Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > Z39589 > DF41/S524 > Z43690 > Y8426/FGC5572 > MC21 > FGC36628 > FGC36627

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
397394
BigY3
397394
BigY2
397394
28101053-G-C 25954906-G-C P1_Y2 A+
28818076-G-T 26671929-G-T A+
19779268-C-T 17667388-C-T P5_Prx A*
59026092-C-T 56879945-C-T A*
26332907-C-T 24186760-C-T P1_Y1 A*
23179137-C-T 21017251-C-T YA*
22440644-G-T 20278758-G-T FGC36645 DYZ19 +**+
5470561-C-T 5602520-C-T +
5445492-C-T 5577451-C-T +
16355422-G-A 14243542-G-A Y+
5364101-CA-C 5496060-CA-C +
9109859-G-A 9272250-G-A FGC36629 Y+++
16453809-T-C 14341929-T-C FGC36639 YY+++
4922397-T-C 5054356-T-C +
6756440-G-T 6888399-G-T Y+
3570681-C-A 3702640-C-A +
3319769-C-G 3451728-C-G +
3126722-C-T 3258681-C-T +
22559805-A-G 20397919-A-G FGC36646 YY+++
21012190-ATGTGTGTGTG-A 18850304-ATGTGTGTGTG-A P4_Dst 20×TG*
6400922-T-G 6532881-T-G ***
3702819-T-TACAC 3834778-T-TACAC 16×AC*
16396785-C-G 14284905-C-G **
16703426-C-A 14591546-C-A **
16627698-GTATATATATATATATATATATATATGTGTATATATA-G 14515818-GTATATATATATATATATATATATATGTGTATATATA-G 12×TA**
16705681-AT-A 14593801-AT-A **
16710209-C-A 14598329-C-A **
16719979-T-C 14608099-T-C **
16719985-A-G 14608105-A-G **
16412224-C-A 14300344-C-A **
16777992-C-A 14666112-C-A **
16816623-C-T 14704743-C-T **
16829164-C-G 14717284-C-G **
16829181-G-A 14717301-G-A **
16397210-A-C 14285330-A-C **
16933153-C-A 14821273-C-A **
16396894-T-C 14285014-T-C **
16396822-T-A 14284942-T-A **
58972515-A-G 56826368-A-G **
16352076-G-T 14240196-G-T **
16017615-G-T 13905735-G-T **
15717892-C-T 13606012-C-T **
15743862-A-T 13631982-A-T **
15769197-C-T 13657317-C-T **
15924077-T-A 13812197-T-A **
16003121-C-A 13891241-C-A **
16004168-A-G 13892288-A-G **
16004267-C-A 13892387-C-A **
16017691-G-C 13905811-G-C **
16352045-G-T 14240165-G-T **
16017715-C-A 13905835-C-A **
16029647-T-C 13917767-T-C **
16034424-C-A 13922544-C-A **
17053124-G-T 14941244-G-T **
16184058-T-C 14072178-T-C **
16221055-T-G 14109175-T-G **
16245291-G-T 14133411-G-T **
16974110-G-T 14862230-G-T **
17644206-C-A 15532326-C-A **
17255167-C-T 15143287-C-T **
18278200-G-T 16166320-G-T P6_Prx **
18155817-C-A 16043937-C-A **
18158559-C-A 16046679-C-A **
18159827-A-C 16047947-A-C **
18278150-T-A 16166270-T-A P6_Prx **
18278168-A-C 16166288-A-C P6_Prx **
18278184-T-C 16166304-T-C P6_Prx **
18280984-T-G 16169104-T-G P6_Prx **
18089248-C-A 15977368-C-A **
18299803-G-T 16187923-G-T P6_Prx **
18299861-G-GGTCT 16187981-G-GGTCT P6_Prx **
18367671-G-C 16255791-G-C P6_Prx **
18402668-A-T 16290788-A-T P6_Gap **
18578057-T-A 16466177-T-A **
18578064-A-T 16466184-A-T **
18630994-C-A 16519114-C-A **
18134288-C-A 16022408-C-A **
18060312-A-C 15948432-A-C **
17262950-C-A 15151070-C-A **
17545655-C-A 15433775-C-A **
17315411-A-C 15203531-A-C **
17315422-G-C 15203542-G-C **
17315440-G-T 15203560-G-T **
17413372-G-T 15301492-G-T **
17440628-TG-T 15328748-TG-T **
17466525-C-A 15354645-C-A **
17547753-C-A 15435873-C-A **
17990673-A-C 15878793-A-C P7_Prx **
15686649-T-C 13574769-T-C **
17876393-T-C 15764513-T-C **
17876396-G-A 15764516-G-A **
17876402-T-G 15764522-T-G **
17922516-C-A 15810636-C-A **
17926526-G-A 15814646-G-A **
17929116-A-C 15817236-A-C **
15686653-C-A 13574773-C-A **
15285872-T-C 13173971-T-C **
15686642-G-A 13574762-G-A **
11655517-C-T **
13518189-C-A 11362513-C-A **
13643877-G-T 11488201-G-T **
13643878-ATGC-A 11488202-ATGC-A **
13696879-G-A 11541203-G-A **
13721895-G-T 11566219-G-T **
13721896-A-G 11566220-A-G **
11658821-C-A **
13412470-C-A 11256794-C-A **
11668369-G-A **
13855939-G-T 11735233-G-T **
13858524-G-T 11737818-G-T **
13874053-C-A 11753347-C-A **
13884701-T-A 11763995-T-A **
13941069-C-A 11820363-C-A **
13958461-G-C 11837755-G-C **
13467953-A-G 11312277-A-G **
13329204-G-T 11173528-G-T **
14195163-C-A 12074457-C-A **
10991197-C-G **
10960241-C-A **
10964422-C-A **
10964712-C-A **
10975834-T-G **
10987368-A-T **
10991191-G-T **
10992831-C-A **
13323294-G-A 11167618-G-A **
11015716-C-A **
11026045-T-TCCCAA **
11031414-T-C **
13235702-C-A 11080026-C-A **
13248497-C-G 11092821-C-G **
13253678-C-A 11098002-C-A **
13288832-C-A 11133156-C-A **
13972190-A-G 11851484-A-G **
14198353-G-C 12077647-G-C **
15686631-G-A 13574751-G-A **
18634874-T-G 16522994-T-G **
14765014-T-C 12653083-T-C **
14986181-A-C 12874249-A-C **
15034715-T-C 12922803-T-C **
15092340-C-A 12980429-C-A **
15102237-AT-A 12990325-AT-A **
15178900-G-C 13066986-G-C **
15332245-C-A 13220363-C-A **
14727231-T-G 12615299-T-G **
15366107-C-A 13254227-C-A **
15394689-C-A 13282809-C-A **
15430354-CA-C 13318474-CA-C 8×A**
15430671-A-C 13318791-A-C **
15432773-C-A 13320893-C-A **
15575057-C-A 13463177-C-A **
15605495-T-C 13493615-T-C **
14735256-T-G 12623324-T-G **
14689359-A-G 12577425-A-G **
14200566-G-T 12079860-G-T **
14358218-T-G 12237513-T-G **
14205015-C-A 12084309-C-A **
14213190-G-T 12092484-G-T **
14240306-C-A 12119600-C-A **
14272356-G-A 12151650-G-A **
14283848-C-A 12163142-C-A **
14284051-C-T 12163345-C-T **
14450223-C-A 12329496-C-A **
14622904-C-A 12511102-C-A **
14467649-C-A 12346918-C-A **
14495806-C-A 12384003-C-A **
14530840-GA-G 12419041-GA-G 8×A**
14589040-T-G 12477240-T-G **
14606518-C-A 12494720-C-A **
14610579-C-A 12498781-C-A **
14620251-T-G 12508449-T-G **
18634844-C-G 16522964-C-G **
19213707-T-C 17101827-T-C **
18670188-G-T 16558308-G-T **
24351062-A-C 22204915-A-C P3_t1 **
24259110-A-C 22112963-A-C P3_b1 **
24259116-A-C 22112969-A-C P3_b1 **
24259132-T-C 22112985-T-C P3_b1 **
24278463-C-CA 22132316-C-CA P3_b1 **
24278466-A-AG 22132319-A-AG P3_b1 **
24351043-C-A 22204896-C-A P3_t1 **
24351077-C-A 22204930-C-A P3_t1 **
23952531-C-A 21806384-C-A **
24404869-A-C 22258722-A-C **
25200951-G-T 23054804-G-T g1 **
25839848-C-A 23693701-C-A P1_b3 **
25839856-C-A 23693709-C-A P1_b3 **
26015324-A-ACAT 23869177-A-ACAT P1_Y1 **
26315130-C-A 24168983-C-A P1_Y1 **
27423470-T-C 25277323-T-C P1_g3 **
24259082-A-C 22112935-A-C P3_b1 **
21755533-G-T **
27907995-A-AT 25761848-A-AT P1_Y2 **
23401291-C-A 21239405-C-A **
23098096-T-C 20936210-T-C **
23199837-T-G 21037951-T-G **
23202717-A-G 21040831-A-G **
23202721-C-G 21040835-C-G **
23204990-G-T 21043104-G-T **
23372219-CTTTT-C 21210333-CTTTT-C 13×T**
23465266-G-T 21303380-G-T **
23875133-G-T 21713247-G-T **
23468517-T-C 21306631-T-C **
23475643-C-G 21313757-C-G **
23778091-T-C 21616205-T-C **
23778106-A-T 21616220-A-T **
23778109-T-G 21616223-T-G **
23832839-G-T 21670953-G-T **
23848776-T-C 21686890-T-C **
27667288-G-T 25521141-G-T P1_Y2 **
27987170-T-TGGACA 25841023-T-TGGACA P1_Y2 **
23052489-G-A 20890603-G-A **
15631387-T-C 13519507-T-C **
18850288-A-G 16738408-A-G BY8241 **
20040487-G-T 17928607-G-T P5_Prx **
5772322-G-T 5904281-G-T **
6216152-T-C 6348111-T-C IR3_Dst **
6250185-G-T 6382144-G-T IR3_Dst **
13393269-T-A 11237593-T-A **
16000658-G-T 13888778-G-T **
56880512-A-G **
18121282-C-A 16009402-C-A **
20084148-GAGA-G 17972268-GAGA-G P5_Dst **
20084237-G-T 17972357-G-T P5_Dst **
23723305-C-A 21561419-C-A **
24270917-ATTT-A 22124770-ATTT-A P3_b1 19×T**
27933990-A-G 25787843-A-G P1_Y2 **
56727862-T-A **
27446-A-G **
56848311-G-T **
28520607-A-G 26374460-A-G **
28623221-C-A 26477074-C-A **
28529570-C-A 26383423-C-A **
28559841-G-T 26413694-G-T **
28561570-G-T 26415423-G-T **
28570763-G-A 26424616-G-A **
28620618-C-A 26474471-C-A **
28622032-T-C 26475885-T-C **
28633816-T-A 26487669-T-A **
56826377-CCAGT-C **
28653936-G-A 26507789-G-A **
28668391-C-A 26522244-C-A **
28726968-A-G 26580821-A-G **
28730101-C-A 26583954-C-A **
28741228-A-G 26595081-A-G **
28742388-T-G 26596241-T-G **
28782177-T-G 26636030-T-G **
23097089-A-G 20935203-A-G **
23019856-A-G 20857970-A-G **
18670190-G-T 16558310-G-T **
19791334-C-A 17679454-C-A P5_Prx **
19740390-T-G 17628510-T-G P5_Prx **
19781172-C-A 17669292-C-A P5_Prx **
19781183-C-A 17669303-C-A P5_Prx **
19781197-C-A 17669317-C-A P5_Prx **
19781212-C-A 17669332-C-A P5_Prx **
19781219-C-A 17669339-C-A P5_Prx **
19819615-A-G 17707735-A-G P5_Prx **
19740358-A-G 17628478-A-G P5_Prx **
20352235-C-A 18190349-C-A P5_Dst **
20570180-T-C 18408294-T-C P5_Dst **
20622536-A-T 18460650-A-T P4_Prx **
20631886-T-G 18470000-T-G P4_Prx **
20700678-C-CAA 18538792-C-CAA P4_Prx **
20746177-G-T 18584291-G-T P4_Prx **
20761014-A-AT 18599128-A-AT P4_Prx **
19740374-C-T 17628494-C-T P5_Prx **
19597177-G-C 17485297-G-C P5_Prx **
20792770-C-A 18630884-C-A P4_Prx **
19079205-C-A 16967325-C-A **
18701811-C-A 16589931-C-A **
18753458-G-T 16641578-G-T **
18902699-C-A 16790819-C-A **
18956045-ATGGATG-A 16844165-ATGGATG-A **
18990367-C-A 16878487-C-A **
19052137-G-C 16940257-G-C **
19137580-A-G 17025700-A-G **
19524590-C-T 17412710-C-T **
10959215-G-T **
19253169-G-C 17141289-G-C **
19253253-G-T 17141373-G-T **
19329656-C-A 17217776-C-A **
19393020-T-C 17281140-T-C **
19394175-T-C 17282295-T-C **
19437015-GA-G 17325135-GA-G **
20792731-T-TTCCTG 18630845-T-TTCCTG P4_Prx **
20979235-G-GCTGT 18817349-G-GCTGT P4_Dst **
23004640-A-G 20842754-A-G **
22209321-G-T 20047435-G-T **
22045568-A-G 19883682-A-G **
22048568-C-A 19886682-C-A **
22065184-A-T 19903298-A-T **
22080603-T-C 19918717-T-C **
22124486-C-A 19962600-C-A **
22165091-C-A 20003205-C-A **
22309873-C-A 20147987-C-A DYZ19 **
21846981-G-T 19685095-G-T **
22602174-C-A 20440288-C-A **
22798120-T-C 20636234-T-C **
22800068-C-A 20638182-C-A **
22808801-C-A 20646915-C-A **
22846055-C-A 20684169-C-A **
22876606-C-G 20714720-C-G **
22991286-A-G 20829400-A-G **
21996484-C-A 19834598-C-A **
21677548-G-T 19515662-G-T **
20989110-C-CCAGTGTTAAATGCTAGTTTA 18827224-C-CCAGTGTTAAATGCTAGTTTA P4_Dst **
21202154-C-A 19040268-C-A **
20989118-CA-C 18827232-CA-C P4_Dst **
20989132-C-A 18827246-C-A P4_Dst **
21048435-C-A 18886549-C-A **
21106837-C-T 18944951-C-T **
21109993-T-A 18948107-T-A **
21146425-A-T 18984539-A-T 16×T**
21234860-C-A 19072974-C-A **
21476193-T-G 19314307-T-G **
21262654-A-C 19100768-A-C **
21283241-C-A 19121355-C-A **
21283254-T-C 19121368-T-C **
21296954-A-G 19135068-A-G **
21297769-C-A 19135883-C-A **
21353207-C-A 19191321-C-A **
21368730-T-G 19206844-T-G **
10959221-C-A **
11032301-C-A **
10937581-A-C **
4125215-A-C 4257174-A-C **
3990634-C-A 4122593-C-A **
4050267-G-C 4182226-G-C **
4063234-C-A 4195193-C-A **
4088332-A-C 4220291-A-C **
4107813-T-G 4239772-T-G **
4107831-T-A 4239790-T-A **
4178846-G-T 4310805-G-T **
3934009-G-T 4065968-G-T **
4178915-G-T 4310874-G-T **
4201687-A-C 4333646-A-C **
4216078-T-G 4348037-T-G **
4222582-T-C 4354541-T-C **
4229290-A-C 4361249-A-C **
4229296-T-C 4361255-T-C **
3955243-T-C 4087202-T-C **
3877062-C-A 4009021-C-A **
4271748-A-G 4403707-A-G **
3559651-G-T 3691610-G-T **
3363914-G-T 3495873-G-T **
3367150-C-A 3499109-C-A **
3403969-T-A 3535928-T-A **
3452030-T-C 3583989-T-C FT6970 **
3501236-C-A 3633195-C-A **
3545874-C-A 3677833-C-A **
3559705-G-T 3691664-G-T **
3854130-C-A 3986089-C-A **
3590493-G-T 3722452-G-T **
3590495-G-T 3722454-G-T **
3594176-A-C 3726135-A-C **
3647435-G-T 3779394-G-T **
3755550-C-A 3887509-C-A **
3815910-C-A 3947869-C-A **
3851828-G-T 3983787-G-T **
4261834-A-G 4393793-A-G **
4292743-C-G 4424702-C-G **
3334212-G-T 3466171-G-T **
5219324-A-T 5351283-A-T **
5119054-T-A 5251013-T-A **
5119094-T-A 5251053-T-A **
5125776-C-A 5257735-C-A **
5170240-A-G 5302199-A-G **
5171693-G-T 5303652-G-T **
5190099-T-C 5322058-T-C **
5229685-C-T 5361644-C-T **
5011152-G-T 5143111-G-T **
5274138-T-C 5406097-T-C **
5275552-T-A 5407511-T-A **
5446255-C-A 5578214-C-A **
5523650-C-A 5655609-C-A **
5551569-GA-G 5683528-GA-G **
5562847-T-A 5694806-T-A **
5586775-C-A 5718734-C-A **
5107904-C-A 5239863-C-A **
4957811-C-A 5089770-C-A **
4292777-C-T 4424736-C-T **
4374109-A-G 4506068-A-G **
4292779-T-C 4424738-T-C **
4302665-C-G 4434624-C-G FT110 **
4314035-G-T 4445994-G-T **
4314106-G-T 4446065-G-T **
4356913-C-A 4488872-C-A **
4357552-T-C 4489511-T-C **
4388588-C-A 4520547-C-A **
4903057-G-T 5035016-G-T **
4396378-G-T 4528337-G-T **
4444059-G-C 4576018-G-C **
4626785-A-C 4758744-A-C **
4665902-A-C 4797861-A-C **
4762807-A-C 4894766-A-C **
10937570-A-C **
4902088-T-A 5034047-T-A **
3343976-C-T 3475935-C-T **
3210114-G-T 3342073-G-T **
5612255-G-T 5744214-G-T **
7131967-C-A 7263926-C-A **
16881547-C-A 14769667-C-A **
14561822-C-A 12450023-C-A **
22659494-C-A 20497608-C-A **
15823738-C-A 13711858-C-A **
22449670-C-A 20287784-C-A DYZ19 **
10789923-A-T **
28772066-G-T 26625919-G-T **
20215909-T-C 18054023-T-C P5_Dst **
4178928-C-A 4310887-C-A **
8911982-G-T 9043941-G-T **
24244695-C-A 22098548-C-A P3_b1 **
14557259-C-A 12445460-C-A **
16049979-C-A 13938099-C-A **
10972056-C-A **
14023063-T-C 11902357-T-C **
6944943-C-A 7076902-C-A 28×A**
8913115-C-A 9045074-C-A **
7210106-G-A 7342065-G-A **
15422968-CAAA-C 13311088-CAAA-C 14×A****
18241943-A-G 16130063-A-G **
13501902-C-A 11346226-C-A **
9172769-G-C 9335160-G-C **
17200001-G-T 15088121-G-T **
28585694-T-A 26439547-T-A **
17474932-ATT-A 15363052-ATT-A 12×T**
21042975-T-A 18881089-T-A **
10889115-C-A **
13487799-T-A 11332123-T-A **
19301607-G-T 17189727-G-T **
11026037-C-G **
10748006-C-A **
24634103-T-C 22487956-T-C P3_t2 **
21515859-T-G 19353973-T-G **
2974336-C-A 3106295-C-A **
3865513-C-A 3997472-C-A **
3165748-C-A 3297707-C-A **
2772746-T-C 2904705-T-C **
16719973-A-T 14608093-A-T **
13445180-C-A 11289504-C-A **
2665805-G-T 2797764-G-T **
2688770-C-G 2820729-C-G **
2744929-C-A 2876888-C-A **
2746040-C-T 2877999-C-T **
2772789-A-G 2904748-A-G **
10946014-A-C **
2860053-C-A 2992012-C-A **
2905863-T-C 3037822-T-C **
2917731-C-A 3049690-C-A **
3093890-C-A 3225849-C-A **
3122522-T-C 3254481-T-C **
3165232-A-G 3297191-A-G **
3165674-C-A 3297633-C-A **
18567979-C-A 16456099-C-A **
20215977-CAC-A 18054091-CAC-A P5_Dst **
6773330-C-A 6905289-C-A **
10660069-G-T **
25918857-T-TA 23772710-T-TA P1_Y1 **
23142157-C-A 20980271-C-A **
24264546-C-A 22118399-C-A P3_b1 **
11015694-C-A **
10777514-C-T **
10782601-C-A **
17544899-C-A 15433019-C-A **
11032961-G-T **
13467281-T-A 11311605-T-A **
13467295-G-A 11311619-G-A **
19258955-C-A 17147075-C-A **
10033006-C-A 10195397-C-A **
10937533-G-T **
27861852-C-A 25715705-C-A P1_Y2 **
25995436-G-T 23849289-G-T P1_Y1 **
5587393-C-A 5719352-C-A **
4888404-T-C 5020363-T-C **
5627626-G-T 5759585-G-T **
10760331-A-C **
10668345-T-TC **
10672126-T-TTAAAA **
5711292-C-T 5843251-C-T **
10692064-C-G **
10750953-C-A **
10756975-C-A **
10760373-T-C **
10655915-A-G **
10761683-T-G **
10763499-T-C **
10763500-G-C **
10765761-C-G **
10768057-A-G **
10768068-C-T **
10668343-T-TCAA **
10655895-GTTC-G **
10768124-T-G **
10655782-C-A **
9822750-G-A 9985141-G-A **
9952098-G-T 10114489-G-T **
10010433-C-A 10172824-C-A **
10624298-A-G **
10654858-C-A **
10655776-C-G **
10655787-C-T **
10655890-ATT-A **
10655788-A-G **
10655798-T-G **
10655808-C-A **
10655815-T-C **
10655825-A-T **
10655857-C-A **
10768102-A-C **
10768142-A-G **
9672931-T-A 9835322-T-A IR3_Prx **
10895756-C-A **
10845998-C-G **
10880256-CTG-C **
10880260-TCCG-T **
10880267-C-A **
10880273-A-T **
10894681-C-A **
10895861-C-A **
10828098-G-T **
10937488-T-C **
10937531-G-A **
10937535-T-C **
10937542-C-T **
10937546-A-G **
10937559-A-ACGTTC **
10841257-C-A **
10825831-C-A **
10768150-C-G **
10789910-T-G **
10782513-C-A **
10782523-C-A **
10782599-C-A **
10783535-C-A **
10783754-T-C **
10788984-C-A **
10789920-T-G **
10825786-C-A **
10803604-ACCACT-A **
10803923-C-A **
10816067-T-C **
10818828-T-A **
10821975-T-A **
10825757-C-A **
9765898-C-A 9928289-C-A **
10678658-C-A **
9509465-C-A 9671856-C-A **
6775302-T-C 6907261-T-C **
6602208-C-A 6734167-C-A **
6621580-C-A 6753539-C-A **
6623470-A-G 6755429-A-G **
6623609-G-T 6755568-G-T **
6642168-G-A 6774127-G-A **
6747934-T-G 6879893-T-G **
6818939-TG-T 6950898-TG-T **
6526839-G-T 6658798-G-T **
6911256-C-A 7043215-C-A **
6916019-C-A 7047978-C-A **
6981284-C-G 7113243-C-G Y45535 **
7039937-C-A 7171896-C-A **
7040158-G-T 7172117-G-T **
7088095-C-A 7220054-C-A **
7138336-G-T 7270295-G-T **
9364165-C-A 9526556-C-A **
6526764-G-C 6658723-G-C **
7238905-A-C 7370864-A-C **
6018264-T-C 6150223-T-C **
5728079-C-T 5860038-C-T **
5799721-C-A 5931680-C-A **
5842624-C-A 5974583-C-A **
5858356-C-A 5990315-C-A **
5927497-G-T 6059456-G-T **
5968436-A-C 6100395-A-C **
6070090-G-T 6202049-G-T **
6523684-C-A 6655643-C-A **
6070104-G-T 6202063-G-T **
6096953-T-C 6228912-T-C **
6202209-T-C 6334168-T-C IR3_Dst **
6202213-G-A 6334172-G-A IR3_Dst **
6233288-C-T 6365247-C-T IR3_Dst **
6246508-A-C 6378467-A-C IR3_Dst **
6400951-C-T 6532910-C-T **
7184907-C-A 7316866-C-A **
30345-T-C **
9076912-C-A 9239303-C-A **
7391894-C-A 7523853-C-A **
9076927-T-C 9239318-T-C **
8980028-G-T 9142419-G-T **
8856892-C-A 8988851-C-A **
8811263-G-T 8943222-G-T **
8325631-G-A 8457590-G-A **
8137229-T-A 8269188-T-A **
8130669-G-T 8262628-G-T **
8090780-A-C 8222739-A-C **
8074006-C-A 8205965-C-A **
7990738-A-G 8122697-A-G **
9076929-C-A 9239320-C-A **
7756938-C-A 7888897-C-A **
7608508-C-A 7740467-C-A **
7572854-C-A 7704813-C-A **
8085414-G-T 8217373-G-T **
9076933-C-A 9239324-C-A **
7303785-G-T 7435744-G-T **
7360691-C-A 7492650-C-A **
7337786-C-A 7469745-C-A **
7320300-A-G 7452259-A-G **
7303800-T-G 7435759-T-G **
7298793-TA-T 7430752-TA-T **
9116744-C-A 9279135-C-A **
7303783-A-G 7435742-A-G **
15184349-A-C 13072435-A-C ***
13476638-C-T 11320962-C-T ***
13467341-A-C 11311665-A-C ***
22365596-G-A 20203710-G-A DYZ19 ***
24999923-C-T 22853776-C-T g1 ***
9429394-T-G 9591785-T-G ***
24971015-G-A 22824868-G-A g1 ***
22326950-G-C 20165064-G-C DYZ19 ***
22188714-C-A 20026828-C-A ***
26730201-AAAAGAAAGAAAGAAAG-A 24584054-AAAAGAAAGAAAGAAAG-A P1_g2 18×AAAG***
15411271-A-C 13299391-A-C ***
13486715-A-G 11331039-A-G ***
58979547-A-T 56833400-A-T ***
28565722-TTA-T,TTATA 26419575-TTA-T,TTATA 13×TA***
22305984-G-A 20144098-G-A DYZ19 ***
58979547-A-C,T 56833400-A-C,T ***
15636267-G-T 13524387-G-T ***
15952780-A-G 13840900-A-G ***
15515178-CTTT-C,CT 13403298-CTTT-C,CT 14×T***
24813946-G-A 22667799-G-A P3_b2 ***
22219330-C-T 20057444-C-T ZS124 DYZ19 ***
16357227-T-C 14245347-T-C ***
17859700-A-G 15747820-A-G ***
16641872-CATAT-C,CAT 14529992-CATAT-C,CAT 12×AT***
24406613-A-G 22260466-A-G ***
19797707-AG-A 17685827-AG-A P5_Prx ***
3341355-C-A 3473314-C-A ***
7504069-A-T 7636028-A-T IR1_L ***
22227685-G-A 20065799-G-A DYZ19 ***
13467275-G-A 11311599-G-A ***
3411690-CAAAA-C 3543649-CAAAA-C 30×A***
17527438-G-GTATATA 15415558-G-GTATATA 18×TA***
17203542-T-A 15091662-T-A ***
13476321-C-A 11320645-C-A ***
13624352-GTATA-G,GTA 11468676-GTATA-G,GTA 11×TA***
19106850-C-A 16994970-C-A ***
17465151-T-C 15353271-T-C ***
7984038-TCTAAAAAAAAAAAAAAAAAAAAAGAGC-T 8115997-TCTAAAAAAAAAAAAAAAAAAAAAGAGC-T ***
7705064-CAG-C 7837023-CAG-C ***
10673913-C-GGGTTA ***
15140782-C-T 13028869-C-T ***
10958505-C-A ***
13467309-G-C 11311633-G-C ***
16707115-C-A 14595235-C-A ***
7255943-T-C 7387902-T-C ***
18758861-C-A 16646981-C-A ***
13467256-C-G 11311580-C-G ***
13447227-C-A 11291551-C-A ***
28784739-G-A 26638592-G-A ***
13447896-CGTTCAATTCCATTCCATTTA-C,CGTTCAATTCCATTCCATTCA 11292220-CGTTCAATTCCATTCCATTTA-C,CGTTCAATTCCATTCCATTCA ***
23455072-C-A 21293186-C-A ***
18639035-G-A 16527155-G-A ***
3115650-T-C 3247609-T-C ***
18639039-G-A 16527159-G-A ***
2856782-CT-C,CTT 2988741-CT-C,CTT 24×T***
13463183-TAC-CAC,T 11307507-TAC-CAC,T ***
19048090-T-C 16936210-T-C ***
10965585-A-G ***
56830879-G-T ***
13467274-A-G 11311598-A-G ***
14352579-CTT-C 12231874-CTT-C 14×T***
18890563-G-GGAAAGAAA 16778683-G-GGAAAGAAA 11×GAAA***
2957323-CTT-C 3089282-CTT-C 15×T***
13236349-C-T 11080673-C-T ***
56832567-A-C,T ***
16701645-G-T 14589765-G-T ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 3973941086772378943557976359
Kit: 397394991789080658957938984
Kit: 397394*1060000077000007800000
Used in age calculations1086772380658957976359
Counts of SNPs53
Variant counts last updated 2019-08-26 22:27:24.

* BED data not available. Using default values.


Big Tree Main Page