Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > Z39589 > DF49/S474 > Z2980 > Z2976 > DF23 > Z2961 > M222 > DF106 > DF104 > DF105 > A223 > BY3339 > A225 > A224

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
12701
BigY2
12701
26202050-G-GA 24055903-G-GA P1_Y1 9×AA*
6347750-G-GA 6479709-G-GA A*
56826992-C-A A*
22440077-G-A 20278191-G-A DYZ19 A*
19957278-C-CT 17845398-C-CT P5_Prx 9×TA*
13698541-T-A 11542865-T-A A*
25980633-C-CA 23834486-C-CA P1_Y1 10×AA*
19866507-T-C 17754627-T-C P5_Prx ***A*
25918856-C-CT 23772709-C-CT P1_Y1 10×TA*
25858396-G-GA 23712249-G-GA P1_Y1 22×AA*
6347750-G-A 6479709-G-A A*
14005951-TAATA-T 11885245-TAATA-T 10×AATA+**
14360002-G-A 12239297-G-A Y40479 YY++
16260512-CA-C 14148632-CA-C ++
17058441-C-A 14946561-C-A Y41825 Y**+
7738518-C-T 7870477-C-T BY18135 YY++
4243398-A-G 4375357-A-G ++
23147369-G-A 20985483-G-A YY++
22612395-T-C 20450509-T-C BY18189 YY++
18743601-C-T 16631721-C-T YY*
13448384-T-A 11292708-T-A *
13448359-CT-C,CA 11292683-CT-C,CA *
13448390-A-C 11292714-A-C *
13448342-CTAAACT-C 11292666-CTAAACT-C *
10879684-C-T **
10879706-T-C **
10880678-C-A **
10902856-C-A **
10983520-G-T **
10976053-C-A **
10924779-C-A **
10944245-C-A **
10976043-A-G **
10976033-T-G **
10924786-G-T **
10942624-T-C **
10942629-TTTCAC-T **
10865018-G-T **
10870806-C-A **
24124-T-A **
10859138-T-C **
10745205-C-A **
9936707-A-T 10099098-A-T **
9943495-G-T 10105886-G-T **
9966097-C-A 10128488-C-A **
10004861-G-A 10167252-G-A **
10646855-C-A **
10662271-C-A **
10666747-GCCATT-G **
10671656-C-A **
10677263-T-C **
10687985-A-T **
10691006-T-A **
10755534-C-T **
10844133-A-C **
10755542-A-C **
10760666-G-T **
10761764-T-C **
10769003-C-A **
10793204-G-T **
10793933-T-C **
10796600-C-T **
10984947-A-T **
10814814-C-T **
10834540-GCATTC-G **
10836559-C-A **
10843012-C-T **
10801612-T-C **
10991165-T-C **
10987368-A-C **
13928781-C-A 11808075-C-A **
11668448-C-G **
11668449-G-C **
11669874-C-A **
13799098-ATGAACGGGAG-A 11678392-ATGAACGGGAG-A **
13828227-G-C 11707521-G-C **
13828342-C-A 11707636-C-A **
13846967-A-T 11726261-A-T **
13859224-G-A 11738518-G-A **
13866220-T-A 11745514-T-A **
13887262-C-A 11766556-C-A **
13958796-C-A 11838090-C-A **
11646483-C-G **
14098786-T-C 11978080-T-C **
14125773-C-A 12005067-C-A **
14198537-C-A 12077831-C-A **
14239461-A-G 12118755-A-G **
14263239-C-A 12142533-C-A **
14269913-C-A 12149207-C-A **
14284599-A-G 12163893-A-G **
14344881-C-A 12224176-C-A **
14381861-T-C 12261157-T-C **
14425406-C-A 12304681-C-A **
14443000-A-G 12322273-A-G **
11668446-G-A **
11646458-G-T **
10987966-C-T **
13218420-C-A 11062744-C-A **
10987974-C-T **
10987983-C-T **
10987996-T-C **
9421213-C-A 9583604-C-A **
11007319-A-T **
11016494-C-T **
11018116-C-G **
11022069-C-G **
11022132-A-G **
13198877-C-A 11043201-C-A **
13290946-A-C 11135270-A-C **
13644005-C-A 11488329-C-A **
13311997-C-A 11156321-C-A **
13465935-G-A 11310259-G-A **
13465951-T-A 11310275-T-A **
13485469-T-C 11329793-T-C **
13487823-C-T 11332147-C-T **
13507058-G-T 11351382-G-T **
13507071-A-G 11351395-A-G **
13510623-C-A 11354947-C-A **
13526461-C-A 11370785-C-A **
13564551-C-T 11408875-C-T **
13564554-G-T 11408878-G-T **
9824053-A-T 9986444-A-T **
7994264-G-T 8126223-G-T **
8760596-A-T 8892555-A-T **
5846365-C-A 5978324-C-A **
5021800-T-A 5153759-T-A **
5108079-C-T 5240038-C-T **
5209787-CAGG-C 5341746-CAGG-C **
5296110-G-T 5428069-G-T **
5336336-G-T 5468295-G-T **
5458720-C-A 5590679-C-A **
5620888-AT-A 5752847-AT-A **
5652823-G-T 5784782-G-T **
5675398-C-A 5807357-C-A **
5709942-C-A 5841901-C-A **
5846326-G-A 5978285-G-A **
5870053-C-A 6002012-C-A **
5005742-T-C 5137701-T-C **
5872030-T-C 6003989-T-C **
5872034-A-G 6003993-A-G **
5913325-C-A 6045284-C-A **
5969184-C-A 6101143-C-A **
6079910-G-C 6211869-G-C **
6096930-A-T 6228889-A-T **
6129022-C-A 6260981-C-A **
6359095-C-CAA 6491054-C-CAA 30×A**
6449893-T-C 6581852-T-C **
6458430-C-A 6590389-C-A **
6463393-G-T 6595352-G-T **
5019655-C-A 5151614-C-A **
4976937-G-T 5108896-G-T **
6478473-C-A 6610432-C-A **
3822785-C-A 3954744-C-A **
2928389-A-G 3060348-A-G **
2974362-C-A 3106321-C-A **
3024663-C-A 3156622-C-A **
3246444-G-T 3378403-G-T **
3254368-C-A 3386327-C-A **
3284626-G-T 3416585-G-T **
3333966-T-A 3465925-T-A **
3366661-C-A 3498620-C-A **
3626898-T-C 3758857-T-C **
3635225-C-A 3767184-C-A **
3786282-G-T 3918241-G-T **
3822878-C-A 3954837-C-A **
4900770-G-T 5032729-G-T **
3952802-T-C 4084761-T-C **
3953133-G-T 4085092-G-T **
3961936-CA-C 4093895-CA-C **
3963964-CCA-C 4095923-CCA-C **
4062733-T-A 4194692-T-A **
4228037-C-A 4359996-C-A **
4229256-G-T 4361215-G-T **
4388078-TAATGTACATTCCCACC-T 4520037-TAATGTACATTCCCACC-T **
4497806-C-A 4629765-C-A **
4505292-C-A 4637251-C-A **
4580623-T-C 4712582-T-C **
4769558-G-C 4901517-G-C **
6465384-C-A 6597343-C-A **
6593630-C-A 6725589-C-A **
8704314-C-A 8836273-C-A **
7432488-C-A 7564447-C-A **
7204311-C-A 7336270-C-A **
7216660-T-C 7348619-T-C **
7221358-G-T 7353317-G-T **
7252220-A-G 7384179-A-G **
7258583-C-A 7390542-C-A **
7337378-T-C 7469337-T-C **
7338733-C-A 7470692-C-A **
7358234-C-A 7490193-C-A **
7400191-C-A 7532150-C-A **
7409835-C-A 7541794-C-A **
7426752-C-A 7558711-C-A **
7442003-T-A 7573962-T-A **
7188196-C-A 7320155-C-A **
7641992-C-A 7773951-C-A **
7659732-C-T 7791691-C-T **
7759340-C-A 7891299-C-A **
7885377-A-G 8017336-A-G **
7941748-C-T 8073707-C-T **
7947046-A-T 8079005-A-T **
7994252-C-T 8126211-C-T **
7994259-A-T 8126218-A-T **
14472375-C-A 12351644-C-A **
8080642-C-A 8212601-C-A **
8169458-A-T 8301417-A-T **
8661697-C-A 8793656-C-A **
7197229-C-T 7329188-C-T **
7184335-T-C 7316294-T-C **
6626861-C-A 6758820-C-A **
6998003-TC-T 7129962-TC-T **
6721486-A-G 6853445-A-G **
6755782-A-C 6887741-A-C **
6765670-G-T 6897629-G-T **
6771765-C-A 6903724-C-A **
6787415-G-C 6919374-G-C **
6806818-C-A 6938777-C-A **
6930873-C-A 7062832-C-A **
6931227-T-A 7063186-T-A **
6935386-C-A 7067345-C-A **
6955033-A-G 7086992-A-G **
6956529-G-A 7088488-G-A **
7062355-C-A 7194314-C-A **
7171929-C-A 7303888-C-A **
7075888-A-C 7207847-A-C **
7092397-C-T 7224356-C-T **
7092398-A-G 7224357-A-G **
7092403-C-A 7224362-C-A **
7092405-C-T 7224364-C-T **
7092421-G-C 7224380-G-C **
7092422-C-T 7224381-C-T Y18106 **
7092429-A-C 7224388-A-C **
7093728-C-A 7225687-C-A **
7109594-C-A 7241553-C-A **
7135544-C-A 7267503-C-A **
7164098-T-C 7296057-T-C **
14467335-G-A 12346604-G-A **
14569388-G-T 12457588-G-T **
14500223-C-A 12388428-C-A **
21890927-A-G 19729041-A-G **
21394228-G-C 19232342-G-C **
21411709-C-A 19249823-C-A **
21495975-A-T 19334089-A-T **
21501016-G-T 19339130-G-T **
21511594-T-A 19349708-T-A **
21513769-C-A 19351883-C-A **
21528397-C-A 19366511-C-A **
21543759-G-T 19381873-G-T **
21563055-C-A 19401169-C-A **
21600633-A-G 19438747-A-G **
21658431-G-GA 19496545-G-GA **
21890944-AC-A 19729058-AC-A **
21315350-GT-G 19153464-GT-G **
21890955-T-C 19729069-T-C **
21890959-C-T 19729073-C-T **
21890968-G-A 19729082-G-A **
21890969-G-C 19729083-G-C **
21890971-C-T 19729085-C-T A6069 **
21941311-C-A 19779425-C-A **
21947124-T-C 19785238-T-C **
22049663-T-C 19887777-T-C **
22137158-A-G 19975272-A-G **
22194136-G-T 20032250-G-T **
22210708-C-A 20048822-C-A **
21346302-A-C 19184416-A-C **
21299239-T-C 19137353-T-C **
22301593-T-A 20139707-T-A DYZ19 **
19759349-G-C 17647469-G-C P5_Prx **
19259060-A-C 17147180-A-C **
19259063-A-C 17147183-A-C **
19266683-G-T 17154803-G-T **
19331555-C-A 17219675-C-A **
19331559-A-G 17219679-A-G **
19394118-G-C 17282238-G-C **
19476635-C-T 17364755-C-T **
19597189-TTTATTATTATTATTTATTA-T 17485309-TTTATTATTATTATTTATTA-T P5_Prx **
19622056-C-G 17510176-C-G P5_Prx **
19622139-C-T 17510259-C-T P5_Prx **
19671599-A-G 17559719-A-G P5_Prx **
19759349-G-GTCTT 17647469-G-GTCTT P5_Prx **
21249134-G-T 19087248-G-T **
19809876-C-G 17697996-C-G P5_Prx **
19839617-A-AG 17727737-A-AG P5_Prx **
20404584-A-G 18242698-A-G P5_Dst **
20458849-G-T 18296963-G-T P5_Dst **
20493540-A-AAC 18331654-A-AAC P5_Dst **
20983058-A-AG 18821172-A-AG P4_Dst **
21043112-G-A 18881226-G-A **
21048291-C-A 18886405-C-A **
21146425-A-ATT 18984539-A-ATT 16×T**
21153699-C-A 18991813-C-A **
21200710-C-A 19038824-C-A **
21230053-C-A 19068167-C-A **
22264288-G-C 20102402-G-C DYZ19 **
22330210-T-G 20168324-T-G DYZ19 **
19123270-C-A 17011390-C-A **
28608471-C-A 26462324-C-A **
26152303-G-T 24006156-G-T P1_Y1 **
27289382-C-T 25143235-C-T P1_g3 **
27535089-G-T 25388942-G-T P1_Y2 **
27801226-A-AG 25655079-A-AG P1_Y2 **
27801298-CAATG-C 25655151-CAATG-C P1_Y2 **
27801658-T-TC 25655511-T-TC P1_Y2 **
28474952-T-G 26328805-T-G **
28514740-TG-T 26368593-TG-T **
28547478-C-A 26401331-C-A **
28555231-G-T 26409084-G-T **
28608331-C-A 26462184-C-A **
28635634-A-T 26489487-A-T **
24634137-G-T 22487990-G-T P3_t2 **
28723539-A-G 26577392-A-G **
28743035-C-A 26596888-C-A **
28767913-C-A 26621766-C-A **
28782814-C-A 26636667-C-A **
56836546-CCACCT-C **
56850941-G-A **
56862895-G-A **
56873931-C-A **
56877684-T-A **
56877760-G-T **
16577-T-A **
24123-T-A **
24890231-T-C 22744084-T-C g1 **
24466240-C-A 22320093-C-A **
22330218-A-T 20168332-A-T DYZ19 **
22962049-G-A 20800163-G-A **
22518353-C-A 20356467-C-A **
22592974-C-A 20431088-C-A **
22658130-C-A 20496244-C-A **
22720497-C-A 20558611-C-A **
22804103-A-T 20642217-A-T **
22845848-C-A 20683962-C-A **
22851562-C-A 20689676-C-A **
22860449-C-A 20698563-C-A **
22962020-T-G 20800134-T-G **
22962026-T-G 20800140-T-G **
22962043-A-T 20800157-A-T **
22962050-C-T 20800164-C-T **
24373215-C-A 22227068-C-A **
22962056-C-T 20800170-C-T **
22996814-C-A 20834928-C-A **
23058439-G-A 20896553-G-A **
23098173-A-G 20936287-A-G **
23127005-T-C 20965119-T-C **
23131145-C-A 20969259-C-A **
23184247-C-A 21022361-C-A **
23279513-AGACAAGGTTTCATAATGTT-A 21117627-AGACAAGGTTTCATAATGTT-A **
23316172-C-A 21154286-C-A **
23345859-TC-T 21183973-TC-T **
23435997-AT-A 21274111-AT-A **
23633371-C-CTT 21471485-C-CTT 21×T**
19183973-T-C 17072093-T-C **
19044589-G-T 16932709-G-T **
14517295-G-T 12405496-G-T **
16067208-C-A 13955328-C-A **
15630984-G-T 13519104-G-T **
15655695-C-T 13543815-C-T **
15700527-TA-T 13588647-TA-T **
15724249-G-T 13612369-G-T **
15816349-C-A 13704469-C-A **
15932443-C-A 13820563-C-A **
15974437-C-A 13862557-C-A **
15988123-T-C 13876243-T-C **
16032435-C-A 13920555-C-A **
16039201-C-A 13927321-C-A **
16044496-T-C 13932616-T-C **
16171502-C-A 14059622-C-A **
15556792-C-T 13444912-C-T **
16181437-C-T 14069557-C-T **
16214083-AT-A 14102203-AT-A **
16269531-G-A 14157651-G-A **
16293057-C-A 14181177-C-A **
16312365-C-T 14200485-C-T **
16336855-C-A 14224975-C-A **
16454292-T-C 14342412-T-C **
16457226-C-A 14345346-C-A **
16491958-C-A 14380078-C-A **
16492512-G-T 14380632-G-T **
16524862-C-A 14412982-C-A **
16588300-T-C 14476420-T-C **
15558999-C-A 13447119-C-A **
15533440-C-A 13421560-C-A **
16588308-T-A 14476428-T-A **
14943559-C-A 12831633-C-A **
14523971-T-C 12412172-T-C **
14557804-C-A 12446005-C-A **
2803875-CG-C 2935834-CG-C **
14589854-A-C 12478054-A-C **
14592141-A-G 12480341-A-G **
14627033-C-A 12515101-C-A **
14778853-C-A 12666923-C-A **
14806014-C-A 12694085-C-A **
14852953-C-A 12741019-C-A **
14887883-C-A 12775949-C-A **
14934421-TC-T 12822486-TC-T **
14992860-C-G 12880945-C-G **
15396810-C-A 13284930-C-A **
15092422-C-A 12980511-C-A **
15092602-A-G 12980691-A-G **
15178240-CA-C 13066326-CA-C **
15188721-A-T 13076807-A-T **
15198650-G-A 13086736-G-A **
15248151-T-C 13136237-T-C **
15262456-C-A 13150540-C-A **
15280263-T-C 13168362-T-C **
15287872-C-A 13175971-C-A **
15305718-C-A 13193817-C-A **
15324023-GTTTA-G 13212141-GTTTA-G **
15335905-A-G 13224023-A-G **
16588307-T-C 14476427-T-C **
16603256-T-C 14491376-T-C **
19022309-C-G 16910429-C-G **
18650481-C-A 16538601-C-A **
18096500-T-C 15984620-T-C **
18098958-A-G 15987078-A-G **
18151774-C-A 16039894-C-A **
18172940-C-A 16061060-C-A **
18191293-C-A 16079413-C-A **
18288586-C-A 16176706-C-A P6_Prx **
18305290-C-T 16193410-C-T P6_Prx **
18378984-T-G 16267104-T-G P6_Prx **
18386537-C-A 16274657-C-A P6_Gap **
18403307-A-T 16291427-A-T P6_Gap **
18603446-C-A 16491566-C-A **
18670216-C-T 16558336-C-T **
17889919-G-C 15778039-G-C **
18708093-A-G 16596213-A-G **
18712827-C-T 16600947-C-T **
18712839-T-C 16600959-T-C **
18716581-G-T 16604701-G-T **
18767157-C-A 16655277-C-A **
18796335-G-T 16684455-G-T **
18895681-C-A 16783801-C-A **
18924920-C-A 16813040-C-A **
18943877-T-G 16831997-T-G **
18946882-C-A 16835002-C-A **
18976698-A-G 16864818-A-G **
18994465-C-T 16882585-C-T **
18003911-A-T 15892031-A-T P7_Gap **
17889915-C-T 15778035-C-T **
16679404-A-G 14567524-A-G 18×T**
17193165-T-C 15081285-T-C **
16681415-C-G 14569535-C-G **
16705535-T-C 14593655-T-C **
16765514-C-A 14653634-C-A **
16789718-C-A 14677838-C-A **
16885809-G-T 14773929-G-T **
16931923-C-A 14820043-C-A **
16932819-C-A 14820939-C-A **
17061555-C-A 14949675-C-A **
17065845-A-G 14953965-A-G **
17098317-A-G 14986437-A-G **
17159009-C-A 15047129-C-A **
17287433-T-G 15175553-T-G **
17885813-C-A 15773933-C-A **
17342783-C-T 15230903-C-T **
17486396-C-G 15374516-C-G **
17503961-A-G 15392081-A-G **
17524284-C-A 15412404-C-A **
17562076-A-T 15450196-A-T **
17631734-A-C 15519854-A-C **
17691923-C-A 15580043-C-A **
17693594-C-A 15581714-C-A **
17731001-G-A 15619121-G-A **
17731014-CA-C 15619134-CA-C 35×A**
17770139-A-T 15658259-A-T **
17782895-G-T 15671015-G-T **
2833359-AT-A 2965318-AT-A 9×T**
5415675-G-T 5547634-G-T **
2789316-C-T 2921275-C-T **
21515861-TCAA-T 19353975-TCAA-T **
20084532-A-G 17972652-A-G P5_Dst **
17802162-TCAG-T 15690282-TCAG-T **
10947333-C-T **
7241985-C-A 7373944-C-A **
14931757-C-A 12819822-C-A **
23262603-G-C 21100717-G-C **
21682196-T-C 19520310-T-C **
12754206-CGTGT-C **
2811415-C-A 2943374-C-A **
9983401-C-A 10145792-C-A **
7160894-C-CTT 7292853-C-CTT 16×T**
22264262-A-G 20102376-A-G DYZ19 **
10004868-C-T 10167259-C-T 8×GT**
7335572-A-G 7467531-A-G **
21556919-CTT-C 19395033-CTT-C 23×T**
13858120-C-T 11737414-C-T **
19394097-G-T 17282217-G-T **
10980769-CATTAA-C **
27838008-G-T 25691861-G-T P1_Y2 **
10804386-T-TTGAAC **
19183843-G-GT 17071963-G-GT **
21000914-TA-T 18839028-TA-T P4_Dst **
9040925-A-ATATAT 9203316-A-ATATAT 17×AT**
10762958-T-A **
10804396-A-T **
10804395-A-C **
10804390-T-A **
10804383-T-C **
14297038-CTATA-C 12176332-CTATA-C 10×TA**
10804380-T-G **
2845800-T-G 2977759-T-G **
15733770-C-A 13621890-C-A **
28755705-C-A 26609558-C-A **
10880355-T-C **
8325689-T-C 8457648-T-C **
19271586-T-G 17159706-T-G **
17731006-T-A 15619126-T-A **
13858135-A-C 11737429-A-C **
25967686-T-TA 23821539-T-TA P1_Y1 **
13143949-G-C 10633435-G-C **
13856835-A-T 11736129-A-T **
58912907-G-T 56677964-C-A **
14624294-C-A 12512494-T-A **
2803921-T-G 2935880-T-G **
5957089-T-TATAC 6089048-T-TATAC 12×AC****
28581303-G-A 26435156-G-A CTS12358 **
28581291-G-T 26435144-G-T CTS12357 **
22273542-CA-T 20111656-CA-T DYZ19 **
20717027-G-A 18555141-G-A P4_Prx **
20717021-C-A 18555135-C-A P4_Prx **
2773151-C-A 2905110-C-A **
18763630-A-C 16651750-A-C **
17926417-G-A 15814537-G-A **
13686958-GAATGC-G 11531282-GAATGC-G **
13859333-TCCAAA-T 11738627-TCCAAA-T **
13855391-A-G 11734685-A-G **
13143889-T-C 10633375-T-C **
20025441-CT-C 17913561-CT-C P5_Prx **
58997092-C-A 56850945-C-A **
22962041-G-A 20800155-G-A **
2699548-G-A 2831507-G-A **
22264301-T-C 20102415-T-C DYZ19 **
22330219-A-G 20168333-A-G DYZ19 **
22301579-G-T 20139693-G-T DYZ19 **
22330234-A-C 20168348-A-C YFS033218 DYZ19 **
21890940-A-T 19729054-A-T **
21890932-C-T 19729046-C-T **
14447478-C-A 12326751-C-A **
2835623-TG-T 2967582-TG-T **
22301581-G-T 20139695-G-T DYZ19 **
4697475-T-TA 4829434-T-TA 14×A**
23026676-C-T 20864790-C-T Y26747 **
17192946-AAT-A 15081066-AAT-A **
8712873-C-A 8844832-C-A Z19378 **
22330202-T-C 20168316-T-C YFS033217 DYZ19 **
13546989-ATT-A 11391313-ATT-A 16×T**
15259276-T-A 13147360-T-A **
17707367-A-C 15595487-A-C **
17387294-G-A 15275414-G-A 12×TA**
27987732-G-T 25841585-G-T P1_Y2 **
28805826-C-T 26659679-C-T **
20497381-T-TC 18335495-T-TC P5_Dst **
4433458-C-A 4565417-C-A **
27985044-AT-A 25838897-AT-A P1_Y2 **
13483284-A-C 11327608-A-C **
19691355-G-T 17579475-G-T P5_Prx **
19022318-C-A 16910438-C-A **
2684477-A-T 2816436-A-T **
2725610-C-A 2857569-C-A **
2740282-T-A 2872241-T-A **
22301567-G-A 20139681-G-A DYZ19 **
18712844-A-G 16600964-A-G **
11036085-C-CTGA **
11036083-T-TCC **
10762972-A-G **
11022133-T-C **
10965322-T-C **
10984943-C-A **
10879716-A-C **
5550320-G-T 5682279-G-T **
15733854-T-G 13621974-T-G **
7109321-C-A 7241280-C-A **
4905620-CA-C 5037579-CA-C 9×A**
22995450-C-A 20833564-C-A **
9382372-C-A 9544763-C-A **
19275149-GTATA-G 17163269-GTATA-G 8×TA**
13466329-G-A 11310653-G-A **
17889909-T-G 15778029-T-G **
10976049-A-T **
2876725-C-A 3008684-C-A **
6510585-C-A 6642544-C-A **
15898878-C-A 13786998-C-A **
28474965-C-A 26328818-C-A 18×A**
4470629-C-A 4602588-C-A **
2665382-C-A 2797341-C-A **
14463291-CTTTTT-C 12342564-CTTTTT-C 16×T**
6651539-C-A 6783498-C-A **
14599052-G-T 12487252-G-T **
9509685-C-A 9672076-C-A **
18997253-GTA-G 16885373-GTA-G **
10971353-G-T **
11022131-C-T **
19022321-CA-C 16910441-CA-C **
14230703-C-A 12109997-C-A **
10980783-C-T **
10937376-A-T **
10879709-A-C **
22190682-C-A 20028796-C-A **
10809002-C-CTGTTT **
10808978-C-CGTACT **
10808964-A-C **
10980777-T-C **
22520541-C-A 20358655-C-A **
10868378-G-C **
10987960-G-T **
24363633-CTTTTT-C 22217486-CTTTTT-C 16×T**
10843002-A-T **
7238932-A-T 7370891-A-T **
18672615-C-A 16560735-C-A **
10879733-T-A **
20793542-CA-C 18631656-CA-C P4_Prx **
10879726-G-C **
18943851-C-A 16831971-C-A **
10984906-T-C **
10769004-G-A **
10984905-G-A **
13488054-G-C 11332378-G-C ***
13839391-G-C 11718685-G-C ***
13139307-T-C 10628793-T-C ***
19126238-C-A 17014358-C-A ***
13459381-C-T 11303705-C-T ***
13466928-AAG-C 11311252-AAG-C ***
13474732-C-T 11319056-C-T ***
13446730-T-C 11291054-T-C ***
13839376-G-C 11718670-G-C ***
13858614-T-G 11737908-T-G ***
13488063-A-T 11332387-A-T ***
21048097-C-A 18886211-C-A ***
13488064-C-T 11332388-C-T ***
13139301-ATTCAG-A,G 10628787-ATTCAG-A,G ***
13521668-T-G 11365992-T-G ***
13648957-TGTAAA-T 11493281-TGTAAA-T ***
13138408-C-T 10627894-C-T ***
13651253-A-G 11495577-A-G ***
13839055-C-G 11718349-C-G ***
13139309-G-C 10628795-G-C ***
13457439-T-A 11301763-T-A ***
13454313-T-G 11298637-T-G ***
13446748-C-G 11291072-C-G ***
13446933-A-C 11291257-A-C ***
13447212-A-C,T 11291536-A-C,T ***
13449157-A-C 11293481-A-C ***
13451191-T-C,TCCATTCCATTCCATTC 11295515-T-C,TCCATTCCATTCCATTC ***
13452613-T-C 11296937-T-C ***
19382389-C-A 17270509-C-A ***
13452638-T-C 11296962-T-C ***
13406079-TG-T 11250403-TG-T ***
13446711-A-T 11291035-A-T ***
19322444-C-A 17210564-C-A ***
13406077-G-C 11250401-G-C ***
13406072-G-T 11250396-G-T ***
13457341-A-C 11301665-A-C ***
13143892-C-T 10633378-C-T ***
13839383-A-T 11718677-A-T ***
13839378-G-C 11718672-G-C ***
13457347-T-TATTCC 11301671-T-TATTCC 10×ATTCC***
13139608-T-C 10629094-T-C ***
13456361-T-C 11300685-T-C ***
13660565-T-G 11504889-T-G BY32878 ***
18850908-C-A 16739028-C-A ***
13829510-G-A 11708804-G-A ***
13728554-G-C 11572878-G-C ***
13728560-G-T 11572884-G-T ***
13728569-G-T 11572893-G-T ***
13835227-A-G 11714521-A-G ***
13728580-G-A 11572904-G-A ***
13728590-A-G 11572914-A-G ***
13834075-A-T 11713369-A-T ***
18035461-T-C 15923581-T-C ***
13829540-G-A 11708834-G-A ***
13829475-G-A 11708769-G-A ***
18253555-C-A 16141675-C-A ***
13740680-C-T 11585004-C-T ***
17902840-T-C 15790960-T-C ***
13817870-A-C 11697164-A-C ***
13829438-T-G 11708732-T-G ***
13820803-G-T 11700097-G-T ***
13818630-T-A 11697924-T-A ***
13820774-A-G 11700068-A-G ***
13820788-G-C 11700082-G-C ***
13820801-A-C 11700095-A-C ***
18191936-G-T 16080056-G-T ***
13728549-G-A 11572873-G-A ***
13653039-T-A 11497363-T-A ***
13838692-G-C 11717986-G-C ***
13660495-C-A 11504819-C-A ***
18723887-CT-C,CTT 16612007-CT-C,CTT 19×T***
13674233-A-G 11518557-A-G ***
13839052-C-A 11718346-C-A ***
13674359-A-T 11518683-A-T ***
13680775-G-C 11525099-G-C ***
13838702-G-A 11717996-G-A ***
17244215-G-T 15132335-G-T ***
13683145-T-A 11527469-T-A ***
13683238-T-G 11527562-T-G ***
13710702-G-T 11555026-G-T ***
13836386-A-T 11715680-A-T ***
13686932-G-A 11531256-G-A ***
17371413-C-A 15259533-C-A ***
18573457-G-T 16461577-G-T ***
13836309-G-A 11715603-G-A ***
13836307-T-A 11715601-T-A ***
18540210-C-A 16428330-C-A ***
13138113-C-T 10627599-C-T ***
13690804-A-T 11535128-A-T ***
13701313-GATATC-G 11545637-GATATC-G ***
13138391-A-ACCATT 10627877-A-ACCATT 8×CCATT***
6167025-CTGTG-C 6298984-CTGTG-C IR3_Dst 12×TG***
13138009-T-C 10627495-T-C ***
23990455-GCA-G 21844308-GCA-G 9×CA***
13823219-A-G 11702513-A-G 9×ATGGG***
13835237-A-C 11714531-A-C ***
13138440-C-T 10627926-C-T ***
13457437-C-G 11301761-C-G ***
13819063-T-G 11698357-T-G ***
13866777-G-A 11746071-G-A ***
24406873-C-A 22260726-C-A ***
28792729-T-A 26646582-T-A ***
13867293-G-A 11746587-G-A ***
23579511-C-A 21417625-C-A ***
13808088-G-A 11687382-G-A FGC24735 ***
23517708-G-T 21355822-G-T ***
28787273-T-G 26641126-T-G ***
23389579-T-G 21227693-T-G ***
23377696-C-T 21215810-C-T ***
58980612-T-C 56834465-T-C ***
5471889-A-G 5603848-A-G ***
13648906-C-A 11493230-C-A ***
23198279-C-T 21036393-C-T ***
13839413-C-A 11718707-C-A ***
13813494-A-T 11692788-A-T ***
13817757-A-G 11697051-A-G ***
13808080-T-C 11687374-T-C ***
24298894-AAC-A 22152747-AAC-A P3_t1 ***
28701469-C-A 26555322-C-A ***
28800227-G-T 26654080-G-T ***
28800226-G-A 26654079-G-A ***
28800232-G-C 26654085-G-C ***
28799496-G-C 26653349-G-C ***
58837247-T-C 56753624-A-G ***
13143912-C-T 10633398-C-T ***
13143917-T-C 10633403-T-C ***
13446958-C-T 11291282-C-T ***
13478931-G-A 11323255-G-A ***
56847422-TCC-T ***
13808079-A-T 11687373-A-T ***
28660434-A-T 26514287-A-T ***
13647838-T-G 11492162-T-G ***
13647944-TCGAAAGGAAAGATAA-T 11492268-TCGAAAGGAAAGATAA-T ***
13647963-A-G 11492287-A-G ***
13647965-G-A 11492289-G-A FGC67752 Z44952 ***
56847431-T-C ***
13647969-T-C 11492293-T-C ***
13674367-G-A 11518691-G-A ***
13808066-G-T 11687360-G-T ***
28370088-T-G 26223941-T-G P1_gr2 ***
13839375-A-G 11718669-A-G ***
13447214-C-T 11291538-C-T ***
21249111-G-T 19087225-G-T ***
9198593-CAGGA-C 9360984-CAGGA-C ***
9068731-G-T 9231122-G-T ***
9068745-C-A 9231136-C-A ***
9068746-G-A 9231137-G-A ***
21712136-C-T 19550250-C-T ***
9068758-A-C 9231149-A-C ***
9068770-A-C 9231161-A-C ***
9068773-A-C 9231164-A-C ***
21549183-GTTT-G 19387297-GTTT-G 17×T***
9068782-A-C 9231173-A-C ***
9741354-TACAC-T 9903745-TACAC-T IR3_Prx 16×AC***
7503851-AACAC-A 7635810-AACAC-A IR1_L 20×AC***
9944058-T-G 10106449-T-G ***
9971888-C-T 10134279-C-T ***
9971889-C-A 10134280-C-A ***
9971894-C-T 10134285-C-T ***
10017747-C-T 10180138-C-T ***
10019375-C-CT 10181766-C-CT ***
13867282-C-G 11746576-C-G ***
10020511-C-A 10182902-C-A 10×AAAAG***
10026389-A-G 10188780-A-G ***
13104633-AG-A 10594119-AG-A ***
9068730-A-T 9231121-A-T ***
7453565-C-T 7585524-C-T IR1_L ***
58974040-C-A 56827893-C-A ***
13809853-C-G 11689147-C-G ***
13456350-A-T 11300674-A-T ***
13867027-C-A 11746321-C-A ***
13842630-C-A,G 11721924-C-A,G ***
58893690-C-G 56697181-G-C ***
13810203-G-A 11689497-G-A ***
58976522-C-T 56830375-C-T ***
22900023-A-G 20738137-A-G ***
13140535-C-T 10630021-C-T ***
13143902-C-T 10633388-C-T ***
13143947-C-T 10633433-C-T ***
13809898-G-C 11689192-G-C ***
6402015-CG-C 6533974-CG-C ***
13839385-G-C 11718679-G-C ***
13839404-A-T 11718698-A-T ***
13853843-C-G 11733137-C-G ***
13858139-T-A 11737433-T-A ***
28801736-A-G 26655589-A-G ***
5471875-A-G 5603834-A-G ***
5472008-G-A 5603967-G-A ***
5472010-G-A 5603969-G-A ***
22067395-T-G 19905509-T-G ***
6347717-A-G 6479676-A-G ***
16930732-C-G 14818852-C-G ***
20669272-TTTG-T 18507386-TTTG-T P4_Prx 11×TTG***
16855422-C-A 14743542-C-A ***
13143897-A-C,T 10633383-A-C,T ***
58973956-C-G 56827809-C-G ***
58973996-GATTCC-CATTCC,G 56827849-GATTCC-CATTCC,G 5×ATTCC***
58974026-C-T 56827879-C-T ***
11016318-A-T ***
58974036-C-T 56827889-C-T ***
58974072-A-ATCCGATTCC 56827925-A-ATCCGATTCC ***
10989426-CA-C ***
58981804-C-G 56835657-C-G ***
13542959-AC-A 11387283-AC-A ***
58978384-C-A,G 56832237-C-A,G ***
58908819-A-C 56682052-T-G ***
13483957-G-A 11328281-G-A ***
13483970-A-T 11328294-A-T ***
13801547-T-A,C 11680841-T-A,C ***
16860740-G-T 14748860-G-T ***
13463893-G-A,T 11308217-G-A,T ***
13447204-A-C,T 11291528-A-C,T ***
9300170-ACC-A 9462561-ACC-A ***
18354240-AG-A 16242360-AG-A P6_Prx ***
23544846-CTT-C 21382960-CTT-C 15×T***
23971898-CTG-C 21825751-CTG-C 8×TG***
11024596-C-A ***
13202947-T-C 11047271-T-C ***
14992933-TCA-T 12881018-TCA-T 11×CA***
28796099-A-G 26649952-A-G ***
13575682-G-T 11420006-G-T ***
13566492-AC-A 11410816-AC-A ***
28785604-A-T 26639457-A-T ***
28785779-A-G 26639632-A-G ***
28789205-A-T 26643058-A-T ***
28790595-G-C 26644448-G-C ***
28790598-A-T 26644451-A-T ***
28790599-T-A 26644452-T-A ***
13488525-T-A 11332849-T-A ***
28796126-G-A 26649979-G-A ***
58876733-C-T 56714138-G-A ***
13478710-C-A 11323034-C-A ***
28799810-GTGGCA-G,T 26653663-GTGGCA-G,T ***
28799850-G-A 26653703-G-A ***
13463747-C-T 11308071-C-T ***
13462238-G-T 11306562-G-T ***
28800119-G-A 26653972-G-A ***
13448349-C-CG 11292673-C-CG ***
28801747-G-C 26655600-G-C ***
28805550-T-G 26659403-T-G ***
28814691-AG-A,G 26668544-AG-A,G ***
7137212-TATAC-T 7269171-TATAC-T ***
17491636-C-A 15379756-C-A ***
28784738-T-C 26638591-T-C ***
27396774-G-T 25250627-G-T P1_g3 ***
16914104-G-GCT 14802224-G-GCT 9×CT***
7363642-C-A 7495601-C-A ***
7290427-C-A 7422386-C-A ***
7290426-C-A 7422385-C-A ***
7287076-C-A 7419035-C-A ***
13483406-G-A 11327730-G-A ***
28800214-A-T 26654067-A-T ***
7125089-C-A 7257048-C-A ***
7101423-C-A 7233382-C-A ***
2861534-CAAAAA-C 2993493-CAAAAA-C 25×A***
7677488-G-T 7809447-G-T ***
6957108-C-A 7089067-C-A ***
56832905-C-T ***
10946839-C-A ***
5627849-C-A 5759808-C-A ***
5490103-G-T 5622062-G-T ***
13458653-T-C 11302977-T-C ***
56835847-CCCACTCCATTCCAATCCGTGC-C,CCACTCCATTCCAATCCGTGT ***
4075739-G-T 4207698-G-T ***
10033029-C-A 10195420-C-A ***
9125371-G-T ***
7568782-C-A 7700741-C-A ***
7683427-C-A 7815386-C-A ***
10776522-CA-C,GG ***
10671556-ACTCTC-A,ATTCCA ***
13475215-C-G,T 11319539-C-G,T ***
13140124-C-A,T 10629610-C-A,T ***
13447197-G-A,C 11291521-G-A,C ***
10688018-TC-T,TT ***
10688017-T-C ***
10687997-T-A ***
13470854-T-C,G 11315178-T-C,G ***
10685748-A-G ***
25096447-AG-A,AGGAAAGAAAGAAA 22950300-AG-A,AGGAAAGAAAGAAA g1 ***
10671567-G-A,T ***
10022020-C-T 10184411-C-T ***
7894502-C-A 8026461-C-A ***
2819960-CTTTTT-C 2951919-CTTTTT-C 17×T***
9774752-C-A 9937143-C-A ***
9512138-C-A 9674529-C-A ***
9437605-T-C 9599996-T-C ***
8760532-TTTTTTG-A,TTTG 8892491-TTTTTTG-A,TTTG ***
8434652-C-T 8566611-C-T ***
8030030-TAAA-T 8161989-TAAA-T 26×A***
2741101-CTT-C,CT 2873060-CTT-C,CT 19×T***
7933628-C-A 8065587-C-A ***
7899229-C-A 8031188-C-A ***
13624442-C-A 11468766-C-A ***
28784727-G-C 26638580-G-C ***
13839417-G-A 11718711-G-A ***
13863436-ATGCAATGGAT-A 11742730-ATGCAATGGAT-A ***
13853362-T-G 11732656-T-G ***
13853386-C-T 11732680-C-T ***
13856708-A-G 11736002-A-G 5×AATGG***
13858584-G-A 11737878-G-A ***
13859340-G-T 11738634-G-T ***
13863328-C-A 11742622-C-A ***
13863338-G-T 11742632-G-T ***
15714446-G-A 13602566-G-A ***
13863344-G-A 11742638-G-A ***
13863449-C-G 11742743-C-G ***
13851708-AT-A,ATAGATA 11731002-AT-A,ATAGATA ***
13865763-T-A 11745057-T-A ***
13865775-G-T 11745069-G-T ***
13866814-A-G 11746108-A-G ***
13867059-C-G 11746353-C-G ***
13867290-A-G 11746584-A-G ***
13867826-C-G 11747120-C-G ***
13867831-A-G 11747125-A-G ***
13868630-T-C,G 11747924-T-C,G ***
13868636-C-G 11747930-C-G ***
14062809-CAT-C 11942103-CAT-C ***
16095463-C-A 13983583-C-A ***
13851344-A-ATGGAC 11730638-A-ATGGAC ***
15248913-G-A 13136999-G-A Y93348 ***
13844649-G-A 11723943-G-A BY30155 ***
13839814-T-TGAAATGGAATGGAAA 11719108-T-TGAAATGGAATGGAAA ***
13839911-G-A 11719205-G-A ***
16688502-C-A 14576622-C-A ***
13841490-A-G 11720784-A-G ***
13844558-C-T 11723852-C-T ***
13844572-GTGGAACGGAATAGAA-G 11723866-GTGGAACGGAATAGAA-G ***
13844638-T-A 11723932-T-A ***
13844642-A-C 11723936-A-C ***
13844644-C-G 11723938-C-G ***
16583465-G-T 14471585-G-T ***
13844654-G-A 11723948-G-A ***
16194802-G-GA 14082922-G-GA 8×A***
13844663-C-T 11723957-C-T ***
13845476-G-C 11724770-G-C ***
13845494-T-C 11724788-T-C ***
16360603-C-A 14248723-C-A ***
13845541-A-AAATGGAATGGAATGG 11724835-A-AAATGGAATGGAATGG 8×AATGG***
13846548-T-A 11725842-T-A ***
13846562-T-A 11725856-T-A ***
16290516-C-A 14178636-C-A ***
13847493-T-G 11726787-T-G ***
13851265-T-G 11730559-T-G ***
15024746-T-A 12912834-T-A PR1695 ***
15811022-G-T 13699142-G-T PR5663 ***
28784705-G-A 26638558-G-A ***
24835860-TA-T 22689713-TA-T P3_b2 11×A***
22807914-T-G 20646028-T-G ******
22864065-GAC-G 20702179-GAC-G 12×AC***
14236799-A-G 12116093-A-G ***
23976876-TTG-T 21830729-TTG-T 10×TG***
24120628-C-T 21974481-C-T P3_b1 ***
24412123-T-A 22265976-T-A ***
14052006-C-A 11931300-C-A ***
14017766-C-A 11897060-C-A ***
14002484-C-A 11881778-C-A ***
25447296-AGTT-A 23301149-AGTT-A P2_r2 ***
22451546-G-C 20289660-G-C DYZ19 ***
25462345-GACAC-G 23316198-GACAC-G P2_r2 22×AC***
25689881-T-G 23543734-T-G P1_b3 ***
26392991-T-TCA 24246844-T-TCA P1_Y1 15×CA***
13855994-TA-T 11735288-TA-T ***
27082369-CAGA-C 24936222-CAGA-C P1_r4 5×AGA***
27775583-CA-C 25629436-CA-C P1_Y2 ***
27791839-T-G 25645692-T-G P1_Y2 ***
27791848-T-G 25645701-T-G P1_Y2 ***
27992022-A-AG 25845875-A-AG P1_Y2 ***
28784589-C-G 26638442-C-G ***
22506475-C-G 20344589-C-G DYZ19 ***
22436719-A-C 20274833-A-C DYZ19 ***
15811027-C-A 13699147-C-A ***
20012744-AGT-A 17900864-AGT-A P5_Prx ***
15107117-A-AT 12995204-A-AT 9×T***
16292546-A-T 14180666-A-T 48×T***
17991841-TAGTTCAAGA-T 15879961-TAGTTCAAGA-T P7_Prx ***
18338332-ATG-A 16226452-ATG-A P6_Prx ***
18353228-A-G 16241348-A-G P6_Prx ***
18353233-TAC-T 16241353-TAC-T P6_Prx ***
18639018-AGT-A,T 16527138-AGT-A,T 26×GT***
19036703-G-GTT 16924823-G-GTT 40×T***
20001451-T-C 17889571-T-C P5_Prx ***
14600810-C-A 12489010-C-A ***
20213005-TTTCTTCTTCTTC-T,TTTC 18051119-TTTCTTCTTCTTC-T,TTTC P5_Dst 26×TTC***
14363327-C-A 12242622-C-A ***
14531071-A-T 12419272-A-T ***
20927099-G-GTTTTTTTTTTT 18765213-G-GTTTTTTTTTTT P4_Dst 35×T***
22147842-T-C 19985956-T-C ***
22245729-ACT-A 20083843-ACT-A DYZ19 ***
22245737-GC-AG,G 20083851-GC-AG,G DYZ19 ***
14464165-ATTT-A,ATTTT 12343438-ATTT-A,ATTTT 18×T***
14458558-CAAAAAAAA-C 12337831-CAAAAAAAA-C 21×A***
22291024-A-G 20129138-A-G DYZ19 ***
22339733-G-T 20177847-G-T DYZ19 ***
22341581-A-G,T 20179695-A-G,T DYZ19 ***
6130293-A-T 6262252-A-T ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

ERROR: There was an error querying the server about the notes for this person.



Big Tree Main Page