12126032-C-A FT329154 **
28470819-G-T 26324672-G-T **
13237552-C-A 11081876-C-A **
8751215-C-A 8883174-C-A **
14518839-C-A 12407040-C-A **
10992611-C-A FGC82613 **
23455237-G-T 21293351-G-T **
10832490-A-C **
19532578-C-A 17420698-C-A **
6013036-C-A 6144995-C-A **
22536224-C-A 20374338-C-A **
10969140-G-C **
18242080-C-A 16130200-C-A **
7649125-C-A 7781084-C-A **
22996041-T-A 20834155-T-A **
18841111-C-A 16729231-C-A **
28522401-G-A 26376254-G-A **
2665630-CT-C 2797589-CT-C **
2683376-T-C 2815335-T-C **
2740543-T-G 2872502-T-G FGC20237 **
2784318-T-C 2916277-T-C **
2791042-G-T 2923001-G-T **
2855483-T-G 2987442-T-G **
2856952-C-A 2988911-C-A **
2895270-A-C 3027229-A-C **
2951300-C-A 3083259-C-A **
2954125-G-T 3086084-G-T **
3032572-A-T 3164531-A-T **
3032645-G-A 3164604-G-A **
3053018-G-T 3184977-G-T **
3077978-A-G 3209937-A-G **
3089390-G-A 3221349-G-A **
3346865-C-A 3478824-C-A **
3363418-T-C 3495377-T-C **
3464493-A-T 3596452-A-T **
3519885-G-T 3651844-G-T **
3544146-C-A 3676105-C-A FT244729 **
3640808-T-C 3772767-T-C **
3640812-T-C 3772771-T-C **
3644900-C-G 3776859-C-G **
3644903-C-G 3776862-C-G **
3644938-A-C 3776897-A-C **
3644961-A-T 3776920-A-T **
3644967-C-G 3776926-C-G **
3645018-C-G 3776977-C-G **
3645340-A-C 3777299-A-C **
3645342-G-A 3777301-G-A FTA21844 **
3645343-G-C 3777302-G-C **
3645373-G-T 3777332-G-T **
3645379-C-T 3777338-C-T **
3645380-A-G 3777339-A-G **
3645405-A-T 3777364-A-T **
3645419-A-C 3777378-A-C **
3654732-T-C 3786691-T-C **
3695949-A-T 3827908-A-T **
3761191-C-A 3893150-C-A **
3773472-C-A 3905431-C-A **
3814228-C-A 3946187-C-A **
3866010-G-A 3997969-G-A **
3921644-A-T 4053603-A-T **
3990758-A-T 4122717-A-T **
4009072-C-A 4141031-C-A **
4022480-C-G 4154439-C-G **
4036981-A-T 4168940-A-T **
4094264-C-A 4226223-C-A **
4109255-C-A 4241214-C-A **
4123976-A-C 4255935-A-C **
4133503-A-G 4265462-A-G **
4160342-G-A 4292301-G-A FT319728 **
4244983-T-C 4376942-T-C **
4263282-G-A 4395241-G-A **
4466935-A-C 4598894-A-C **
4519979-A-C 4651938-A-C **
4520063-C-T 4652022-C-T **
4522383-T-A 4654342-T-A **
4525872-A-T 4657831-A-T **
4534606-C-G 4666565-C-G **
4534617-T-A 4666576-T-A **
4534622-A-T 4666581-A-T **
4557214-C-A 4689173-C-A **
4557654-C-A 4689613-C-A **
4875303-G-A 5007262-G-A **
4888128-A-C 5020087-A-C **
4957122-T-G 5089081-T-G **
4968363-T-G 5100322-T-G **
4969892-T-C 5101851-T-C **
5000558-C-T 5132517-C-T **
5000629-C-A 5132588-C-A **
5172296-G-C 5304255-G-C **
5216463-G-A 5348422-G-A **
5216781-C-A 5348740-C-A **
5358543-G-T 5490502-G-T **
5557006-C-A 5688965-C-A **
5560847-C-T 5692806-C-T **
5560858-A-C 5692817-A-C **
5560906-A-C 5692865-A-C **
5644396-A-G 5776355-A-G **
5644502-G-A 5776461-G-A **
5673235-C-A 5805194-C-A **
5676217-C-A 5808176-C-A **
5708975-A-C 5840934-A-C **
5717176-G-T 5849135-G-T **
5733804-CT-C 5865763-CT-C **
5736630-C-A 5868589-C-A **
5754790-A-C 5886749-A-C **
5777422-C-A 5909381-C-A **
5785323-T-C 5917282-T-C **
5801404-C-A 5933363-C-A **
5818558-C-A 5950517-C-A **
6062673-G-T 6194632-G-T **
6147508-G-T 6279467-G-T IR3_Dst **
6247078-G-C 6379037-G-C IR3_Dst **
6365079-T-C 6497038-T-C **
6375627-A-C 6507586-A-C **
6375636-A-G 6507595-A-G **
6437314-C-A 6569273-C-A **
6444613-C-A 6576572-C-A **
6445224-G-A 6577183-G-A **
6451996-G-A 6583955-G-A **
6464615-C-A 6596574-C-A **
6582607-A-G 6714566-A-G **
6637163-G-C 6769122-G-C **
6654128-C-A 6786087-C-A **
6671477-T-C 6803436-T-C **
6685179-G-T 6817138-G-T **
6816683-T-G 6948642-T-G **
6916131-G-A 7048090-G-A **
7061923-T-A 7193882-T-A **
7084586-A-T 7216545-A-T **
7091149-G-T 7223108-G-T **
7093646-A-T 7225605-A-T **
7115513-C-A 7247472-C-A **
7132865-G-GC 7264824-G-GC **
7132869-GT-G 7264828-GT-G **
7235187-T-A 7367146-T-A **
7238296-G-T 7370255-G-T **
7238319-G-T 7370278-G-T **
7243383-A-T 7375342-A-T **
7243388-A-C 7375347-A-C **
7243391-C-CA 7375350-C-CA **
7243402-C-T 7375361-C-T **
7243403-A-G 7375362-A-G **
7243407-G-C 7375366-G-C **
7256533-G-A 7388492-G-A **
7257922-A-G 7389881-A-G **
7275314-A-C 7407273-A-C **
7347608-C-A 7479567-C-A **
7371061-C-A 7503020-C-A **
7381875-A-C 7513834-A-C **
7390334-C-A 7522293-C-A **
7434064-A-C 7566023-A-C **
7470540-G-C 7602499-G-C IR1_L **
7470546-G-C 7602505-G-C IR1_L **
7470550-G-C 7602509-G-C IR1_L **
7470566-A-C 7602525-A-C IR1_L **
7470578-A-T 7602537-A-T IR1_L **
7470583-C-T 7602542-C-T IR1_L **
7470590-A-C 7602549-A-C IR1_L **
7470595-A-C 7602554-A-C IR1_L **
7541446-T-A 7673405-T-A **
7615139-T-C 7747098-T-C **
7621456-C-T 7753415-C-T **
7630358-G-C 7762317-G-C **
7630362-C-G 7762321-C-G **
7630380-T-G 7762339-T-G **
7630392-A-T 7762351-A-T **
7630397-C-A 7762356-C-A **
7630402-A-G 7762361-A-G **
7630406-T-G 7762365-T-G **
7630426-C-A 7762385-C-A **
7630442-G-A 7762401-G-A **
7630446-G-A 7762405-G-A **
7630452-C-G 7762411-C-G **
7630502-G-C 7762461-G-C **
7630507-T-C 7762466-T-C **
7630524-A-C 7762483-A-C **
7630527-A-G 7762486-A-G **
7630546-A-C 7762505-A-C **
7630551-A-T 7762510-A-T **
7630554-A-T 7762513-A-T **
7630603-C-T 7762562-C-T **
7630645-G-T 7762604-G-T **
7754521-G-T 7886480-G-T **
7939419-G-C 8071378-G-C **
7996009-T-G 8127968-T-G **
8052544-A-T 8184503-A-T **
8090795-T-C 8222754-T-C **
8090796-C-T 8222755-C-T **
8090822-T-C 8222781-T-C **
8090833-C-T 8222792-C-T **
8090838-A-C 8222797-A-C **
8090842-A-C 8222801-A-C **
8102660-T-C 8234619-T-C **
8353188-G-C 8485147-G-C **
8501729-T-A 8633688-T-A **
8501747-T-G 8633706-T-G **
8669740-G-T 8801699-G-T **
8748967-A-C 8880926-A-C **
8748968-C-A 8880927-C-A **
8816479-G-A 8948438-G-A **
8822491-G-T 8954450-G-T **
8850751-G-T 8982710-G-T **
9109537-T-G **
9080010-C-T 9242401-C-T **
9483472-A-T 9645863-A-T **
9507972-A-G 9670363-A-G **
9508356-C-G 9670747-C-G **
9511397-T-C 9673788-T-C **
9591111-C-T 9753502-C-T IR3_Prx **
9634194-A-T 9796585-A-T IR3_Prx **
9634208-T-G 9796599-T-G IR3_Prx **
9634255-T-A 9796646-T-A IR3_Prx **
9634262-G-C 9796653-G-C IR3_Prx **
9773579-A-C 9935970-A-C **
9926688-C-A 10089079-C-A **
9934751-C-A 10097142-C-A **
9939986-G-A 10102377-G-A **
9940050-T-C 10102441-T-C **
9943532-G-T 10105923-G-T **
9962529-A-C 10124920-A-C **
9983197-T-A 10145588-T-A **
9983206-G-A 10145597-G-A **
9990644-G-T 10153035-G-T **
9993479-C-A 10155870-C-A **
10023737-G-A 10186128-G-A FT376434 **
10033134-G-A 10195525-G-A **
10057482-T-C 10219873-T-C **
10059523-C-T 10221914-C-T **
10059534-T-C 10221925-T-C **
10059535-T-A 10221926-T-A **
10059539-A-G 10221930-A-G **
10654846-C-A **
10654998-T-C **
10656071-A-C **
10656963-A-C **
10661933-C-A **
10663285-T-C **
10663287-A-T **
10663289-T-TC **
10663295-T-C **
10671190-C-T **
10673017-T-C **
10673022-T-C **
10686860-A-C **
10692290-T-C **
10744331-G-C **
10745306-A-C **
10754165-C-T FT87698 **
10761104-A-C **
10764385-T-A **
10764821-C-A **
10764833-C-T **
10766734-C-T **
10766741-C-A **
10766769-T-C **
10771202-C-G **
10773406-A-G **
10773479-C-A **
10774037-T-A **
10783448-C-A **
10786054-A-T **
10786142-C-G **
10786227-C-A **
10786512-A-C **
10786560-C-A **
10786576-C-A **
10786585-T-C **
10793797-A-G FT431459 **
10793881-C-A **
10794058-G-C **
10800735-C-T **
10819020-C-A **
10819076-C-A **
10819559-TC-T **
10824361-G-T **
10827515-C-A **
10831339-T-A **
10843724-T-TCCCCTCCACCC **
10844574-A-C **
10844577-C-A **
10844772-C-T **
10858535-T-A **
10864668-C-G FT434602 **
10868108-C-A **
10880831-T-C **
10886252-G-C **
10888072-A-C **
10888352-C-A **
10894280-C-A **
10895601-C-A **
10920887-G-T **
10930515-C-A **
10934180-C-A **
10934887-C-T **
10935168-C-A **
10948306-C-T **
10948311-C-G **
10948333-C-T **
10948338-C-T FT437781 **
10948343-C-T **
10948355-C-T **
10949326-T-G **
10950446-C-T **
10951030-C-A **
10952587-C-A **
10954566-C-A **
10954789-T-C **
10954835-C-A FT438064 **
10960004-T-G **
10962586-C-A **
10970730-T-C **
10973440-A-G **
10974715-C-A **
10976414-C-A **
10976537-C-T **
10976542-G-T **
10976544-G-C **
10976549-T-C **
10977099-A-C **
10980552-A-G **
10983381-C-A **
10986603-T-C **
10995740-A-C **
10995749-G-C **
10995751-A-C **
10999313-T-C **
11001284-T-C **
11001653-C-T **
11001733-T-C **
11007503-C-A **
11007512-C-G **
11007513-C-G **
11007559-T-A **
11007564-T-C **
11011903-T-A **
11011970-A-T **
11011997-G-C **
11013745-G-A **
11013751-T-C **
11013757-T-C **
11013781-T-C **
11016804-G-T FT393779 **
11016828-T-A **
11020265-C-G **
11020397-C-A **
11020917-T-C **
11024594-A-C **
11026004-A-G **
11028127-T-G **
11035986-A-G **
13227994-A-T 11072318-A-T **
13287379-C-A 11131703-C-A **
13303385-T-A 11147709-T-A **
13303410-C-A 11147734-C-A **
13361416-A-T 11205740-A-T **
13442423-T-A 11286747-T-A **
13475614-T-A 11319938-T-A **
13504810-TA-T 11349134-TA-T **
13522002-G-A 11366326-G-A **
13541705-G-T 11386029-G-T **
13550903-C-A 11395227-C-A **
13559129-G-T 11403453-G-T **
13576193-C-A 11420517-C-A **
13596403-C-A 11440727-C-A **
13623630-C-A 11467954-C-A **
13630790-A-G 11475114-A-G **
13630805-A-G 11475129-A-G **
13642932-A-G 11487256-A-G **
13717521-G-C 11561845-G-C **
11643879-T-G **
11645305-A-G **
13856610-A-C 11735904-A-C **
13935011-C-A 11814305-C-A **
13953892-G-T 11833186-G-T **
13990135-C-G 11869429-C-G **
13998292-C-A 11877586-C-A **
14073621-C-T 11952915-C-T **
14074025-C-A 11953319-C-A **
14074072-C-A 11953366-C-A **
14085918-G-C 11965212-G-C **
14088458-G-T 11967752-G-T **
14123980-C-T 12003274-C-T FT149116 **
14124023-T-A 12003317-T-A **
14124057-T-A 12003351-T-A **
14124062-T-A 12003356-T-A **
14124071-A-G 12003365-A-G **
14124079-T-A 12003373-T-A **
14142364-A-G 12021658-A-G **
14142366-A-C 12021660-A-C **
14160756-G-T 12040050-G-T **
14168111-A-G 12047405-A-G **
14180983-A-C 12060277-A-C **
14229809-A-T 12109103-A-T **
14255196-C-A 12134490-C-A **
14270675-T-A 12149969-T-A **
14285932-T-C 12165226-T-C **
14292792-C-A 12172086-C-A **
14292846-T-G 12172140-T-G **
14355180-A-G 12234475-A-G **
14364111-T-G 12243406-T-G **
14371322-A-C 12250618-A-C **
14397642-C-G 12276938-C-G **
14397687-G-T 12276983-G-T **
14458303-T-C 12337576-T-C **
14518517-T-G 12406718-T-G **
14518829-A-G 12407030-A-G **
14531183-C-A 12419384-C-A **
14554961-A-G 12443162-A-G **
14561408-C-A 12449609-C-A **
14562359-TTTTTG-T 12450559-TTTTTG-T **
14596102-T-C 12484302-T-C **
14608048-G-A 12496250-G-A **
14630562-A-T 12518631-A-T **
14648798-C-T 12536863-C-T **
14714720-T-C 12602787-T-C FT76326 **
14719885-C-A 12607953-C-A **
14755614-A-G 12643683-A-G **
14933534-G-T 12821599-G-T **
14953470-C-A 12841544-C-A **
14953577-T-C 12841651-T-C **
15047744-C-A 12935835-C-A **
15066352-T-C 12954443-T-C **
15109827-C-A 12997914-C-A **
15218692-C-A 13106778-C-A **
15248099-G-C 13136185-G-C **
15276587-C-A 13164676-C-A **
15333819-C-A 13221937-C-A **
15370482-T-A 13258602-T-A **
15402571-A-C 13290691-A-C **
15402574-A-C 13290694-A-C **
15402578-G-T 13290698-G-T **
15402594-G-C 13290714-G-C **
15477239-C-T 13365359-C-T **
15669847-C-A 13557967-C-A **
15717765-C-A 13605885-C-A **
15748186-T-A 13636306-T-A **
15748206-A-T 13636326-A-T **
15816419-G-T 13704539-G-T **
15928695-T-C 13816815-T-C **
15944236-C-A 13832356-C-A **
15975075-C-A 13863195-C-A **
15975767-A-G 13863887-A-G FGC20240 **
15987482-G-A 13875602-G-A **
16029616-G-T 13917736-G-T FT418279 **
16036298-A-G 13924418-A-G **
16054906-A-G 13943026-A-G **
16060533-G-A 13948653-G-A **
16066937-G-T 13955057-G-T **
16070707-A-G 13958827-A-G **
16070800-G-A 13958920-G-A **
16070801-A-T 13958921-A-T **
16070819-C-A 13958939-C-A **
16092641-C-G 13980761-C-G **
16092726-C-A 13980846-C-A **
16092866-A-C 13980986-A-C **
16094423-C-A 13982543-C-A **
16171444-A-C 14059564-A-C **
16277922-G-T 14166042-G-T **
16336923-G-A 14225043-G-A **
16345017-T-A 14233137-T-A **
16356052-G-A 14244172-G-A FT45189 **
16429169-A-G 14317289-A-G **
16469809-G-T 14357929-G-T **
16493224-T-G 14381344-T-G **
16588283-G-T 14476403-G-T **
16588434-A-G 14476554-A-G **
16623142-C-G 14511262-C-G **
16623721-G-T 14511841-G-T **
16636052-C-A 14524172-C-A **
16648245-G-T 14536365-G-T **
16673635-C-T 14561755-C-T **
16673651-C-T 14561771-C-T FTA39993 **
16673670-T-G 14561790-T-G **
16676597-T-C 14564717-T-C **
16701688-A-T 14589808-A-T **
16739411-G-A 14627531-G-A **
16765572-G-A 14653692-G-A **
16827518-T-G 14715638-T-G **
16827528-G-A 14715648-G-A **
16886345-A-G 14774465-A-G **
17014527-C-G 14902647-C-G **
17014574-G-T 14902694-G-T **
17058568-G-T 14946688-G-T **
17130020-G-T 15018140-G-T **
17250993-C-A 15139113-C-A **
17455787-A-G 15343907-A-G **
17455862-G-A 15343982-G-A **
17455898-G-A 15344018-G-A **
17455904-T-C 15344024-T-C **
17455958-C-A 15344078-C-A **
17491095-A-G 15379215-A-G **
17584154-TTTGA-T 15472274-TTTGA-T **
17628309-A-T 15516429-A-T **
17629762-A-T 15517882-A-T **
17644367-C-A 15532487-C-A **
17808204-A-G 15696324-A-G **
17812197-T-A 15700317-T-A **
17831342-T-C 15719462-T-C FGC20242 **
17850143-G-C 15738263-G-C **
17915071-A-G 15803191-A-G **
17960991-A-C 15849111-A-C **
17997327-A-T 15885447-A-T P7_Gap **
18022420-A-G 15910540-A-G **
18088331-A-T 15976451-A-T **
18174686-G-GTA 16062806-G-GTA **
18340602-G-C 16228722-G-C P6_Prx **
18454934-T-TTTC 16343054-T-TTTC P6_Dst **
18573526-C-A 16461646-C-A **
18584027-A-T 16472147-A-T **
18630649-A-T 16518769-A-T **
18630651-T-C 16518771-T-C **
18749512-G-T 16637632-G-T **
18750173-A-G 16638293-A-G **
18780223-G-C 16668343-G-C **
18819535-T-A 16707655-T-A **
18906290-AC-A 16794410-AC-A **
18932687-T-G 16820807-T-G **
18933583-A-T 16821703-A-T **
18951635-A-C 16839755-A-C **
18969379-C-G 16857499-C-G **
19031484-C-G 16919604-C-G **
19043774-C-A 16931894-C-A **
19049578-TG-T 16937698-TG-T **
19054363-C-T 16942483-C-T **
19079049-T-C 16967169-T-C **
19097330-A-G 16985450-A-G **
19097349-G-C 16985469-G-C **
19125692-C-T 17013812-C-T **
19155903-G-T 17044023-G-T **
19299172-C-T 17187292-C-T **
19355892-G-T 17244012-G-T **
19355904-G-T 17244024-G-T **
19377067-C-A 17265187-C-A **
19436830-A-C 17324950-A-C **
19510047-C-T 17398167-C-T **
19510058-G-T 17398178-G-T **
19529474-G-T 17417594-G-T **
19529483-C-T 17417603-C-T **
19529488-G-A 17417608-G-A 10×A**
19536811-C-A 17424931-C-A **
19560258-C-A 17448378-C-A **
19668739-G-A 17556859-G-A P5_Prx **
19668748-G-A 17556868-G-A P5_Prx **
19739322-C-G 17627442-C-G P5_Prx **
19739399-T-C 17627519-T-C P5_Prx **
19739427-A-T 17627547-A-T P5_Prx **
19739429-A-G 17627549-A-G P5_Prx **
19834268-G-T 17722388-G-T P5_Prx **
19948965-T-G 17837085-T-G P5_Prx **
19948980-T-A 17837100-T-A P5_Prx **
20116667-G-T 18004787-G-T P5_Dst **
20116736-G-A 18004856-G-A P5_Dst **
20116738-T-A 18004858-T-A P5_Dst **
20359420-G-T 18197534-G-T P5_Dst **
20379159-AAAAAAAGG-A 18217273-AAAAAAAGG-A P5_Dst **
20424327-C-A 18262441-C-A P5_Dst **
20433689-G-T 18271803-G-T P5_Dst **
20440446-A-C 18278560-A-C P5_Dst **
20557572-T-G 18395686-T-G P5_Dst **
20557639-G-T 18395753-G-T P5_Dst **
20743554-G-A 18581668-G-A P4_Prx **
20743568-G-A 18581682-G-A P4_Prx **
20743584-T-A 18581698-T-A P4_Prx **
20865341-C-A 18703455-C-A P4_Dst **
21042235-G-T 18880349-G-T **
21054378-T-A 18892492-T-A **
21076969-T-A 18915083-T-A **
21076970-C-A 18915084-C-A **
21106848-C-T 18944962-C-T **
21115893-T-A 18954007-T-A **
21125771-C-A 18963885-C-A **
21162925-A-T 19001039-A-T **
21162937-C-G 19001051-C-G **
21208719-G-A 19046833-G-A **
21266746-A-G 19104860-A-G FTB15389 **
21283207-TA-T 19121321-TA-T 8×A**
21283293-G-T 19121407-G-T **
21284992-T-C 19123106-T-C **
21320141-G-A 19158255-G-A **
21324103-T-C 19162217-T-C **
21334643-G-T 19172757-G-T **
21352712-C-A 19190826-C-A **
21367277-C-T 19205391-C-T **
21457357-T-A 19295471-T-A **
21457364-A-C 19295478-A-C **
21457392-A-G 19295506-A-G **
21457409-T-G 19295523-T-G **
21457413-T-G 19295527-T-G **
21464829-C-G 19302943-C-G FT452957 **
21597054-T-G 19435168-T-G **
21597089-T-G 19435203-T-G **
21597103-A-T 19435217-A-T **
21697417-C-T 19535531-C-T **
21713422-G-C 19551536-G-C **
21809927-G-T 19648041-G-T FGC20243 **
21824616-G-T 19662730-G-T **
21830800-C-T 19668914-C-T **
21830870-T-C 19668984-T-C **
22063861-T-G 19901975-T-G **
22080612-G-A 19918726-G-A **
22097019-A-T 19935133-A-T **
22154895-C-A 19993009-C-A **
22164235-A-G 20002349-A-G **
22164249-A-T 20002363-A-T **
22166737-C-G 20004851-C-G **
22170459-C-A 20008573-C-A **
22316233-T-A 20154347-T-A DYZ19 **
22316235-C-T 20154349-C-T DYZ19 **
22316249-C-G 20154363-C-G DYZ19 **
22316272-T-C 20154386-T-C DYZ19 **
22316298-G-T 20154412-G-T DYZ19 **
22316300-T-C 20154414-T-C DYZ19 **
22316305-C-G 20154419-C-G DYZ19 **
22447682-T-G 20285796-T-G DYZ19 **
22591398-C-A 20429512-C-A **
22598802-G-A 20436916-G-A **
22639468-C-T 20477582-C-T **
22655287-A-G 20493401-A-G **
22713212-C-A 20551326-C-A **
23142099-C-T 20980213-C-T **
23200476-G-T 21038590-G-T **
23202942-T-A 21041056-T-A **
23311352-C-G 21149466-C-G **
23381110-T-A 21219224-T-A **
23395687-A-G 21233801-A-G **
23441304-C-A 21279418-C-A **
23516539-A-G 21354653-A-G **
23516622-G-T 21354736-G-T **
23579400-A-G 21417514-A-G **
23789563-C-A 21627677-C-A **
23838717-G-A 21676831-G-A **
23875483-G-T 21713597-G-T **
21757694-T-G **
21783795-A-G **
24220773-T-A 22074626-T-A P3_b1 **
24259841-A-C 22113694-A-C P3_b1 **
24373199-T-A 22227052-T-A **
24415756-A-G 22269609-A-G **
24450549-T-A 22304402-T-A **
24513516-A-T 22367369-A-T **
24626440-T-A 22480293-T-A P3_t2 **
24626442-T-A 22480295-T-A P3_t2 **
24626452-C-T 22480305-C-T P3_t2 8×T**
24626453-T-TTA 22480306-T-TTA P3_t2 **
24890216-A-C 22744069-A-C g1 **
26014999-T-G 23868852-T-G P1_Y1 **
26015015-A-C 23868868-A-C P1_Y1 **
26015029-A-T 23868882-A-T P1_Y1 **
26015039-G-C 23868892-G-C P1_Y1 **
26044985-T-G 23898838-T-G P1_Y1 **
26045977-C-A 23899830-C-A P1_Y1 **
26355439-C-A 24209292-C-A P1_Y1 **
26699378-C-A 24553231-C-A P1_g2 **
27606990-G-T 25460843-G-T P1_Y2 **
27862499-A-T 25716352-A-T P1_Y2 **
28234460-A-T 26088313-A-T P1_b4 **
28506436-G-T 26360289-G-T **
28531341-T-A 26385194-T-A **
28539579-C-A 26393432-C-A **
28539580-T-C 26393433-T-C **
28558248-C-T 26412101-C-T **
28589090-A-T 26442943-A-T **
28611390-C-A 26465243-C-A **
28611400-G-A 26465253-G-A **
28611526-G-T 26465379-G-T **
28620768-T-A 26474621-T-A **
28650021-C-A 26503874-C-A **
28668002-G-T 26521855-G-T **
28689651-A-C 26543504-A-C **
28771868-G-C 26625721-G-C **
28776389-G-T 26630242-G-T **
28798859-G-C 26652712-G-C **
56734737-G-A **
56825582-G-T **
56840289-C-G **
56843809-G-C **
56843850-G-C **
56848652-C-A **
56850482-A-T **
56850517-G-T **
56860902-C-A **
13851591-A-C,G 11730885-A-C,G ***
13701315-T-A 11545639-T-A ***
13839708-G-C 11719002-G-C ***
13859332-A-G 11738626-A-G ***
13817328-C-G 11696622-C-G ***
24118042-A-AT 21971895-A-AT P3_b1 15×T***
28800164-A-G 26654017-A-G ***
13803117-GGAATT-G 11682411-GGAATT-G ***
13865857-A-G 11745151-A-G ***
13452773-C-T 11297097-C-T ***
13452846-C-G 11297170-C-G ***
13452847-TCCTTTTCA-A,G 11297171-TCCTTTTCA-A,G ***
13870031-G-A 11749325-G-A ***
13870110-GA-G 11749404-GA-G ***
28800194-G-A 26654047-G-A ***
28785707-G-T 26639560-G-T ***
13853066-T-A 11732360-T-A ***
13139533-T-C 10629019-T-C ***
6347814-G-GAGAAAGAA 6479773-G-GAGAAAGAA 12×AGAA***
13652070-G-A 11496394-G-A ***
13331773-T-C 11176097-T-C ***
13331794-GTCT-G 11176118-GTCT-G ***
13331818-G-A 11176142-G-A ***
13465298-T-TA 11309622-T-TA ***
13676638-A-G 11520962-A-G ***
13817352-C-G 11696646-C-G ***
13833511-T-C 11712805-T-C ***
13833526-G-T 11712820-G-T ***
13846215-T-A 11725509-T-A ***
13867757-G-A 11747051-G-A ***
15305843-AAATAAT-A,AA 13193942-AAATAATAAT-A,AA 15×AAT***
19800611-CTCCTTTTT-C 17688731-CTCCTTTTT-C P5_Prx ***
22229316-C-A 20067430-C-A DYZ19 ***
22244250-G-A 20082364-G-A DYZ19 ***
22259564-A-C 20097678-A-C DYZ19 ***
22269481-C-T 20107595-C-T DYZ19 ***
22274125-C-T 20112239-C-T DYZ19 ***
22310360-GT-G 20148474-GT-G DYZ19 ***
22353512-C-T 20191626-C-T DYZ19 ***
22366556-T-G 20204670-T-G DYZ19 ***
22425909-G-T 20264023-G-T DYZ19 ***
22429101-C-A 20267215-C-A DYZ19 ***
22435544-G-T 20273658-G-T DYZ19 ***
24090843-A-C 21944696-A-C P3_b1 ***
24812578-A-G 22666431-A-G P3_b2 ***
24978550-C-G 22832403-C-G g1 ***
25106380-A-G 22960233-A-G g1 ***
25123172-C-T 22977025-C-T g1 ***
25155173-C-T 23009026-C-T g1 ***
25312980-C-T 23166833-C-T P2_r1 ***
26264399-A-G 24118252-A-G P1_Y1 ***
28785720-T-A 26639573-T-A ***
28787543-G-T 26641396-G-T ***
28800169-A-G 26654022-A-G ***
58975912-C-CCATTCCATTCCATTCCATCTCATTG 56829765-C-CCATTCCATTCCATTCCATCTCATTG ***
16679093-C-T 14567213-C-T ***
13213798-T-G 11058122-T-G FGC24526 ***
13141681-A-ATCCAT,T 10631167-A-ATCCAT,T 5×TCCAT***
13853003-G-A,T 11732297-G-A,T ***
10946573-C-A ***
10988609-C-T ***
10757330-C-A ***
9732923-C-A 9895314-C-A IR3_Prx ***
28633159-C-A 26487012-C-A ***
11038179-A-CTGCTC ***
11038198-T-C ***
17136464-ATTAT-A 15024584-ATTAT-A 5×TTAT***
15740481-C-A 13628601-C-A ***
18035694-TTGA-T 15923814-TTGA-T ***
10939821-C-A ***
10669496-C-A ***
28815005-A-G 26668858-A-G ***
6791006-C-A 6922965-C-A ***
10762985-C-T ***
11038160-C-A ***
11038174-C-T ***
19429624-C-A 17317744-C-A ***
21996275-G-T 19834389-G-T ***
17668514-TTTG-T 15556634-TTTG-T ***
10988592-TTTCATTCCAC-T,TTTTATTCCAC ***
14312339-G-A 12191633-G-A ***
22103540-C-A 19941654-C-A ***
3834981-C-A 3966940-C-A ***
4388452-A-G 4520411-A-G ***
10678139-A-T ***
27699982-G-T 25553835-G-T P1_Y2 ***
10663000-C-A ***
6807684-C-A 6939643-C-A ***
8403271-G-A 8535230-G-A ***
2909345-T-C 3041304-T-C ***
3332232-T-G 3464191-T-G ***
3640954-T-C 3772913-T-C ***
4960747-C-A 5092706-C-A ***
7134886-C-A 7266845-C-A ***
7201678-T-C 7333637-T-C ***
7250448-C-A 7382407-C-A 8×A***
7256067-G-A 7388026-G-A ***
7773718-C-A 7905677-C-A ***
8124698-A-G 8256657-A-G ***
8273646-T-C 8405605-T-C ***
9172815-C-T 9335206-C-T ***
9951808-G-T 10114199-G-T ***
10026624-C-G 10189015-C-G ***
10652381-C-A ***
10677630-C-A ***
10809505-G-T ***
10827322-C-A ***
10927394-C-A ***
10996999-G-A ***
10999874-C-CCCTGCACTCGCTTTG ***
13450104-CTCCACTCCACCCCATCCCATCCCATTCTATTCCAT-C,CTCCACTCCACCCCATTCCACCCCATTCCATTCCTT 11294428-CTCCACTCCACCCCATCCCATCCCATTCTATTCCAT-C,CTCCACTCCACCCCATTCCACCCCATTCCATTCCTT ***
13643328-T-C 11487652-T-C ***
13936292-G-A 11815586-G-A 4×GAAA***
14184696-C-G 12063990-C-G ***
15176304-T-G 13064390-T-G ***
15728626-G-T 13616746-G-T BY207073 ***
15975120-C-A 13863240-C-A ***
16019293-C-A 13907413-C-A ***
16486604-C-A 14374724-C-A ***
16611219-G-GT 14499339-G-GT 8×T***
16882229-G-T 14770349-G-T ***
17141942-C-CTG 15030062-C-CTG 8×TG***
17239245-G-A 15127365-G-A ***
17407970-C-A 15296090-C-A ***
17951341-C-T 15839461-C-T ***
18566227-C-A 16454347-C-A ***
18630546-A-G 16518666-A-G ***
18718201-T-A 16606321-T-A ***
19071542-C-A 16959662-C-A ***
19465820-C-T 17353940-C-T ***
21960400-T-C 19798514-T-C ***
22027624-G-C 19865738-G-C ***
22085406-G-T 19923520-G-T ***
22173979-G-A 20012093-G-A ***
22658520-A-AT,ATT 20496634-A-AT,ATT 8×T***
24050405-C-A 21904258-C-A P3_b1 ***
56843056-C-A ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.