Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > L513/S215/DF1 > S5668

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
U2464
BigY2
U2464
28817946-G-A 26671799-G-A A*
28816799-A-G 26670652-A-G A*
28805316-T-C 26659169-T-C A*
28815523-A-G 26669376-A-G A*
20788296-C-T 18626410-C-T P4_Prx ***A*
20705958-C-T 18544072-C-T P4_Prx ***A*
19571600-G-C 17459720-G-C P5_Prx Y***A*
6253131-A-G 6385090-A-G IR3_Dst ***A*
28805294-A-T 26659147-A-T A*
28817951-T-C 26671804-T-C A*
28810981-A-T 26664834-A-T A*
28805313-G-C 26659166-G-C A*
24302808-T-G 22156661-T-G P3_t1 A*
28805289-T-G 26659142-T-G A*
22465723-T-G 20303837-T-G BY158997 DYZ19 ++
19239431-T-C 17127551-T-C BY127586 YY++
18958017-A-AC 16846137-A-AC ++
21373396-A-T 19211510-A-T BY132432 YY++
18209275-T-A 16097395-T-A BY120874 YY++
23025839-C-T 20863953-C-T BY142398 YY++
22476075-G-T 20314189-G-T BY36573 DYZ19 ++
22478011-G-C 20316125-G-C BY158991 DYZ19 ++
22515868-A-G 20353982-A-G BY138617 Y++
18100613-G-T 15988733-G-T BY120023 YY++
23449909-G-T 21288023-G-T BY145352 YY++
23860627-A-C 21698741-A-C BY148488 Y++
23984159-C-A 21838012-C-A BY149005 Y++
24892352-G-A 22746205-G-A BY158698 g1 ++
7104436-TTCTC-T 7236395-TTCTC-T 9×TC++
14892525-G-GT 12780591-G-GT ++
19259418-TA-T 17147538-TA-T ++
15175567-A-T 13063653-A-T BY100042 YY+
15175568-A-T 13063654-A-T BY100043 YY+
18182679-A-G 16070799-A-G BY120714 YY++
15198917-TA-T 13087003-TA-T ++
17769195-C-T 15657315-C-T BY117292 YY++
7706949-C-T 7838908-C-T BY67061 YY++
6865467-A-G 6997426-A-G BY61824 YY++
7962401-T-C 8094360-T-C BY69091 YY++
8203734-A-T 8335693-A-T BY70706 YY++
8596014-C-T 8727973-C-T Y130643 YY++
8670734-T-C 8802693-T-C BY75076 YY++
13720262-G-A 11564586-G-A BY89792 **+
14046191-C-A 11925485-C-A BY92597 YY++
14368284-C-A 12247580-C-A BY95259 YY++
14618470-T-A 12506668-T-A BY96813 Y**+
2819494-G-T 2951453-G-T BY56636 YY++
22470891-G-T 20309005-G-T BY13914 DYZ19 ++
15033824-A-G 12921912-A-G BY99273 YY++
7915411-T-TATCATA 8047370-T-TATCATA ++
17663870-G-A 15551990-G-A BY116466 YY++
15040908-G-A 12928998-G-A BY99357 YY++
15175567-AA-T 13063653-AA-T +
15175569-A-T 13063655-A-T YY+
15227610-GAA-G 13115696-GAA-G ++
15465690-G-C 13353810-G-C FGC18667Y34486 YY++
15740268-C-T 13628388-C-T BY103753 Y**+
15787096-C-T 13675216-C-T BY104135 YY++
17194298-T-C 15082418-T-C YP6086 YY++
17404046-G-T 15292166-G-T BY114504 YY++
17439473-C-T 15327593-C-T BY114807 YY++
17515552-C-T 15403672-C-T BY115390 YY++
23530641-G-GTA 21368755-G-GTA ****
13718294-T-A 11562618-T-A BY160756 *
22269235-A-T 20107349-A-T DYZ19 *
28814336-G-C 26668189-G-C ****
22318290-C-A 20156404-C-A DYZ19 ****
22277354-G-C 20115468-G-C DYZ19 ****
22298905-C-A 20137019-C-A DYZ19 ****
14383-T-C *
14407-C-T *
22312478-T-A 20150592-T-A DYZ19 ****
15131875-C-A 13019962-C-A **
14300743-C-A 12180037-C-A **
14296917-C-T 12176211-C-T **
14241153-C-A 12120447-C-A **
14216287-C-A 12095581-C-A **
14134676-G-T 12013970-G-T **
13984238-C-G 11863532-C-G **
14093647-C-A 11972941-C-A **
13998071-CTTTT-C 11877365-CTTTT-C 19×T**
13961407-T-A 11840701-T-A **
13856951-C-A 11736245-C-A **
13809522-AGGAATGGAATGGAAT-A 11688816-AGGAATGGAATGGAAT-A 10×GGAAT**
11647866-C-A **
13725031-G-A 11569355-G-A **
14405783-C-A 12285080-C-A **
14450517-C-T 12329790-C-T **
14449675-C-A 12328948-C-A **
15396331-G-C 13284451-G-C **
14712536-G-T 12600603-G-T **
14688606-C-A 12576672-C-A **
13576248-C-A 11420572-C-A **
14671792-G-T 12559858-G-T **
14627117-A-G 12515185-A-G **
14627115-A-C 12515183-A-C **
15654938-C-A 13543058-C-A **
14802984-T-A 12691055-T-A **
7303573-C-A 7435532-C-A **
14627109-C-T 12515177-C-T **
14627094-TGG-A 12515162-TGG-A **
14627088-G-A 12515156-G-A **
14605851-T-C 12494053-T-C **
14589040-T-C 12477240-T-C **
14468001-T-C 12347270-T-C **
13585370-C-G 11429694-C-G **
10925525-A-ACTCGG **
13550728-AT-A 11395052-AT-A **
7428325-C-A 7560284-C-A **
10671173-C-A **
10660937-G-T **
10024945-A-G 10187336-A-G **
10024048-C-A 10186439-C-A **
10023347-C-A 10185738-C-A **
9965282-C-A 10127673-C-A **
15712305-G-A 13600425-G-A **
9938606-C-T 10100997-C-T **
10773561-GCTCCA-G **
9887044-T-C 10049435-T-C **
9461743-C-A 9624134-C-A **
9077289-G-T 9239680-G-T **
8856778-G-A 8988737-G-A **
8734323-C-A 8866282-C-A **
8481983-C-AA 8613942-C-AA **
8052095-C-G 8184054-C-G **
10757200-A-T **
10777951-C-G **
13446506-G-T 11290830-G-T **
10940984-T-C **
13372277-C-A 11216601-C-A **
13228148-C-A 11072472-C-A **
10992245-C-G **
10990021-C-A **
10976951-T-A **
10969315-A-T **
10952552-C-A **
10940925-C-A **
10822207-ATTCTG-A **
10937430-C-T **
10937423-TGCACT-G **
10933640-C-A **
10931836-C-A **
10925522-T-C **
10916134-T-G **
10888334-T-A **
10888275-T-A **
14627083-G-A 12515151-G-A CTS3041 ****
18869183-T-A 16757303-T-A **
16015594-A-G 13903714-A-G **
21408457-A-G 19246571-A-G **
22084888-C-A 19923002-C-A **
21700401-C-T 19538515-C-T **
21700395-G-T 19538509-G-T **
21700385-G-T 19538499-G-T **
21700381-C-T 19538495-C-T **
21700375-A-G 19538489-A-G **
21700371-A-G 19538485-A-G **
21386898-C-A 19225012-C-A **
22435709-C-G 20273823-C-G DYZ19 **
21382058-T-G 19220172-T-G **
21307152-G-A 19145266-G-A **
21235178-T-A 19073292-T-A **
21152534-C-A 18990648-C-A **
21135077-C-A 18973191-C-A **
21109506-G-T 18947620-G-T **
20839588-G-A 18677702-G-A P4_Gap **
22176205-G-A 20014319-G-A **
22529708-T-A 20367822-T-A **
20693735-G-A 18531849-G-A P4_Prx **
28532099-G-A 26385952-G-A **
56837774-G-T **
56828529-C-T **
28774498-G-T 26628351-G-T **
28742510-T-C 26596363-T-C **
28720912-T-A 26574765-T-A **
28636048-C-A 26489901-C-A **
28635031-C-A 26488884-C-A **
28511047-C-A 26364900-C-A **
22639242-C-A 20477356-C-A **
26154495-C-G 24008348-C-G P1_Y1 **
25985431-T-TC 23839284-T-TC P1_Y1 **
24553609-G-C 22407462-G-C P3_t2 **
23807141-G-A 21645255-G-A **
23294188-C-A 21132302-C-A **
22857787-C-A 20695901-C-A **
22715025-C-A 20553139-C-A **
22644865-T-A 20482979-T-A **
20802780-C-A 18640894-C-A P4_Gap **
20693734-T-C 18531848-T-C P4_Prx **
16071762-C-A 13959882-C-A **
17390052-A-G 15278172-A-G **
17994947-G-T 15883067-G-T P7_Prx **
17928036-C-A 15816156-C-A **
17859986-T-A 15748106-T-A **
17854371-C-A 15742491-C-A **
17775182-G-T 15663302-G-T **
17723450-C-A 15611570-C-A **
17717086-C-A 15605206-C-A **
17337682-A-T 15225802-A-T **
18183897-A-C 16072017-A-C **
17103776-C-A 14991896-C-A **
16945081-T-A 14833201-T-A **
16848069-C-A 14736189-C-A **
16540914-C-A 14429034-C-A **
16516393-C-A 14404513-C-A **
16506699-G-A 14394819-G-A **
16320099-G-T 14208219-G-T **
16232315-TG-T 14120435-TG-T **
18059595-G-A 15947715-G-A **
18222486-C-T 16110606-C-T **
20693721-G-T 18531835-G-T P4_Prx **
19213540-C-A 17101660-C-A **
20620919-A-T 18459033-A-T P4_Prx **
20387292-CT-C 18225406-CT-C P5_Dst **
20350303-TAA-T 18188417-TAA-T P5_Dst **
19517853-C-T 17405973-C-T **
19448315-C-T 17336435-C-T **
19415411-C-A 17303531-C-A **
19235676-C-A 17123796-C-A **
7170048-A-T 7302007-A-T **
18256283-G-T 16144403-G-T **
18869131-T-C 16757251-T-C **
18753414-A-G 16641534-A-G **
18752953-A-G 16641073-A-G **
18749531-C-A 16637651-C-A **
18566134-G-A 16454254-G-A **
18533975-A-C 16422095-A-C P6_Dst **
18454883-T-C 16343003-T-C P6_Dst **
18439255-G-GTTC 16327375-G-GTTC P6_Dst 25×T**
7294834-A-G 7426793-A-G **
5002851-T-C 5134810-T-C **
6934698-C-T 7066657-C-T **
21700362-A-G 19538476-A-G **
28514522-C-A 26368375-C-A **
10757354-C-A **
28511069-C-A 26364922-C-A **
20424867-G-T 18262981-G-T P5_Dst **
16277821-C-A 14165941-C-A **
11006856-C-A **
9030362-AGGGAGGGGAG-A 9192753-AGGGAGGGGAG-A 5×GGGAG**
13576115-C-A 11420439-C-A **
16668041-C-A 14556161-C-A **
3252493-C-A 3384452-C-A **
4114758-C-A 4246717-C-A **
14806014-C-A 12694085-C-A **
18996602-C-A 16884722-C-A **
28517217-C-A 26371070-C-A **
10937440-C-T **
22078259-C-A 19916373-C-A **
23401368-C-A 21239482-C-A **
16071850-C-A 13959970-C-A **
7886496-GA-G 8018455-GA-G **
13940892-A-G 11820186-A-G **
17313631-C-A 15201751-C-A **
8481058-A-AAT 8613017-A-AAT **
16707599-G-T 14595719-G-T Y97082 **
11019073-C-A **
14784794-C-A 12672864-C-A **
24885559-C-A 22739412-C-A g1 **
22240964-A-G 20079078-A-G DYZ19 **
10937414-C-A **
6917556-A-C 7049515-A-C **
10937379-C-T **
28707434-C-A 26561287-C-A **
16058018-C-A 13946138-C-A **
10926698-C-CACTCCAATCA **
23035864-C-A 20873978-C-A **
20438784-TA-T 18276898-TA-T P5_Dst **
13317198-C-A 11161522-C-A **
24385153-G-T 22239006-G-T **
14727319-ATTTT-A 12615387-ATTTT-A 23×T**
6910435-CTTTTT-C 7042394-CTTTTT-C 16×T**
13585185-C-A 11429509-C-A **
7311757-C-A 7443716-C-A **
3346930-C-A 3478889-C-A **
20438781-T-G 18276895-T-G P5_Dst **
13881251-C-A 11760545-C-A **
7225497-C-A 7357456-C-A **
28485979-A-G 26339832-A-G **
3877248-C-A 4009207-C-A **
13445668-G-GA 11289992-G-GA 9×A**
28581838-C-T 26435691-C-T ****
19517749-C-A 17405869-C-A PR6486 ****
15483800-T-A 13371920-T-A BY101884 **
23045470-TCA-T 20883584-TCA-T **
10794194-C-T **
20279584-TA-T 18117698-TA-T P5_Dst **
13484736-C-A 11329060-C-A **
16602623-C-A 14490743-C-A **
10992271-C-T **
10992282-A-T **
14512007-C-A 12400212-C-A **
14021447-C-A 11900741-C-A **
17074693-G-C 14962813-G-C **
10912554-C-A **
10794195-A-G **
11672645-C-A **
5425909-AT-A 5557868-AT-A 10×T**
15728745-C-A 13616865-C-A **
5267070-C-A 5399029-C-A **
6240991-G-A 6372950-G-A IR3_Dst 12×A**
10765555-C-T **
23065702-C-A 20903816-C-A **
17779610-G-A 15667730-G-A **
10937390-C-CCATCT **
4357016-C-A 4488975-C-A **
16424505-G-T 14312625-G-T **
4900115-T-C 5032074-T-C **
4687850-G-GA 4819809-G-GA **
4553667-C-A 4685626-C-A **
4438643-C-A 4570602-C-A **
4356802-C-A 4488761-C-A **
4356743-C-A 4488702-C-A **
3877447-T-C 4009406-T-C **
5022017-A-G 5153976-A-G **
3804643-A-G 3936602-A-G **
3704627-C-A 3836586-C-A **
3620650-C-A 3752609-C-A **
3396462-G-T 3528421-G-T **
3272943-A-G 3404902-A-G **
3011633-C-T 3143592-C-T **
2985909-C-A 3117868-C-A **
5002784-T-TG 5134743-T-TG **
5309618-A-AT 5441577-A-AT **
10892382-C-A **
5924493-C-A 6056452-C-A **
6917507-A-G 7049466-A-G **
6757099-T-C 6889058-T-C **
6619549-C-A 6751508-C-A **
6505023-C-A 6636982-C-A **
6461696-C-A 6593655-C-A **
6008120-G-T 6140079-G-T **
5999427-C-A 6131386-C-A **
5891210-G-T 6023169-G-T **
5420492-C-G 5552451-C-G **
5754196-G-T 5886155-G-T **
5708376-G-A 5840335-G-A **
5626105-T-C 5758064-T-C **
5562367-G-A 5694326-G-A **
5454786-T-C 5586745-T-C **
5443297-A-G 5575256-A-G **
5426067-C-A 5558026-C-A **
2719011-A-G 2850970-A-G **
4134088-G-T 4266047-G-T **
3176022-CAA-C 3307981-CAA-C 14×A**
17217309-CTCT-C 15105429-CTCT-C 5×TCT**
3837046-C-A 3969005-C-A **
16295652-C-A 14183772-C-A **
10677065-C-A **
5000706-C-A 5132665-C-A **
10953471-A-C **
10946819-C-A **
13278572-C-A 11122896-C-A **
19857578-A-AT 17745698-A-AT P5_Prx **
2719033-C-T 2850992-C-T **
28761479-C-A 26615332-C-A **
10924490-C-A **
15034778-C-A 12922866-C-A **
20693730-C-A 18531844-C-A P4_Prx **
9140199-C-A 9302590-C-A **
13859060-G-A 11738354-G-A **
20693715-C-T 18531829-C-T P4_Prx **
10031295-C-A 10193686-C-A **
28660922-C-A 26514775-C-A **
22662188-C-A 20500302-C-A **
56830078-C-A **
14196313-C-A 12075607-C-A **
23875959-C-A 21714073-C-A ***
6693605-C-A 6825564-C-A ***
8049669-C-A 8181628-C-A ***
25323507-T-G 23177360-T-G P2_r1 ***
25250310-G-T 23104163-G-T P2_r1 ***
24973099-T-C 22826952-T-C g1 ***
24957051-T-C 22810904-T-C g1 ***
24080936-A-G 21934789-A-G P3_b1 ***
22437639-A-C 20275753-A-C DYZ19 ***
22436146-C-T 20274260-C-T DYZ19 ***
23436866-C-A 21274980-C-A ***
22353266-A-T 20191380-A-T DYZ19 ***
22229151-C-T 20067265-C-T DYZ19 ***
22220604-A-G 20058718-A-G DYZ19 ***
7176083-C-A 7308042-C-A ***
7454609-C-T 7586568-C-T IR1_L ***
56828612-T-C ***
56828742-T-G ***
16654899-C-A 14543019-C-A ***
8184729-G-GTA 8316688-G-GTA ***
22334548-T-G 20172662-T-G DYZ19 ***
56828709-C-T ***
6149871-TACACAC-T,TAC 6281830-TACACAC-T,TAC IR3_Dst 17×AC***
9666679-G-T 9829070-G-T IR3_Prx ***
10093999-C-A 10256390-C-A ***
20420954-G-T 18259068-G-T P5_Dst ***
13804947-G-A 11684241-G-A ***
16749738-TTT-T,TTG 14637858-TTT-T,TTG ***
28762846-C-A 26616699-C-A ***
28597143-C-A 26450996-C-A ***
11672625-C-T ***
21238047-C-A 19076161-C-A ***
19382915-C-A 17271035-C-A ***
24278270-G-GAA,GAAAG 22132123-G-GAA,GAAAG P3_b1 ***
21409314-C-A 19247428-C-A ***
18283769-G-A 16171889-G-A P6_Prx ***
15175566-TA-T 13063652-TA-T ***
13453663-CATTCCATTCCATTCCATTCT-C,CATTCCATTCCATTCCATTCC 11297987-CATTCCATTCCATTCCATTCT-C,CATTCCATTCCATTCCATTCC ***
56828723-C-T ***
15176296-C-A 13064382-C-A ***
23802389-CAAAA-C 21640503-CAAAA-C 15×A***
22210680-C-A 20048794-C-A ***
56828710-A-T ***
15497295-T-C 13385415-T-C ***
15439173-C-A 13327293-C-A ***
17770653-C-A 15658773-C-A ***
4557425-C-A 4689384-C-A ***
14414-C-A ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: U24641078750078587727961113
Kit: U2464982359780103517924263
Used in age calculations1078750080103517961113
Counts of SNPs3331
Variant counts last updated 2018-07-08 21:04:24.



Big Tree Main Page