Tree Position

R-P312/S116 > Z290 > L21/S145 > DF13 > Z39589 > DF49/S474 > Z2980 > Z2976 > DF23 > Z2961 > Z2956 > M222 > Z46375 > DF106 > DF104 > DF105 > ZZ87 > DF85 > S673 > S668 > DF97 > ZZ36 > FGC19851 > BY3346 > FGC19846 > FGC19848 > FGC19840 > FGC19845 > FGC19852

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRFTDNA
205297
FGC-BigY
ZHGA5
13680735-A-T 11525059-A-T +
22234335-T-C 20072449-T-C DYZ19 **
22765770-C-A 20603884-C-A **
19356390-G-T 17244510-G-T **
20809831-C-A 18647945-C-A P4_Gap **
19562493-G-C 17450613-G-C **
16279376-C-T 14167496-C-T **
13740604-AATG-A 11584928-AATG-A **
5937242-CTATATA-C 6069201-CTATATA-C 18×TA**
16297287-C-A 14185407-C-A **
16702018-G-T 14590138-G-T **
22504554-T-G 20342668-T-G DYZ19 **
13740609-T-A 11584933-T-A **
16929821-C-A 14817941-C-A **
7090966-C-A 7222925-C-A **
6998204-C-A 7130163-C-A **
6978237-C-A 7110196-C-A **
14491212-G-A 12370481-G-A *****
6830391-C-A 6962350-C-A **
17135823-T-A 15023943-T-A **
20390132-G-T 18228246-G-T P5_Dst **
22767669-A-C 20605783-A-C **
28101123-TG-T 25954976-TG-T P1_Y2 **
16030291-C-A 13918411-C-A **
21672147-C-A 19510261-C-A **
22077112-C-T 19915226-C-T **
14815709-C-A 12703780-C-A **
10048846-A-G 10211237-A-G **
14785022-C-A 12673092-C-A **
15397763-C-A 13285883-C-A **
21744398-T-C 19582512-T-C **
14517673-C-A 12405874-C-A **
28688244-C-A 26542097-C-A **
13858287-T-C 11737581-T-C **
18143700-G-T 16031820-G-T **
15863210-C-A 13751330-C-A **
22234332-CT-C 20072446-CT-C DYZ19 **
21297728-C-A 19135842-C-A **
22435755-T-C 20273869-T-C DYZ19 **
10048858-C-T 10211249-C-T **
14491213-G-A 12370482-G-A *****
23184460-C-G 21022574-C-G **
13838543-AATCAC-A 11717837-AATCAC-A *****
6519314-C-T 6651273-C-T **
7225683-G-A 7357642-G-A BY18249 **
20217930-C-A 18056044-C-A P5_Dst **
13890190-C-A 11769484-C-A **
27319730-T-C 25173583-T-C P1_g3 **
22435753-A-T 20273867-A-T DYZ19 **
7232992-T-C 7364951-T-C BY64064 **
17701749-C-A 15589869-C-A **
9921850-T-C 10084241-T-C PF6725 **
58848158-C-CCCATT 56742662-C-CAATGG 10×CCATT*****
2684611-C-A 2816570-C-A BY18242 **
4063917-C-T 4195876-C-T **
13652130-G-GTGGAATGGAA 11496454-G-GTGGAATGGAA 11×TGGAA**
13881553-G-T 11760847-G-T **
28101093-G-A 25954946-G-A P1_Y2 **
13894441-C-T 11773735-C-T **
3759043-CT-C 3891002-CT-C ****
13945606-A-T 11824900-A-T **
13941716-A-C 11821010-A-C **
10018233-A-G 10180624-A-G **
13897029-C-A 11776323-C-A **
3100424-G-T 3232383-G-T **
13494346-C-A 11338670-C-A **
3986035-C-A 4117994-C-A **
22330539-G-T 20168653-G-T DYZ19 ***
22244989-C-A 20083103-C-A DYZ19 ***
22244988-T-C 20083102-T-C DYZ19 ***
22330562-A-G 20168676-A-G DYZ19 ***
22244991-A-C 20083105-A-C DYZ19 ***
22244986-T-A 20083100-T-A DYZ19 ***
22244990-C-T 20083104-C-T DYZ19 ***
22330477-C-A 20168591-C-A DYZ19 ***
22286909-G-T 20125023-G-T DYZ19 ***
22237298-A-C 20075412-A-C DYZ19 ***
22237304-T-C 20075418-T-C DYZ19 ***
22334893-A-G 20173007-A-G DYZ19 ***
22237303-C-T 20075417-C-T DYZ19 ***
22237302-T-C 20075416-T-C DYZ19 ***
22237301-C-A 20075415-C-A DYZ19 ***
22337751-G-C 20175865-G-C DYZ19 ***
22244993-A-T 20083107-A-T DYZ19 ***
22338481-C-G 20176595-C-G DYZ19 ***
22338762-A-T 20176876-A-T DYZ19 ***
22341253-T-A 20179367-T-A DYZ19 ***
22236337-T-C 20074451-T-C DYZ19 ***
22341259-C-A 20179373-C-A DYZ19 ***
22234754-A-T 20072868-A-T DYZ19 ***
22234735-T-G 20072849-T-G DYZ19 ***
22244992-G-A 20083106-G-A DYZ19 ***
22317576-A-G 20155690-A-G DYZ19 ***
22244994-G-T 20083108-G-T DYZ19 ***
22258577-G-T 20096691-G-T DYZ19 ***
22286907-A-C 20125021-A-C DYZ19 ***
22286906-C-T 20125020-C-T DYZ19 ***
22286904-T-G 20125018-T-G DYZ19 ***
22286911-T-G 20125025-T-G DYZ19 ***
22286901-A-T 20125015-A-T DYZ19 ***
22286900-C-G 20125014-C-G DYZ19 ***
22286912-C-T 20125026-C-T DYZ19 ***
22286899-C-G 20125013-C-G DYZ19 ***
22219444-A-G 20057558-A-G DYZ19 ***
22286898-T-C 20125012-T-C DYZ19 ***
22266346-A-T 20104460-A-T DYZ19 ***
22301139-A-C 20139253-A-C DYZ19 ***
22266199-T-G 20104313-T-G DYZ19 ***
22266197-T-A 20104311-T-A DYZ19 ***
22301142-T-C 20139256-T-C DYZ19 ***
22244995-T-C 20083109-T-C DYZ19 ***
22316747-A-T 20154861-A-T DYZ19 ***
22245001-C-G 20083115-C-G DYZ19 ***
22321201-A-T 20159315-A-T DYZ19 ***
22321197-A-C 20159311-A-C DYZ19 ***
22317581-T-C 20155695-T-C DYZ19 ***
22256899-G-A 20095013-G-A DYZ19 ***
22286908-T-G 20125022-T-G DYZ19 ***
22256901-T-G 20095015-T-G DYZ19 ***
22258575-G-A 20096689-G-A DYZ19 ***
22256902-A-T 20095016-A-T DYZ19 ***
22256903-C-A 20095017-C-A DYZ19 ***
22256904-A-T 20095018-A-T DYZ19 ***
22258386-C-T 20096500-C-T DYZ19 ***
22316743-T-G 20154857-T-G DYZ19 ***
22315989-C-T 20154103-C-T DYZ19 ***
22227923-C-T 20066037-C-T DYZ19 ***
13458327-C-A 11302651-C-A ***
22171734-G-T 20009848-G-T ***
20415456-T-C 18253570-T-C P5_Dst ***
20340123-C-T 18178237-C-T P5_Dst ***
20340126-C-T 18178240-C-T P5_Dst ***
20340221-G-T 18178335-G-T P5_Dst ***
20340226-A-T 18178340-A-T P5_Dst ***
20340233-A-T 18178347-A-T P5_Dst ***
20348861-T-C 18186975-T-C P5_Dst ***
20390252-G-T 18228366-G-T P5_Dst ***
20428440-G-T 18266554-G-T P5_Dst ***
20306352-G-A 18144466-G-A P5_Dst ***
20439934-C-T 18278048-C-T P5_Dst ***
20470288-C-A 18308402-C-A P5_Dst ***
20481135-G-A 18319249-G-A P5_Dst ***
20488019-G-T 18326133-G-T P5_Dst ***
20501116-A-T 18339230-A-T P5_Dst ***
20648947-T-C 18487061-T-C P4_Prx ***
20648948-G-T 18487062-G-T P4_Prx ***
20654151-A-G 18492265-A-G P4_Prx ***
20312742-G-A 18150856-G-A P5_Dst ***
20243589-G-T 18081703-G-T P5_Dst ***
20654155-T-G 18492269-T-G P4_Prx ***
19868137-G-T 17756257-G-T P5_Prx ***
19727536-A-C 17615656-A-C P5_Prx ***
19727554-A-C 17615674-A-C P5_Prx ***
19730964-A-C 17619084-A-C P5_Prx ***
19744955-G-T 17633075-G-T P5_Prx ***
19765775-C-T 17653895-C-T P5_Prx ***
19783687-C-A 17671807-C-A P5_Prx ***
19857942-T-G 17746062-T-G P5_Prx ***
19868136-A-T 17756256-A-T P5_Prx ***
19919382-C-A 17807502-C-A P5_Prx ***
20243004-T-A 18081118-T-A P5_Dst ***
19939632-C-A 17827752-C-A P5_Prx ***
19992053-G-C 17880173-G-C P5_Prx ***
19992054-C-T 17880174-C-T P5_Prx ***
20084558-G-T 17972678-G-T P5_Dst ***
20084563-A-T 17972683-A-T P5_Dst ***
20096972-G-T 17985092-G-T P5_Dst ***
20097028-A-G 17985148-A-G P5_Dst ***
20107286-C-A 17995406-C-A P5_Dst ***
20654154-C-G 18492268-C-G P4_Prx ***
20654157-A-G 18492271-A-G P4_Prx ***
22169193-C-A 20007307-C-A ***
21503170-T-G 19341284-T-G ***
20984183-T-C 18822297-T-C P4_Dst ***
20998050-G-A 18836164-G-A P4_Dst ***
21021584-A-T 18859698-A-T P4_Dst ***
21118830-C-A 18956944-C-A ***
21132671-A-T 18970785-A-T ***
21163096-C-A 19001210-C-A ***
21381604-C-A 19219718-C-A FT97083 ***
22344581-T-A 20182695-T-A DYZ19 ***
21515781-T-G 19353895-T-G ***
20953622-C-A 18791736-C-A P4_Dst ***
21555488-C-A 19393602-C-A ***
21629547-A-C 19467661-A-C ***
21671987-A-G 19510101-A-G ***
21700610-A-C 19538724-A-C ***
21700612-A-G 19538726-A-G ***
21747853-C-T 19585967-C-T ***
21852250-C-A 19690364-C-A ***
22056571-C-A 19894685-C-A ***
20982336-T-A 18820450-T-A P4_Dst ***
20950886-C-T 18789000-C-T P4_Dst ***
20654173-T-G 18492287-T-G P4_Prx ***
20869997-A-G 18708111-A-G P4_Dst ***
20654176-A-C 18492290-A-C P4_Prx ***
20654183-A-G 18492297-A-G P4_Prx ***
20654186-C-G 18492300-C-G P4_Prx ***
20654189-A-G 18492303-A-G P4_Prx ***
20809663-G-T 18647777-G-T P4_Gap ***
20869021-G-T 18707135-G-T P4_Dst 21×T***
20869223-C-T 18707337-C-T P4_Dst ***
20869292-C-A 18707406-C-A P4_Dst ***
20873614-G-T 18711728-G-T P4_Dst ***
20943352-C-T 18781466-C-T P4_Dst ***
20886818-T-C 18724932-T-C P4_Dst ***
20886835-G-A 18724949-G-A P4_Dst ***
20886837-G-A 18724951-G-A P4_Dst ***
20886845-T-A 18724959-T-A P4_Dst ***
20886847-T-A 18724961-T-A P4_Dst ***
20913280-G-A 18751394-G-A P4_Dst ***
20914457-C-A 18752571-C-A P4_Dst ***
20932604-G-T 18770718-G-T P4_Dst ***
22344460-T-A 20182574-T-A DYZ19 ***
22446990-G-T 20285104-G-T DYZ19 ***
22352224-A-G 20190338-A-G DYZ19 ***
24643226-C-G 22497079-C-G P3_t2 ***
24582240-A-T 22436093-A-T P3_t2 ***
24595520-C-T 22449373-C-T P3_t2 ***
24602185-G-T 22456038-G-T P3_t2 ***
24602200-C-T 22456053-C-T P3_t2 ***
24602203-G-T 22456056-G-T P3_t2 ***
24602207-C-T 22456060-C-T P3_t2 ***
24604260-C-A 22458113-C-A P3_t2 ***
24636335-G-T 22490188-G-T P3_t2 ***
24643276-T-C 22497129-T-C P3_t2 ***
24575793-A-G 22429646-A-G P3_t2 ***
24650780-C-T 22504633-C-T P3_b2 ***
24654603-C-A 22508456-C-A P3_b2 ***
24659990-C-T 22513843-C-T P3_b2 ***
24664972-T-C 22518825-T-C P3_b2 ***
24670676-G-T 22524529-G-T P3_b2 ***
24673122-G-T 22526975-G-T P3_b2 ***
24720891-A-T 22574744-A-T P3_b2 ***
24720971-A-C 22574824-A-C P3_b2 ***
24579084-T-C 22432937-T-C P3_t2 ***
24571149-A-T 22425002-A-T P3_t2 ***
24728605-T-A 22582458-T-A P3_b2 ***
24157142-T-C 22010995-T-C P3_b1 ***
24084253-A-C 21938106-A-C P3_b1 ***
24084262-A-C 21938115-A-C P3_b1 ***
24133088-T-G 21986941-T-G P3_b1 ***
24143607-A-C 21997460-A-C P3_b1 ***
24154197-T-C 22008050-T-C P3_b1 ***
24154198-G-A 22008051-G-A P3_b1 ***
24154200-A-G 22008053-A-G P3_b1 ***
24154361-T-C 22008214-T-C P3_b1 ***
24157163-T-C 22011016-T-C P3_b1 ***
24535817-A-C 22389670-A-C P3_t2 ***
24157164-G-T 22011017-G-T P3_b1 ***
24157167-A-T 22011020-A-T P3_b1 ***
24235355-C-A 22089208-C-A P3_b1 ***
24235489-G-A 22089342-G-A P3_b1 ***
24242256-C-A 22096109-C-A P3_b1 ***
24389468-T-A 22243321-T-A ***
24404165-G-T 22258018-G-T ***
24420999-C-T 22274852-C-T ***
24421003-C-T 22274856-C-T ***
24728349-A-T 22582202-A-T P3_b2 ***
24750785-G-A 22604638-G-A P3_b2 ***
24074107-A-T 21927960-A-T P3_b1 ***
25246349-C-T 23100202-C-T P2_r1 ***
24895738-A-G 22749591-A-G g1 ***
24940894-C-G 22794747-C-G g1 ***
25011070-G-T 22864923-G-T g1 ***
25137073-G-T 22990926-G-T g1 ***
25165697-G-A 23019550-G-A g1 ***
25207776-T-A 23061629-T-A P2_r1 ***
25207780-G-A 23061633-G-A P2_r1 ***
25231927-C-G 23085780-C-G P2_r1 ***
25246351-C-T 23100204-C-T P2_r1 ***
24850014-T-G 22703867-T-G IR1_R ***
25246361-C-T 23100214-C-T P2_r1 ***
25246362-C-T 23100215-C-T P2_r1 ***
25246364-T-C 23100217-T-C P2_r1 ***
25246444-C-T 23100297-C-T P2_r1 ***
25268509-G-A 23122362-G-A P2_r1 ***
25306825-C-T 23160678-C-T P2_r1 ***
25310160-G-A 23164013-G-A P2_r1 ***
25361352-C-A 23215205-C-A P2_r2 ***
24850046-G-T 22703899-G-T IR1_R ***
24794780-G-T 22648633-G-T P3_b2 ***
24754852-T-A 22608705-T-A P3_b2 ***
24762576-A-C 22616429-A-C P3_b2 ***
24759894-G-A 22613747-G-A P3_b2 ***
24762178-A-C 22616031-A-C P3_b2 ***
24762187-A-T 22616040-A-T P3_b2 ***
24762195-G-T 22616048-G-T P3_b2 ***
24762196-A-C 22616049-A-C P3_b2 ***
24762211-A-G 22616064-A-G P3_b2 ***
24762215-C-A 22616068-C-A P3_b2 ***
24762565-A-C 22616418-A-C P3_b2 ***
24762687-G-T 22616540-G-T P3_b2 ***
24794487-C-G 22648340-C-G P3_b2 ***
24771280-G-T 22625133-G-T P3_b2 ***
24775669-A-C 22629522-A-C P3_b2 ***
24792912-G-T 22646765-G-T P3_b2 ***
24792917-G-A 22646770-G-A P3_b2 ***
24792932-C-G 22646785-C-G P3_b2 ***
24794415-C-G 22648268-C-G P3_b2 ***
24794424-T-G 22648277-T-G P3_b2 ***
24794431-A-G 22648284-A-G P3_b2 ***
24794458-A-G 22648311-A-G P3_b2 ***
24083893-C-A 21937746-C-A P3_b1 ***
24067362-G-A 21921215-G-A P3_b1 ***
22352453-G-T 20190567-G-T DYZ19 ***
22503960-C-G 20342074-C-G A4409 DYZ19 ***
22492932-G-C 20331046-G-C DYZ19 ***
22493065-G-A 20331179-G-A DYZ19 ***
22496236-T-G 20334350-T-G DYZ19 ***
22498856-T-A 20336970-T-A DYZ19 ***
22498994-T-G 20337108-T-G DYZ19 ***
22499006-T-G 20337120-T-G DYZ19 ***
22502517-G-C 20340631-G-C DYZ19 ***
22502551-G-T 20340665-G-T DYZ19 ***
22508720-T-A 20346834-T-A DYZ19 ***
22482716-G-T 20320830-G-T DYZ19 ***
22508721-C-A 20346835-C-A DYZ19 ***
22508722-T-A 20346836-T-A DYZ19 ***
22508723-T-G 20346837-T-G DYZ19 ***
22508724-C-T 20346838-C-T DYZ19 ***
22508725-A-T 20346839-A-T DYZ19 ***
22508727-A-T 20346841-A-T DYZ19 ***
22508729-G-A 20346843-G-A DYZ19 ***
22511612-A-G 20349726-A-G DYZ19 ***
22488722-G-C 20326836-G-C DYZ19 ***
22460224-C-T 20298338-C-T DYZ19 ***
22816365-T-G 20654479-T-G ***
22357357-G-A 20195471-G-A DYZ19 ***
22352624-G-T 20190738-G-T DYZ19 ***
22354410-A-G 20192524-A-G DYZ19 ***
22356008-T-C 20194122-T-C DYZ19 ***
22356965-A-T 20195079-A-T DYZ19 ***
22357332-G-C 20195446-G-C DYZ19 ***
22357336-A-T 20195450-A-T DYZ19 ***
22357341-A-T 20195455-A-T DYZ19 ***
22357342-C-A 20195456-C-A DYZ19 ***
22358189-A-G 20196303-A-G DYZ19 ***
22460223-A-G 20298337-A-G DYZ19 ***
22360393-A-C 20198507-A-C DYZ19 ***
22367360-T-C 20205474-T-C DYZ19 ***
22367400-C-T 20205514-C-T DYZ19 ***
22367425-T-G 20205539-T-G DYZ19 ***
22426019-A-T 20264133-A-T DYZ19 ***
22435982-A-G 20274096-A-G DYZ19 ***
22446999-A-C 20285113-A-C DYZ19 ***
22460219-C-G 20298333-C-G DYZ19 ***
22460222-T-A 20298336-T-A BY191946 DYZ19 ***
22644673-C-A 20482787-C-A ***
22962059-C-T 20800173-C-T ***
24067360-A-C 21921213-A-C P3_b1 ***
24024757-A-T 21878610-A-T ***
23901140-T-C 21739254-T-C ***
24021384-G-T 21875237-G-T ***
24021403-G-A 21875256-G-A ***
24021405-T-G 21875258-T-G ***
24023390-G-T 21877243-G-T ***
24023429-C-T 21877282-C-T ***
24023430-A-G 21877283-A-G ***
24023431-G-A 21877284-G-A ***
24027977-G-C 21881830-G-C ***
23901132-C-T 21739246-C-T ***
24032472-T-A 21886325-T-A ***
24034873-G-A 21888726-G-A ***
24036051-C-G 21889904-C-G ***
24040663-T-C 21894516-T-C ***
24043784-T-G 21897637-T-G ***
24043790-C-T 21897643-C-T ***
24043800-T-G 21897653-T-G ***
24067327-G-T 21921180-G-T P3_b1 ***
23901133-A-G 21739247-A-G ***
23848581-G-T 21686695-G-T ***
22995222-A-G 20833336-A-G ***
23415301-T-A 21253415-T-A ***
23007487-G-T 20845601-G-T ***
23034416-A-C 20872530-A-C ***
23066481-C-A 20904595-C-A ***
23100061-C-A 20938175-C-A ***
23181518-T-A 21019632-T-A ***
23204609-C-G 21042723-C-G ***
23360729-C-A 21198843-C-A ***
23415300-G-C 21253414-G-C ***
23415303-T-G 21253417-T-G ***
23822663-T-A 21660777-T-A ***
23415305-T-A 21253419-T-A ***
23415308-G-T 21253422-G-T ***
23415309-T-A 21253423-T-A ***
23415311-T-C 21253425-T-C ***
23415312-G-C 21253426-G-C 15×TA***
23439948-C-G 21278062-C-G ***
23514124-A-G 21352238-A-G ***
23514293-C-T 21352407-C-T ***
23696313-A-C 21534427-A-C ***
19727423-T-C 17615543-T-C P5_Prx ***
19577831-G-T 17465951-G-T P5_Prx ***
19727388-G-C 17615508-G-C P5_Prx ***
15793427-T-A 13681547-T-A ***
15280405-A-G 13168504-A-G ***
15363991-C-G 13252111-C-G ***
15363994-A-G 13252114-A-G ***
15364003-T-G 13252123-T-G ***
15475254-C-A 13363374-C-A ***
15749060-G-T 13637180-G-T ***
15764047-C-A 13652167-C-A ***
15792856-C-A 13680976-C-A ***
15842861-T-C 13730981-T-C ***
15049903-A-G 12937994-A-G ***
15865984-G-T 13754104-G-T FT76490 ***
15865986-A-T 13754106-A-T ***
15865987-A-T 13754107-A-T ***
15865989-A-T 13754109-A-T ***
15865990-A-T 13754110-A-T ***
15865993-A-T 13754113-A-T ***
15865994-G-T 13754114-G-T ***
15865995-A-T 13754115-A-T ***
15169057-A-T 13057143-A-T ***
14959796-C-A 12847871-C-A ***
15865997-G-T 13754117-G-T ***
14491284-T-C ***
14491273-A-G ***
14491274-G-A ***
14491275-C-A ***
14491276-C-A ***
14491279-A-C ***
14491280-C-T ***
14491281-A-G ***
14491282-C-T ***
14491287-A-C ***
14667817-C-A 12555882-C-A 23×A***
14491289-A-T ***
14491290-C-G ***
14491291-A-T ***
14491292-A-T ***
14607525-G-T 12495727-G-T ***
14607632-G-T 12495834-G-T ***
14667815-C-A 12555880-C-A ***
14667816-T-A 12555881-T-A ***
15865996-A-T 13754116-A-T ***
15865998-G-T 13754118-G-T ***
14491269-G-T ***
17843182-C-T 15731302-C-T ***
17349339-T-A 15237459-T-A ***
17385378-C-A 15273498-C-A ***
17475193-C-T 15363313-C-T ***
17475195-C-T 15363315-C-T ***
17475198-C-T 15363318-C-T ***
17475209-G-C 15363329-G-C ***
17629653-C-A 15517773-C-A ***
17802162-T-C 15690282-T-C ***
17843200-T-C 15731320-T-C ***
17244630-G-T 15132750-G-T ***
17843204-G-T 15731324-G-T ***
17843207-T-C 15731327-T-C ***
17843223-C-G 15731343-C-G ***
17843227-G-A 15731347-G-A ***
17859103-C-A 15747223-C-A ***
17860031-T-G 15748151-T-G ***
17929813-G-T 15817933-G-T ***
17944931-A-C 15833051-A-C ***
17260415-C-A 15148535-C-A ***
17006374-C-A 14894494-C-A ***
15865999-A-T 13754119-A-T ***
16150031-C-A 14038151-C-A P8_Dst ***
15866000-A-T 13754120-A-T ***
16015686-C-A 13903806-C-A ***
16016446-C-A 13904566-C-A ***
16044457-C-A 13932577-C-A ***
16054042-C-A 13942162-C-A ***
16073050-C-A 13961170-C-A ***
16147434-C-A 14035554-C-A P8_Dst ***
16148322-A-T 14036442-A-T P8_Dst ***
16150060-G-T 14038180-G-T P8_Dst ***
16993533-G-T 14881653-G-T ***
16181300-C-A 14069420-C-A ***
16292639-C-T 14180759-C-T ***
16480952-T-G 14369072-T-G ***
16562830-T-C 14450950-T-C ***
16677596-C-A 14565716-C-A ***
16704877-C-A 14592997-C-A ***
16720239-C-A 14608359-C-A ***
16816364-C-A 14704484-C-A ***
14491272-G-T ***
14491268-G-T ***
17994806-A-C 15882926-A-C P7_Prx ***
13856849-G-A 11736143-G-A ***
13732155-C-T 11576479-C-T ***
13732171-C-G 11576495-C-G ***
13737205-T-A 11581529-T-A ***
13739753-T-G 11584077-T-G ***
13744820-C-G 11589144-C-G ***
13745216-A-G 11589540-A-G ***
13746428-G-T 11590752-G-T ***
13854738-A-G 11734032-A-G ***
13858825-T-A 11738119-T-A ***
13725465-G-C 11569789-G-C ***
13859039-C-T 11738333-C-T ***
13908698-C-A 11787992-C-A ***
14065508-C-A 11944802-C-A ***
14118448-C-A 11997742-C-A ***
14128409-A-T 12007703-A-T ***
14161578-A-G 12040872-A-G ***
14228914-C-A 12108208-C-A ***
14283443-C-A 12162737-C-A ***
13729992-G-A 11574316-G-A ***
13725464-A-C 11569788-A-C ***
14295414-C-A 12174708-C-A ***
13725439-A-G 11569763-A-G ***
13725426-G-C 11569750-G-C ***
13725428-A-T 11569752-A-T ***
13725430-T-G 11569754-T-G ***
13725431-T-A 11569755-T-A ***
13725432-A-C 11569756-A-C ***
13725434-T-G 11569758-T-G ***
13725435-C-G 11569759-C-G ***
13725438-T-A 11569762-T-A ***
13725440-C-G 11569764-C-G ***
13725462-A-C 11569786-A-C ***
13725441-A-C 11569765-A-C ***
13725442-A-T 11569766-A-T ***
13725443-T-G 11569767-T-G ***
13725446-A-T 11569770-A-T ***
13725447-A-G 11569771-A-G ***
13725453-T-A 11569777-T-A ***
13725459-G-T 11569783-G-T ***
13725460-C-G 11569784-C-G ***
14295298-A-G 12174592-A-G ***
14391567-T-G 12270863-T-G ***
14491267-G-T ***
14491254-C-A ***
14491244-C-T ***
14491245-A-G ***
14491246-A-T ***
14491248-C-G ***
14491249-A-T ***
14491250-G-A ***
14491251-G-C ***
14491253-G-C ***
14491255-A-T ***
14491240-G-A ***
14491256-G-A ***
14491257-G-C ***
14491258-A-T ***
14491262-A-T ***
14491263-G-C ***
14491264-G-T ***
14491265-A-G ***
14491266-G-T ***
14491242-C-T ***
14491239-A-C ***
14483192-C-G 12362461-C-G ***
14491224-G-T ***
14491214-T-C 12370483-T-C ***
14491217-G-T 12370486-A-T ***
14491218-G-T 12370487-C-T ***
14491219-T-G ***
14491220-G-C ***
14491221-G-A ***
14491222-A-T ***
14491223-A-T ***
14491225-G-C ***
14491238-G-T ***
14491227-G-T ***
14491228-A-C ***
14491229-A-T ***
14491230-G-A ***
14491231-G-A ***
14491235-C-T ***
14491236-A-C ***
14491237-G-T ***
17994798-G-A 15882918-G-A P7_Prx ***
17994807-T-A 15882927-T-A P7_Prx ***
19727387-T-C 17615507-T-C P5_Prx ***
19577757-T-C 17465877-T-C P5_Prx ***
19189545-T-C 17077665-T-C ***
19189547-A-C 17077667-A-C ***
19319861-T-A 17207981-T-A ***
19319862-A-C 17207982-A-C ***
19319863-T-A 17207983-T-A ***
19389745-G-A 17277865-G-A ***
19389746-T-A 17277866-T-A ***
19509947-C-A 17398067-C-A ***
19577759-C-T 17465879-C-T P5_Prx ***
19189531-T-C 17077651-T-C ***
19577761-C-T 17465881-C-T P5_Prx ***
19577764-T-A 17465884-T-A P5_Prx ***
19577774-A-G 17465894-A-G P5_Prx ***
19577780-G-T 17465900-G-T P5_Prx ***
19577784-G-A 17465904-G-A P5_Prx ***
19577786-G-A 17465906-G-A P5_Prx ***
19577788-G-A 17465908-G-A P5_Prx ***
19577790-A-T 17465910-A-T P5_Prx ***
19189534-G-C 17077654-G-C ***
19189512-A-C 17077632-A-C ***
19577792-A-T 17465912-A-T P5_Prx ***
18490226-C-A 16378346-C-A P6_Dst ***
18353722-C-T 16241842-C-T P6_Prx ***
18353723-T-C 16241843-T-C P6_Prx ***
18353724-G-T 16241844-G-T P6_Prx ***
18353725-G-A 16241845-G-A P6_Prx ***
18361316-T-A 16249436-T-A P6_Prx ***
18369623-G-A 16257743-G-A P6_Prx ***
18462334-A-C 16350454-A-C P6_Dst ***
18467065-G-T 16355185-G-T P6_Dst ***
18511138-T-A 16399258-T-A P6_Dst ***
19189467-A-T 17077587-A-T ***
18524640-A-T 16412760-A-T P6_Dst ***
18530741-G-A 16418861-G-A P6_Dst ***
18533071-C-A 16421191-C-A P6_Dst ***
18627476-C-A 16515596-C-A ***
18747146-T-A 16635266-T-A ***
18780360-C-A 16668480-C-A ***
18856982-C-T 16745102-C-T ***
19031323-C-T 16919443-C-T ***
19577791-A-T 17465911-A-T P5_Prx ***
19577794-A-C 17465914-A-C P5_Prx ***
18353719-T-G 16241839-T-G P6_Prx ***
19695087-C-T 17583207-C-T P5_Prx ***
19577830-G-A 17465950-G-A P5_Prx ***
25366477-C-G 23220330-C-G P2_r2 ***
19577832-G-T 17465952-G-T P5_Prx ***
19577833-A-G 17465953-A-G P5_Prx ***
19577834-C-A 17465954-C-A P5_Prx ***
19577835-T-A 17465955-T-A P5_Prx ***
19577837-C-G 17465957-C-G P5_Prx ***
19577838-T-C 17465958-T-C P5_Prx ***
19695090-C-T 17583210-C-T P5_Prx ***
19577826-T-C 17465946-T-C P5_Prx ***
19700555-C-T 17588675-C-T P5_Prx ***
19709771-G-A 17597891-G-A P5_Prx ***
19709798-T-A 17597918-T-A P5_Prx ***
19709800-G-A 17597920-G-A P5_Prx ***
19709801-G-A 17597921-G-A P5_Prx ***
19709803-C-A 17597923-C-A P5_Prx ***
19709807-C-A 17597927-C-A P5_Prx ***
19727384-T-C 17615504-T-C P5_Prx ***
19577828-C-G 17465948-C-G P5_Prx ***
19577825-C-A 17465945-C-A P5_Prx ***
19577796-A-T 17465916-A-T P5_Prx ***
19577811-T-G 17465931-T-G P5_Prx ***
19577797-C-T 17465917-C-T P5_Prx ***
19577798-A-T 17465918-A-T P5_Prx ***
19577799-T-C 17465919-T-C P5_Prx ***
19577801-T-A 17465921-T-A P5_Prx ***
19577804-A-T 17465924-A-T P5_Prx ***
19577805-A-G 17465925-A-G P5_Prx ***
19577806-G-T 17465926-G-T P5_Prx ***
19577808-A-C 17465928-A-C P5_Prx ***
19577812-C-T 17465932-C-T P5_Prx ***
19577824-C-T 17465944-C-T P5_Prx ***
19577813-T-G 17465933-T-G P5_Prx ***
19577814-A-G 17465934-A-G P5_Prx ***
19577815-T-A 17465935-T-A P5_Prx ***
19577818-A-G 17465938-A-G P5_Prx ***
19577819-G-T 17465939-G-T P5_Prx ***
19577820-T-C 17465940-T-C P5_Prx ***
19577822-G-A 17465942-G-A P5_Prx ***
19577823-A-G 17465943-A-G P5_Prx ***
18353721-T-A 16241841-T-A P6_Prx ***
18353717-T-G 16241837-T-G P6_Prx ***
17994809-G-A 15882929-G-A P7_Prx ***
18008736-A-T 15896856-A-T P7_Dst ***
18008724-C-T 15896844-C-T P7_Dst ***
18008725-G-T 15896845-G-T P7_Dst ***
18008729-A-T 15896849-A-T P7_Dst ***
18008730-G-T 15896850-G-T P7_Dst ***
18008731-G-T 15896851-G-T P7_Dst ***
18008732-C-T 15896852-C-T P7_Dst ***
18008734-G-T 15896854-G-T P7_Dst ***
18008735-G-T 15896855-G-T P7_Dst ***
18008737-G-T 15896857-G-T P7_Dst ***
18008719-G-T 15896839-G-T P7_Dst ***
18008742-G-T 15896862-G-T P7_Dst ***
18008747-G-T 15896867-G-T P7_Dst ***
18008749-A-T 15896869-A-T P7_Dst ***
18008750-A-T 15896870-A-T P7_Dst ***
18008755-G-A 15896875-G-A P7_Dst ***
18008759-C-G 15896879-C-G P7_Dst ***
18008760-A-T 15896880-A-T P7_Dst ***
18008761-C-T 15896881-C-T P7_Dst ***
18008722-G-A 15896842-G-A P7_Dst ***
18008718-C-T 15896838-C-T P7_Dst ***
18008767-G-A 15896887-G-A P7_Dst ***
17994829-G-A 15882949-G-A P7_Prx ***
17994810-C-A 15882930-C-A P7_Prx ***
17994815-C-G 15882935-C-G P7_Prx ***
17994818-C-A 15882938-C-A P7_Prx ***
17994820-C-A 15882940-C-A P7_Prx ***
17994821-T-A 15882941-T-A P7_Prx ***
17994822-C-A 15882942-C-A P7_Prx ***
17994826-C-A 15882946-C-A P7_Prx ***
17994828-T-A 15882948-T-A P7_Prx ***
17994830-G-A 15882950-G-A P7_Prx ***
18008712-G-T 15896832-G-T P7_Dst ***
17994832-C-A 15882952-C-A P7_Prx ***
17994833-G-A 15882953-G-A P7_Prx ***
17994835-C-A 15882955-C-A P7_Prx ***
17994839-G-A 15882959-G-A P7_Prx ***
17994841-G-A 15882961-G-A P7_Prx ***
18008707-A-T 15896827-A-T P7_Dst ***
18008708-G-T 15896828-G-T P7_Dst ***
18008710-C-T 15896830-C-T P7_Dst ***
18008763-G-T 15896883-G-T P7_Dst ***
18008770-C-T 15896890-C-T P7_Dst ***
18353716-T-G 16241836-T-G P6_Prx ***
18353703-C-G 16241823-C-G P6_Prx ***
18353693-A-C 16241813-A-C P6_Prx ***
18353695-A-G 16241815-A-G P6_Prx ***
18353696-C-G 16241816-C-G P6_Prx ***
18353697-G-T 16241817-G-T P6_Prx ***
18353698-G-A 16241818-G-A P6_Prx ***
18353699-C-A 16241819-C-A P6_Prx ***
18353701-A-T 16241821-A-T P6_Prx ***
18353702-T-G 16241822-T-G P6_Prx ***
18353704-T-A 16241824-T-A P6_Prx ***
18353690-A-C 16241810-A-C P6_Prx ***
18353705-C-T 16241825-C-T P6_Prx ***
18353706-T-A 16241826-T-A P6_Prx ***
18353707-T-A 16241827-T-A P6_Prx ***
18353708-G-A 16241828-G-A P6_Prx ***
18353709-A-C 16241829-A-C P6_Prx ***
18353710-C-A 16241830-C-A P6_Prx ***
18353711-C-A 16241831-C-A P6_Prx ***
18353714-T-G 16241834-T-G P6_Prx ***
18353691-G-A 16241811-G-A P6_Prx ***
18353689-C-T 16241809-C-T P6_Prx ***
18008775-C-A 15896895-C-A P7_Dst ***
18158321-C-A 16046441-C-A ***
18008776-C-A 15896896-C-A P7_Dst ***
18008777-C-A 15896897-C-A P7_Dst ***
18008780-G-A 15896900-G-A P7_Dst ***
18008785-C-T 15896905-C-T P7_Dst ***
18008787-C-A 15896907-C-A P7_Dst ***
18008790-C-T 15896910-C-T P7_Dst ***
18008800-C-T 15896920-C-T P7_Dst ***
18008801-C-T 15896921-C-T P7_Dst ***
18184564-G-T 16072684-G-T ***
18353688-T-A 16241808-T-A P6_Prx ***
18297946-G-T 16186066-G-T P6_Prx ***
18353677-T-C 16241797-T-C P6_Prx ***
18353679-A-C 16241799-A-C P6_Prx ***
18353681-T-A 16241801-T-A P6_Prx ***
18353683-A-T 16241803-A-T P6_Prx ***
18353685-A-C 16241805-A-C P6_Prx ***
18353686-A-C 16241806-A-C P6_Prx ***
18353687-G-C 16241807-G-C P6_Prx ***
25366296-C-A 23220149-C-A P2_r2 ***
25447412-T-G 23301265-T-G P2_r2 ***
25366479-T-C 23220332-T-C P2_r2 ***
17994869-C-AAA 15882989-C-AAA P7_Prx ***
16147477-TA-T 14035597-TA-T P8_Dst 14×A***
16148997-TA-T 14037117-TA-T P8_Dst 10×A***
16157792-AACTTTCCAATGACGTTCTTAGAGCAACT-GAAGGAAAGAAAGAAAGAAAAGGGTGTTG 14045912-AACTTTCCAATGACGTTCTTAGAGCAACT-GAAGGAAAGAAAGAAAGAAAAGGGTGTTG P8_Dst ***
16250624-G-TT 14138744-G-TT 28×T***
16595919-CTTTTTT-C 14484039-CTTTTTT-C 17×T***
16860774-G-AA 14748894-G-AA 9×A***
17564912-GAAAAA-G 15453032-GAAAAA-G 16×A***
17872639-CTTTTT-C 15760759-CTTTTT-C 17×T***
18017150-TAT-C 15905270-TAT-C ***
14875586-CTTTGTG-TTTTTT 12763656-CTTTGTG-TTTTTT ***
18035663-GAC-TTTT 15923783-GAC-TTTT ***
18430094-CA-C 16318214-CA-C P6_Dst 28×A***
18447621-G-TTT 16335741-G-TTT P6_Dst 18×T***
18448945-GT-G 16337065-GT-G P6_Dst ***
18465467-CAG-AAAA 16353587-CAG-AAAA P6_Dst ***
18487808-TAA-T 16375928-TAA-T P6_Dst 19×A***
18615932-C-CTT 16504052-C-CTT 27×T***
19668814-AAT-A 17556934-AAT-A P5_Prx ***
15866310-AAG-A 13754430-AAG-A ***
14743154-CAAAAAA-C 12631222-CAAAAAA-C 19×A***
19775301-TC-T 17663421-TC-T P5_Prx ***
13734783-TTC-CTG 11579107-TTC-CTG ***
13489616-C-CCCCGT 11333940-C-CCCCGT ***
13729318-TAA-GG 11573642-TAA-GG ***
13729613-GGG-TGC 11573937-GGG-TGC ***
13729753-ACC-TCG 11574077-ACC-TCG ***
13729781-TG-AC 11574105-TG-AC ***
13729958-TCAAGTGGAA-AGGAGCAGAG 11574282-TCAAGTGGAA-AGGAGCAGAG ***
13732202-T-AATGGA 11576526-T-AATGGA ***
13732560-TC-AG 11576884-TC-AG ***
13740606-TGATATCGAAAGGAAGGGAA-AATGGATTTGAACAGAT 11584930-TGATATCGAAAGGAAGGGAA-AATGGATTTGAACAGAT ***
14491276-CGCACACTTTTAAACAA-AGCCTGTTCTTCATGTT ***
13801113-C-CGAATGGAATGGACTCGAATGGAATGTGCTCGAATG 11680407-C-CGAATGGAATGGACTCGAATGGAATGTGCTCGAATG 12×GAATG***
13801174-AACTCGAATGG-GAATTGAACCA 11680468-AACTCGAATGG-GAATTGAACCA ***
13801189-GATTCGAATG-TAATGGACTT 11680483-GATTCGAATG-TAATGGACTT ***
13856642-AA-GG 11735936-AA-GG ***
13859837-ATCGAAAGG-GTGGACACA 11739131-ATCGAAAGG-GTGGACACA ***
13962037-CTTTCC-TTTTTT 11841331-CTTTCC-TTTTTT ***
14339089-GTTTC-TTTTT 12218384-GTTTC-TTTTT ***
14491211-T-TGGTA 12370480-T-TGGTA ***
14491261-AA-GT ***
19721757-ACCGA-CCCGC 17609877-ACCGA-CCCGC P5_Prx ***
19809172-AT-A 17697292-AT-A P5_Prx 10×T***
13461354-GAG-CTT 11305678-GAG-CTT ***
22235090-CAAG-AAGC 20073204-CAAG-AAGC DYZ19 ***
20949941-TTGATG-CTGACA 18788055-TTGATG-CTGACA P4_Dst ***
20970352-C-CAA 18808466-C-CAA P4_Dst 12×A***
21025133-TA-T 18863247-TA-T P4_Dst ***
21149582-G-TT 18987696-G-TT 27×T***
21306618-G-AA 19144732-G-AA ***
21306622-GAAAG-AAAAA 19144736-GAAAG-AAAAA ***
21402212-TTTTA-T 19240326-TTTTA-T ***
22235088-TA-AC 20073202-TA-AC DYZ19 ***
22237286-TATA-CATC 20075400-TATA-CATC DYZ19 ***
20932612-GAA-G 18770726-GAA-G P4_Dst 17×A***
22256889-TACGG-GTTCC 20095003-TACGG-GTTCC DYZ19 ***
22273575-TTACAATCCTTA-GTTACAGCACTT 20111689-TTACAATCCTTA-GTTACAGCACTT DYZ19 ***
22273589-GAT-AGA 20111703-GAT-AGA DYZ19 ***
22281897-CT-TC 20120011-CT-TC DYZ19 ***
22337543-TTAC-CAGT 20175657-TTAC-CAGT DYZ19 ***
22358694-TTT-AAG 20196808-TTT-AAG DYZ19 ***
22431696-AA-CC 20269810-AA-CC DYZ19 ***
22446106-AC-CT 20284220-AC-CT DYZ19 ***
20949799-AAAG-GCAC 18787913-AAAG-GCAC P4_Dst ***
20920178-C-CAA 18758292-C-CAA P4_Dst 14×A***
19829294-ACTTTC-TTTTTT 17717414-ACTTTC-TTTTTT P5_Prx ***
20280154-TCTTC-T 18118268-TCTTC-T P5_Dst 8×CTTC***
19892868-G-TT 17780988-G-TT P5_Prx 31×T***
19930476-CTT-C 17818596-CTT-C P5_Prx 22×T***
20063941-TAAAAA-T 17952061-TAAAAA-T P5_Gap 18×A***
20086349-T-TA 17974469-T-TA P5_Dst 10×A***
20107299-G-AA 17995419-G-AA P5_Dst 24×A***
20203507-A-ATGTTGT 18041621-A-ATGTTGT P5_Dst 10×TGT***
20245100-TA-T 18083214-TA-T P5_Dst 9×A***
20256948-TA-T 18095062-TA-T P5_Dst 12×A***
20326007-C-TT 18164121-C-TT P5_Dst 29×T***
20886819-CACAGGCT-AAAAAAAA 18724933-CACAGGCT-AAAAAAAA P4_Dst ***
20366225-AT-A 18204339-AT-A P5_Dst 8×T***
20386768-G-GAAA 18224882-G-GAAA P5_Dst 15×A***
20390195-GA-G 18228309-GA-G P5_Dst ***
20430442-CAA-C 18268556-CAA-C P5_Dst 22×A***
20438758-AT-A 18276872-AT-A P5_Dst 23×T***
20479819-AT-A 18317933-AT-A P5_Dst 14×T***
20481197-A-AT 18319311-A-AT P5_Dst 9×T***
20530282-CA-C 18368396-CA-C P5_Dst ***
20757350-CCTGTGATTTACA-TTTTTTTTTTT 18595464-CCTGTGATTTACA-TTTTTTTTTTT P4_Prx ***
13486740-CATT-TATC 11331064-CATT-TATC ***
13461325-CAAG-TAAAT 11305649-CAAG-TAAAT ***
22493033-TGAAA-AGAAG 20331147-TGAAA-AGAAG DYZ19 ***
28065155-C-CT 25919008-C-CT P1_Y2 15×T***
22341286-GATGAAGCTGCA-AAAGAATGAAGC 20179400-GATGAAGCTGCA-AAAGAATGAAGC DYZ19 ***
26713801-CA-C 24567654-CA-C P1_g2 18×A***
9636618-TTG-T 9799009-TTG-T IR3_Prx 13×TG***
27881475-C-CT 25735328-C-CT P1_Y2 12×T***
27311977-C-CA 25165830-C-CA P1_g3 16×A***
27222206-GA-G 25076059-GA-G P1_g3 16×A***
10067427-AC-CA 10229818-AC-CA ***
10048872-CA-TG 10211263-CA-TG ***
20723982-AT-A 18562096-AT-A P4_Prx 14×T***
19790172-GA-G 17678292-GA-G P5_Prx 15×A***
16340170-C-AA 14228290-C-AA ***
27761295-GA-G 25615148-GA-G P1_Y2 15×A***
26556114-C-CA 24409967-C-CA P1_g2 10×A***
3544896-G-GA 3676855-G-GA ***
4358621-TTCTAACTTGAACATACACACTCCCACATAC-CCCCGAAACCCATCTCACTCACATACATACAT 4490580-TTCTAACTTGAACATACACACTCCCACATAC-CCCCGAAACCCATCTCACTCACATACATACAT ***
4358656-CTGTGCATGCACACAC-ACGTACATACATAGAT 4490615-CTGTGCATGCACACAC-ACGTACATACATAGAT ***
4358676-CACACAC-ACACACA 4490635-CACACAC-ACACACA ***
6226043-T-TCTTC 6358002-T-TCTTC IR3_Dst ***
23807600-G-AA 21645714-G-AA ***
27692068-GA-G 25545921-GA-G P1_Y2 15×A***
6323750-CA-C 6455709-CA-C IR3_Dst 12×A***
58990413-A-T 56844266-A-T ***
58912944-T-A 56677927-A-T ***
58912983-C-G 56677888-G-C ***
58914128-G-C 56676743-C-G ***
58914492-A-C 56676379-T-G ***
58984994-T-C 56838847-T-C ***
58984997-C-T 56838850-C-T ***
58985828-G-T 56839681-G-T ***
58988285-G-A 56842138-G-A ***
58991655-C-A 56845508-C-A ***
9622370-TTG-T 9784761-TTG-T IR3_Prx ***
58994612-T-C 56848465-T-C ***
58995897-G-T 56849750-G-T ***
59007980-A-C 56861833-A-C ***
59022265-T-A 56876118-T-A ***
13851695-ACAAATG-TCGAATT 11730989-ACAAATG-TCGAATT ***
13460876-AGG-GAT 11305200-AGG-GAT ***
22263725-AT-TC 20101839-AT-TC DYZ19 ***
26890135-GAT-G 24743988-GAT-G P1_r3 20×AT***
27072229-G-GAT 24926082-G-GAT P1_r4 21×AT***
6226088-T-TTTCC 6358047-T-TTTCC IR3_Dst ***
6403097-GTA-ATC 6535056-GTA-ATC ***
13461127-ACTA-CCTG 11305451-ACTA-CCTG ***
13143473-AAT-CAC 10632959-AAT-CAC ***
10067405-AAGT-GTGC 10229796-AAGT-GTGC ***
10067434-ACCA-GCCG 10229825-ACCA-GCCG ***
10086310-TC-GA 10248701-TC-GA ***
10086339-TAT-AAA 10248730-TAT-AAA ***
10102809-AG-A 10265200-AG-A ***
13140098-AGA-TCC 10629584-AGA-TCC ***
13140601-AA-TC 10630087-AA-TC ***
13143462-TAAT-CCAC 10632948-TAAT-CCAC ***
13193995-TCCCAT-CTCCAC 11038319-TCCCAT-CTCCAC ***
9952735-AGTTA-GGGCG 10115126-AGTTA-GGGCG ***
13301231-TAA-CAG 11145555-TAA-CAG ***
13301284-CA-TG 11145608-CA-TG ***
13320303-TAAAA-GAAAG 11164627-TAAAA-GAAAG ***
13329549-ACT-GCA 11173873-ACT-GCA ***
13423948-AGT-GGG 11268272-AGT-GGG ***
13452873-GCATTCCATTCCATTCCATTCCATTC-G 11297197-GCATTCCATTCCATTCCATTCCATTC-G 14×CATTC***
13460808-AAGC-GAGT 11305132-AAGC-GAGT ***
13460851-TTCCC-ATCCG 11305175-TTCCC-ATCCG ***
13461010-AAGT-GAGA 11305334-AAGT-GAGA ***
10014734-AATGT-TATGC 10177125-AATGT-TATGC ***
9952707-GTCTC-ATCTG 10115098-GTCTC-ATCTG ***
6403210-CTTAG-GTTTT 6535169-CTTAG-GTTTT ***
9345025-CTTGGGCA-GGGGGGGGGG 9507416-CTTGGGCA-GGGGGGGGGG ***
6734680-CTTTTT-C 6866639-CTTTTT-C 21×T***
7165273-CTG-TTT 7297232-CTG-TTT ***
7405015-AGAT-A 7536974-AGAT-A ***
7867929-A-AAAG 7999888-A-AAAG ***
8786746-ACCA-CCCC 8918705-ACCA-CCCC ***
9215556-CAGGGAAGGC-GGGGGGGGGG 9377947-CAGGGAAGGC-GGGGGGGGGG ***
9304418-CTCGGAGGAGGCTTGGGCAGGGAAGGCA-GGGGGGGGGGGGGGGGGGGGGGGGGGGG 9466809-CTCGGAGGAGGCTTGGGCAGGGAAGGCA-GGGGGGGGGGGGGGGGGGGGGGGGGGGG ***
9307398-TTGTGTGTG-T 9469789-TTGTGTGTG-T 15×TG***
9345036-AAGGC-GGGGG 9507427-AAGGC-GGGGG ***
9951900-GAATA-CAATG 10114291-GAATA-CAATG ***
9529142-CTT-C 9691533-CTT-C IR3_Prx 15×T***
9589945-C-CT 9752336-C-CT IR3_Prx 10×T***
9623645-T-TA 9786036-T-TA IR3_Prx 11×A***
9654389-A-AGAAG 9816780-A-AGAAG IR3_Prx ***
9930171-GCTAG-TCTTA 10092562-GCTAG-TCTTA ***
9930212-TGAAGACACCTGCGACCTCAGGAACG-ACACCCCGGGACGGCAGGAAACCTAC 10092603-TGAAGACACCTGCGACCTCAGGAACG-ACACCCCGGGACGGCAGGAAACCTAC ***
9943801-ATCCT-CTCCC 10106192-ATCCT-CTCCC ***
9943885-ATTA-TTTT 10106276-ATTA-TTTT ***
9945110-G-GA 10107501-G-GA ***
22492913-CTGCCGAC-GTGCAGAA 20331027-CTGCCGAC-GTGCAGAA DYZ19 ***
22493046-TTT-CTC 20331160-TTT-CTC DYZ19 ***
58886899-C-T 56703972-G-A ***
58838687-ATCCCT-TTTCAG 56752179-AGGGAT-CTGAAA ***
58824882-TC-T 56765986-AG-A ***
58830157-CCCATTCCATTCAATT-C 56760673-AAATGGAATGGAATTG-A ***
58830540-ATTCCATTGGATTACT-A 56760308-GAATGGAAAGTAATCC-G ***
58834672-TA-T 56756197-AT-A ***
58835237-AT-A 56755631-GA-G ***
58835765-GGCATTCCATTCCATTCCA-TGCATTCCATTCCT 56755088-TGGAATGGAATGGAATGCC-AGGAATGGAATGCA ***
58837915-TCCATTTGATGCCATC-T 56752936-CATGGGATGGCATCAA-C ***
58838641-ATTCGAATCCTTTCT-TTTCAAGTCCATTCC 56752216-AGAAAGGATTCGAAT-GGAATGGACTTGAAA ***
58838705-CATTACAG-GATTCGAT 56752159-CTGTAATG-ATCGAATC ***
58822051-G-GCATTCCATTCCGTGGGTGTC 56768804-G-GCCACGGAATGGAATGGACAC ***
58838722-ATAG-TTCC 56752146-CTAT-GGAA ***
58838736-TTTGCC-ATTCCA 56752130-GGCAAA-TGGAAT ***
58840730-GCATACAATTTCACTCCATTCGTTCCC-TGCATTTTTTCCGTTCAATTACATTCG 56750115-GGGAACGAATGGAGTGAAATTGTATGC-CGAATGTAATTGAACGGAAAAAATGCA ***
58841874-CTTCCATTCGATTCCT-C 56748967-TGGAATCGAATGGAAA-T ***
58842149-CTTTCT-C 56748716-TAGAAA-T ***
58842174-GATTT-AATTC 56748693-AAATC-GAATT ***
58842185-ATTCTGTTCT-TTTCCATGCC 56748677-AGAACAGAAT-GGCATGGAAA ***
58844535-TCAC-CCAT 56746333-GTGA-ATGG ***
58824560-CTTC-ATTA 56766308-GAAG-TAAT ***
58821948-ATTCCG-TTTCCA 56768918-CGGAAT-TGGAAA ***
58846098-AT-CC 56744772-AT-GG ***
28257584-C-GAG 26111437-C-GAG P1_b4 18×AG***
27971754-C-AA 25825607-C-AA P1_Y2 ***
27996127-G-GAA 25849980-G-GAA P1_Y2 14×A***
28027423-AT-A 25881276-AT-A P1_Y2 10×T***
28030733-T-TTTCG 25884586-T-TTTCG P1_Y2 ***
28044809-CA-C 25898662-CA-C P1_Y2 ***
28203963-ACCTA-CCCTT 26057816-ACCTA-CCCTT P1_b4 ***
28242000-GT-G 26095853-GT-G P1_b4 9×T***
28253556-GAAGCT-AAAAAA 26107409-GAAGCT-AAAAAA P1_b4 ***
28406839-C-CA 26260692-C-CA P1_gr2 16×A***
58821938-GTTCG-ATTCC 56768929-CGAAC-GGAAT ***
28438188-CAAAA-C 26292041-CAAAA-C P1_gr2 31×A***
28802672-TGGAT-AGGAG 26656525-TGGAT-AGGAG ***
58819449-TTC-ATTCCATT 56771420-GAA-AATGGAAT ***
58820494-GCATTCGTGTCCGTTCTATTCGAG-CCACTCGAATCCACTCCATTACAC 56770354-CTCGAATAGAACGGACACGAATGC-GTGTAATGGAGTGGATTCGAGTGG ***
58820525-CATTACAGTCT-C 56770332-GAATAGACTGT-G ***
58820557-GTTG-TTCC 56770311-CAAC-GGAA ***
58821900-ACCT-TCAA 56768968-AGGT-TTGA ***
58821911-GCAGTCTT-CCATTACA 56768953-AAGACTGC-TGTAATGG ***
58821923-CTTCGAG-AATCCAT 56768942-CTCGAAG-ATGGATT ***
58846063-G-ACATTC 56744808-C-GAATGT ***
58848262-CTCTATC-TTCCATT 56742603-GATAGAG-AATGGAA ***
27963480-CA-C 25817333-CA-C P1_Y2 11×A***
19979863-GCT-G 17867983-GCT-G P5_Prx ***
58985078-GGGGC-AGGGA 56838931-GGGGC-AGGGA ***
58989444-GGTGCTTTGTGACATATCCCTGCAATGATCACCCAGATGATGT-TGGCGTTTTGACATAGCTCTGCACAGATCACCTAGGTTATGTA 56843297-GGTGCTTTGTGACATATCCCTGCAATGATCACCCAGATGATGT-TGGCGTTTTGACATAGCTCTGCACAGATCACCTAGGTTATGTA ***
58990390-GA-TT 56844243-GA-TT ***
58990399-CATTTTAACT-TATTGTGAGA 56844252-CATTTTAACT-TATTGTGAGA ***
58994544-ACGG-GCGA 56848397-ACGG-GCGA ***
58994573-GGG-TGA 56848426-GGG-TGA ***
58994624-ATAAG-GTAAC 56848477-ATAAG-GTAAC ***
18039365-AAT-A 15927485-AAT-A ***
20510960-GAT-G 18349074-GAT-G P5_Dst ***
58983167-C-CCACTA 56837020-C-CCACTA ***
24686426-TAC-T 22540279-TAC-T P3_b2 ***
27412863-ATATG-A 25266716-ATATG-A P1_g3 ***
58908838-TCCATC-T 56682023-AATGGG-A ***
13464359-T-A,G 11308683-T-A,G ***
28799250-GA-A,G 26653103-GA-A,G ***
9181072-CATAT-C,CAT 9343463-CATAT-C,CAT 14×AT***
13457663-A-G,T 11301987-A-G,T ***
13680706-A-G,T 11525030-A-G,T ***
13680891-T-A,G 11525215-T-A,G ***
58984994-TACC-CACT 56838847-TACC-CACT ***
58979305-CTCCAT-C 56833158-CTCCAT-C ***
58857035-CTCCACA-TTCAATC 56733830-TGTGGAG-GATTGAA ***
58886893-TTT-ATA 56703976-AAA-TAT ***
58865958-GAG-CAT 56724911-CTC-ATG ***
58865999-TA-AT 56724871-TA-AT ***
58866431-TCCATTTGATGCCATC-T 56724420-CATGGGATGGCATCAA-C ***
58873268-CTCTATC-TTCCATT 56717597-GATAGAG-AATGGAA ***
58874918-CTCC-TTCA 56715950-GGAG-TGAA ***
58883875-TTCCAT-C 56706991-ATGGAA-G ***
58885021-TGTTCT-CATTCC 56705845-AGAACA-GGAATG ***
58886881-GGAGTCA-CGATTCC 56703984-TGACTCC-GGAATCG ***
58890943-GTCCATTTCACACCAG-CTACAGTCCACTCCTC 56699913-CTGGTGTGAAATGGAC-GAGGAGTGGACTGTAG ***
58914155-CTG-TTC 56676714-CAG-GAA ***
58890964-TACTA-AACAC 56699903-TAGTA-GTGTT ***
58890973-TTCCATA-CTCCACT 56699892-TATGGAA-AGTGGAG ***
58890983-TTCCATCCCAC-CTCTAA 56699878-GTGGGATGGAA-TTAGAG ***
58908829-CCATACCAT-TGGGTTGAA 56682034-ATGGTATGG-TTCAACCCA ***
58908924-GCACTCC-AGGATTG 56681941-GGAGTGC-CAATCCT ***
58908939-ACATTCTACTCTA-CCGTTCCATTAGT 56681920-TAGAGTAGAATGT-ACTAATGGAACGG ***
58908953-CTG-TCC 56681916-CAG-GGA ***
58912402-ACTA-CAAT 56678466-TAGT-ATTG ***
58912415-TACCATTCCAT-CTCCACTCCTC 56678446-ATGGAATGGTA-GAGGAGTGGAG ***
27968354-C-CTT 25822207-C-CTT P1_Y2 14×T***
27960966-TAA-T 25814819-TAA-T P1_Y2 18×A***
22502526-TTT-AAG 20340640-TTT-AAG DYZ19 ***
25165673-TC-T 23019526-TC-T g1 ***
24792990-ACT-CCC 22646843-ACT-CCC P3_b2 ***
24794449-AGGT-GGGG 22648302-AGGT-GGGG P3_b2 ***
24794470-ACC-CCG 22648323-ACC-CCG P3_b2 ***
24794478-AGGGT-GGGGG 22648331-AGGGT-GGGGG P3_b2 ***
24795027-G-GA 22648880-G-GA P3_b2 9×A***
24825568-CT-C 22679421-CT-C P3_b2 15×T***
24895705-AG-TT 22749558-AG-TT g1 ***
24907802-AAT-A 22761655-AAT-A g1 ***
25251571-G-AA 23105424-G-AA P2_r1 ***
24773659-AT-A 22627512-AT-A P3_b2 9×T***
25287593-GA-G 23141446-GA-G P2_r1 ***
25306190-GA-G 23160043-GA-G P2_r1 ***
25431783-AT-A 23285636-AT-A P2_r2 8×T***
25432611-CAAAAAA-C 23286464-CAAAAAA-C P2_r2 26×A***
25439195-C-CA 23293048-C-CA P2_r2 22×A***
25447251-TGTA-T 23301104-TGTA-T P2_r2 ***
25452458-G-GTT 23306311-G-GTT P2_r2 13×T***
25456551-GATATAT-G 23310404-GATATAT-G P2_r2 20×AT***
24789179-CA-C 22643032-CA-C P3_b2 8×A***
24700953-AAAGACAC-A 22554806-AAAGACAC-A P3_b2 ***
25592446-AT-A 23446299-AT-A P1_gr1 14×T***
24280901-AG-A 22134754-AG-A P3_t1 ***
22502545-ATAC-TTAG 20340659-ATAC-TTAG DYZ19 ***
23415293-TATATATGTATGTATGT-GTAAGGTCATGGAATTA 21253407-TATATATGTATGTATGT-GTAAGGTCATGGAATTA ***
23678682-G-GT 21516796-G-GT 14×T***
23723544-CATATATAT-C 21561658-CATATATAT-C 27×AT***
24043029-CGGGAGGGGTCTGGTGTCTGGGTCAGGTTGAGGTACCCCTGGGACCCG-C 21896882-CGGGAGGGGTCTGGTGTCTGGGTCAGGTTGAGGTACCCCTGGGACCCG-C ***
24084207-A-CC 21938060-A-CC P3_b1 ***
24115164-CCA-C 21969017-CCA-C P3_b1 23×CA***
24235359-TC-AA 22089212-TC-AA P3_b1 ***
24283360-G-AA 22137213-G-AA P3_t1 ***
24693328-GA-G 22547181-GA-G P3_b2 ***
24323664-T-TA 22177517-T-TA P3_t1 14×A***
24560975-T-TA 22414828-T-TA P3_t2 10×A***
24568394-AAT-A 22422247-AAT-A P3_t2 8×AT***
24577878-CA-C 22431731-CA-C P3_t2 25×A***
24597813-CTT-C 22451666-CTT-C P3_t2 22×T***
24607334-G-TT 22461187-G-TT P3_t2 ***
24646583-GT-G 22500436-GT-G P3_b2 21×T***
24670716-CT-C 22524569-CT-C P3_b2 ***
24678599-A-AT 22532452-A-AT P3_b2 ***
25536618-TA-T 23390471-TA-T P1_gr1 13×A***
25677117-CTG-C 23530970-CTG-C P1_b3 ***
27947646-C-CA 25801499-C-CA P1_Y2 8×A***
27774223-CT-C 25628076-CT-C P1_Y2 ***
27583000-CTTTTT-C 25436853-CTTTTT-C P1_Y2 22×T***
27585914-AGTC-TT 25439767-AGTC-TT P1_Y2 ***
27618169-C-CT 25472022-C-CT P1_Y2 14×T***
27644243-CA-C 25498096-CA-C P1_Y2 10×A***
27711690-C-CT 25565543-C-CT P1_Y2 17×T***
27733713-CAA-C 25587566-CAA-C P1_Y2 26×A***
27745674-TA-T 25599527-TA-T P1_Y2 12×A***
27772643-TA-T 25626496-TA-T P1_Y2 21×A***
27777759-G-GA 25631612-G-GA P1_Y2 19×A***
27319772-CT-C 25173625-CT-C P1_g3 8×T***
27801225-G-GA 25655078-G-GA P1_Y2 13×A***
27809490-CAGAC-TAGAT 25663343-CAGAC-TAGAT P1_Y2 ***
27809534-GCTAT-ACAAA 25663387-GCTAT-ACAAA P1_Y2 ***
27819786-ATT-A 25673639-ATT-A P1_Y2 13×T***
27844422-ACCCA-CCCCC 25698275-ACCCA-CCCCC P1_Y2 ***
27847931-GT-G 25701784-GT-G P1_Y2 11×T***
27873319-CTTTCC-TTTTTTT 25727172-CTTTCC-TTTTTTT P1_Y2 ***
27918818-GA-G 25772671-GA-G P1_Y2 11×A***
27943970-CCA-C 25797823-CCA-C P1_Y2 14×CA***
27398534-G-AA 25252387-G-AA P1_g3 ***
27290770-C-CT 25144623-C-CT P1_g3 11×T***
25717179-C-CA 23571032-C-CA P1_b3 15×A***
26914079-AC-T 24767932-AC-T P1_r3 ***
25717443-GAAAG-AAAAA 23571296-GAAAG-AAAAA P1_b3 ***
25858419-G-AA 23712272-G-AA P1_Y1 ***
25940445-CT-C 23794298-CT-C P1_Y1 17×T***
25964919-G-TT 23818772-G-TT P1_Y1 ***
26089081-AG-A 23942934-AG-A P1_Y1 ***
26124489-GAAAGAAGAAAT-AAAAAAAAAAAA 23978342-GAAAGAAGAAAT-AAAAAAAAAAAA P1_Y1 ***
26170521-GGAAGAG-AGAA 24024374-GGAAGAG-AGAA P1_Y1 ***
26563185-TACAC-T 24417038-TACAC-T P1_g2 15×AC***
26997289-CT-C 24851142-CT-C P1_r4 23×T***
27151328-TGTA-T 25005181-TGTA-T P1_g3 ***
27004222-CT-C 24858075-CT-C P1_r4 25×T***
27008910-TA-T 24862763-TA-T P1_r4 ***
27030714-CTT-C 24884567-CTT-C P1_r4 13×T***
27035479-CCT-TC 24889332-CCT-TC P1_r4 ***
27039067-TA-T 24892920-TA-T P1_r4 ***
27049850-ATT-A 24903703-ATT-A P1_r4 17×T***
27129771-CA-C 24983624-CA-C P1_g3 25×A***
27149714-TAA-T 25003567-TAA-T P1_g3 16×A***
27151159-ATT-A 25005012-ATT-A P1_g3 9×T***
58912410-T-C 56678461-A-G ***
58886897-G-T 56703974-C-A ***
25366481-A-C 23220334-A-C P2_r2 ***
26902373-T-A 24756226-T-A P1_r3 ***
26828436-G-A 24682289-G-A P1_g2 ***
26834496-A-G 24688349-A-G P1_g2 ***
26835608-T-G 24689461-T-G P1_g2 ***
26874673-C-G 24728526-C-G P1_r3 ***
26902185-T-A 24756038-T-A P1_r3 ***
26902367-C-A 24756220-C-A P1_r3 ***
26902369-G-A 24756222-G-A P1_r3 ***
26902370-T-A 24756223-T-A P1_r3 ***
26902377-C-A 24756230-C-A P1_r3 ***
26810565-A-T 24664418-A-T P1_g2 ***
26902379-G-A 24756232-G-A P1_r3 ***
26902380-C-A 24756233-C-A P1_r3 ***
26902383-C-A 24756236-C-A P1_r3 ***
26902384-C-A 24756237-C-A P1_r3 ***
26902385-C-A 24756238-C-A P1_r3 ***
26902387-T-A 24756240-T-A P1_r3 ***
26907505-A-G 24761358-A-G P1_r3 ***
26955513-T-G 24809366-T-G P1_r3 ***
26810567-G-T 24664420-G-T P1_g2 ***
26810558-T-A 24664411-T-A P1_g2 ***
26955557-T-G 24809410-T-G P1_r3 ***
26465088-T-A 24318941-T-A P1_Y1 ***
26319788-C-A 24173641-C-A P1_Y1 ***
26320398-G-T 24174251-G-T P1_Y1 ***
26320406-C-T 24174259-C-T P1_Y1 ***
26340884-A-C 24194737-A-C P1_Y1 ***
26344119-G-T 24197972-G-T P1_Y1 ***
26344120-C-T 24197973-C-T P1_Y1 ***
26344125-A-T 24197978-A-T P1_Y1 ***
26344389-G-T 24198242-G-T P1_Y1 ***
26465104-T-A 24318957-T-A P1_Y1 ***
26730200-G-A 24584053-G-A P1_g2 ***
26465105-C-A 24318958-C-A P1_Y1 ***
26465109-G-A 24318962-G-A P1_Y1 ***
26465151-T-A 24319004-T-A P1_Y1 ***
26505309-A-G 24359162-A-G P1_Y1 ***
26505315-A-G 24359168-A-G P1_Y1 ***
26505323-A-G 24359176-A-G P1_Y1 ***
26546621-G-T 24400474-G-T P1_g2 ***
26592994-G-T 24446847-G-T P1_g2 ***
26730199-A-G 24584052-A-G P1_g2 ***
26955530-A-G 24809383-A-G P1_r3 ***
26986415-G-T 24840268-G-T P1_r4 ***
26243447-A-C 24097300-A-C P1_Y1 ***
27424368-C-A 25278221-C-A P1_g3 ***
27231456-T-A 25085309-T-A P1_g3 ***
27256273-G-T 25110126-G-T P1_g3 ***
27266648-G-T 25120501-G-T P1_g3 ***
27329997-G-T 25183850-G-T P1_g3 ***
27368971-T-A 25222824-T-A P1_g3 ***
27370655-T-A 25224508-T-A P1_g3 8×A***
27397086-A-C 25250939-A-C P1_g3 ***
27420607-A-G 25274460-A-G P1_g3 ***
27466779-C-T 25320632-C-T P1_Y2 ***
27205748-G-T 25059601-G-T P1_g3 ***
27546167-G-T 25400020-G-T P1_Y2 ***
27550393-C-A 25404246-C-A P1_Y2 ***
27584263-G-T 25438116-G-T P1_Y2 ***
27607527-C-G 25461380-C-G P1_Y2 ***
27607548-G-A 25461401-G-A P1_Y2 ***
27714820-G-A 25568673-G-A P1_Y2 ***
27763278-A-G 25617131-A-G P1_Y2 ***
27769124-G-T 25622977-G-T P1_Y2 ***
27229530-C-A 25083383-C-A P1_g3 ***
27198931-G-T 25052784-G-T P1_g3 ***
26986419-C-G 24840272-C-G P1_r4 ***
26997371-A-C 24851224-A-C P1_r4 ***
26986440-C-T 24840293-C-T P1_r4 24×T***
26986467-G-A 24840320-G-A P1_r4 ***
26986479-G-T 24840332-G-T P1_r4 ***
26986488-G-T 24840341-G-T P1_r4 ***
26997355-A-T 24851208-A-T P1_r4 ***
26997357-G-A 24851210-G-A P1_r4 ***
26997361-A-T 24851214-A-T P1_r4 ***
26997364-G-A 24851217-G-A P1_r4 ***
27001661-C-T 24855514-C-T P1_r4 ***
27151348-T-G 25005201-T-G P1_g3 ***
27001666-C-T 24855519-C-T P1_r4 ***
27001696-C-T 24855549-C-T P1_r4 ***
27082147-A-C 24936000-A-C P1_r4 ***
27082152-A-C 24936005-A-C P1_r4 ***
27128542-G-T 24982395-G-T P1_g3 ***
27129704-A-G 24983557-A-G P1_g3 ***
27129847-T-A 24983700-T-A P1_g3 ***
27150703-A-T 25004556-A-T P1_g3 ***
27150714-C-T 25004567-C-T P1_g3 ***
26284971-G-A 24138824-G-A P1_Y1 ***
26243445-A-G 24097298-A-G P1_Y1 ***
27780504-T-A 25634357-T-A P1_Y2 ***
25717365-G-T 23571218-G-T P1_b3 ***
25677412-A-T 23531265-A-T P1_b3 ***
25677461-T-G 23531314-T-G P1_b3 ***
25690063-G-T 23543916-G-T P1_b3 ***
25709598-A-T 23563451-A-T P1_b3 ***
25709599-C-T 23563452-C-T P1_b3 ***
25709602-G-T 23563455-G-T P1_b3 ***
25709616-G-T 23563469-G-T P1_b3 ***
25709622-A-T 23563475-A-T P1_b3 ***
25717384-C-A 23571237-C-A P1_b3 ***
25671990-A-T 23525843-A-T P1_b3 ***
25717459-G-A 23571312-G-A P1_b3 ***
25757741-G-T 23611594-G-T P1_b3 ***
25804968-T-C 23658821-T-C P1_b3 ***
25845007-C-A 23698860-C-A P1_b3 ***
25845166-T-A 23699019-T-A P1_b3 ***
25883843-A-C 23737696-A-C P1_Y1 ***
25899578-T-G 23753431-T-G P1_Y1 ***
25954889-T-G 23808742-T-G P1_Y1 ***
25674441-G-T 23528294-G-T P1_b3 ***
25650700-A-C 23504553-A-C P1_b3 ***
25954924-T-C 23808777-T-C P1_Y1 ***
13725424-T-A 11569748-T-A ***
25366490-C-G 23220343-C-G P2_r2 ***
25366813-A-G 23220666-A-G P2_r2 ***
25372016-G-T 23225869-G-T P2_r2 ***
25375096-G-C 23228949-G-C P2_r2 ***
25431769-G-T 23285622-G-T P2_r2 ***
25432540-G-A 23286393-G-A P2_r2 ***
25434096-A-T 23287949-A-T P2_r2 ***
25440128-G-A 23293981-G-A P2_r2 ***
25464619-T-A 23318472-T-A P2_r2 ***
25650623-A-G 23504476-A-G P1_b3 ***
25464730-A-T 23318583-A-T P2_r2 ***
25481007-G-C 23334860-G-C P2_r2 ***
25493278-G-T 23347131-G-T P2_r2 ***
25500457-A-G 23354310-A-G P2_r2 ***
25500539-C-A 23354392-C-A P2_r2 ***
25602256-G-A 23456109-G-A P1_gr1 ***
25603751-A-C 23457604-A-C P1_gr1 ***
25650607-G-T 23504460-G-T P1_b3 ***
25650615-T-A 23504468-T-A P1_b3 ***
25954922-A-G 23808775-A-G P1_Y1 ***
25954931-G-A 23808784-G-A P1_Y1 ***
26243442-A-G 24097295-A-G P1_Y1 ***
26243425-A-T 24097278-A-T P1_Y1 ***
26152251-T-C 24006104-T-C P1_Y1 ***
26152254-A-T 24006107-A-T P1_Y1 ***
26152255-G-T 24006108-G-T P1_Y1 ***
26152256-A-T 24006109-A-T P1_Y1 ***
26225692-T-C 24079545-T-C P1_Y1 ***
26243420-A-G 24097273-A-G P1_Y1 ***
26243422-C-G 24097275-C-G P1_Y1 ***
26243424-A-G 24097277-A-G P1_Y1 ***
26243426-C-A 24097279-C-A P1_Y1 ***
26124511-G-A 23978364-G-A P1_Y1 ***
26243427-A-T 24097280-A-T P1_Y1 ***
26243428-A-G 24097281-A-G P1_Y1 ***
26243430-C-G 24097283-C-G P1_Y1 ***
26243432-A-G 24097285-A-G P1_Y1 ***
26243433-G-T 24097286-G-T P1_Y1 ***
26243435-A-G 24097288-A-G P1_Y1 ***
26243437-G-A 24097290-G-A P1_Y1 ***
26243439-A-T 24097292-A-T P1_Y1 ***
26243440-A-G 24097293-A-G P1_Y1 ***
26124515-G-A 23978368-G-A P1_Y1 ***
26124509-C-A 23978362-C-A P1_Y1 ***
25954947-A-T 23808800-A-T P1_Y1 ***
25955006-T-C 23808859-T-C P1_Y1 ***
25954954-A-C 23808807-A-C P1_Y1 ***
25954965-C-T 23808818-C-T P1_Y1 ***
25954969-C-G 23808822-C-G P1_Y1 ***
25954974-A-T 23808827-A-T P1_Y1 ***
25954985-A-C 23808838-A-C P1_Y1 ***
25954989-C-T 23808842-C-T P1_Y1 ***
25954990-A-G 23808843-A-G P1_Y1 ***
25954995-A-C 23808848-A-C P1_Y1 ***
25955031-A-G 23808884-A-G P1_Y1 ***
26124507-G-A 23978360-G-A P1_Y1 ***
25955032-A-G 23808885-A-G P1_Y1 ***
25955037-C-T 23808890-C-T P1_Y1 ***
25955045-G-A 23808898-G-A P1_Y1 ***
25955050-G-A 23808903-G-A P1_Y1 ***
25955052-A-G 23808905-A-G P1_Y1 ***
26089890-G-T 23943743-G-T P1_Y1 ***
26098044-C-A 23951897-C-A P1_Y1 ***
26098047-C-A 23951900-C-A P1_Y1 ***
26098060-C-A 23951913-C-A P1_Y1 ***
27776088-T-A 25629941-T-A P1_Y2 ***
27793132-G-C 25646985-G-C P1_Y2 ***
58886785-A-T 56704086-T-A ***
28802693-G-A 26656546-G-A ***
28802682-T-A 26656535-T-A ***
28802686-C-A 26656539-C-A ***
28802687-T-A 26656540-T-A ***
28802688-G-A 26656541-G-A ***
28802690-A-G 26656543-A-G ***
28802691-T-A 26656544-T-A ***
28802691-T-G 26656544-T-G ***
28802692-T-A 26656545-T-A ***
28802694-T-A 26656547-T-A ***
28802678-G-T 26656531-G-T ***
28802696-G-A 26656549-G-A ***
28802698-G-A 26656551-G-A ***
28802701-T-A 26656554-T-A ***
28802703-G-T 26656556-G-T ***
28802706-G-A 26656559-G-A ***
28802713-G-C 26656566-G-C ***
28802716-G-A 26656569-G-A ***
28802721-G-A 26656574-G-A ***
28802679-G-C 26656532-G-C ***
28802677-T-A 26656530-T-A ***
28802734-G-A 26656587-G-A ***
28802569-T-C 26656422-T-C ***
28797838-G-A 26651691-G-A ***
28797840-T-A 26651693-T-A ***
28797848-C-G 26651701-C-G ***
28797849-T-A 26651702-T-A ***
28797851-T-C 26651704-T-C ***
28797852-G-C 26651705-G-C ***
28797855-G-A 26651708-G-A ***
28802565-G-A 26656418-G-A ***
28802571-A-G 26656424-A-G ***
28802674-G-C 26656527-G-C ***
28802573-T-G 26656426-T-G ***
28802575-A-T 26656428-A-T ***
28802576-A-T 26656429-A-T ***
28802578-T-G 26656431-T-G ***
28802586-G-T 26656439-G-T ***
28802606-C-G 26656459-C-G ***
28802666-G-A 26656519-G-A ***
28802668-G-T 26656521-G-T ***
28802673-G-T 26656526-G-T ***
28802723-G-C 26656576-G-C ***
28806574-G-C 26660427-G-C ***
28797835-G-A 26651688-G-A ***
58873113-G-T 56717758-C-A ***
58842938-T-A 56747933-A-T ***
58842939-C-A 56747932-G-T ***
58842940-G-C 56747931-C-G ***
58846029-C-T 56744842-G-A ***
58865915-G-T 56724956-C-A ***
58865916-A-T 56724955-T-A ***
58865957-T-C 56724914-A-G ***
58866285-T-C 56724586-A-G ***
58873114-C-T 56717757-G-A ***
58842935-G-T 56747936-C-A ***
58874945-G-C 56715926-C-G ***
58875148-C-T 56715723-G-A ***
58883595-T-A 56707276-A-T ***
58884284-G-A 56706587-C-T ***
58884325-T-G 56706546-A-C ***
58884850-A-C 56706021-T-G ***
58885058-A-T 56705813-T-A ***
58885070-G-C 56705801-C-G ***
58885073-G-C 56705798-C-G ***
58842936-T-A 56747935-A-T ***
58842931-T-A 56747940-A-T ***
28814654-G-A 26668507-G-A ***
58830565-A-T 56760306-T-A ***
58819703-C-G 56771168-G-C ***
58819708-C-G 56771163-G-C ***
58820515-G-C 56770356-C-G ***
58823808-C-T 56767063-G-A ***
58823823-T-A 56767048-A-T ***
58824578-A-T 56766293-T-A ***
58825007-C-T 56765864-G-A ***
58830564-G-C 56760307-C-G ***
58835191-C-G 56755680-G-C ***
58842879-C-G 56747992-G-C ***
58835705-C-T 56755166-G-A ***
58838730-C-T 56752141-G-A ***
58838753-T-A 56752118-A-T ***
58838756-A-G 56752115-T-C ***
58838757-T-A 56752114-A-T ***
58840761-C-G 56750110-G-C ***
58840766-A-G 56750105-T-C ***
58841719-T-C 56749152-A-G ***
58842867-G-T 56748004-C-A ***
28797837-G-C 26651690-G-C ***
28797834-G-A 26651687-G-A ***
27793138-C-G 25646991-C-G P1_Y2 ***
28117340-C-T 25971193-C-T P1_b4 ***
28117322-G-T 25971175-G-T P1_b4 ***
28117323-A-T 25971176-A-T P1_b4 ***
28117324-A-T 25971177-A-T P1_b4 ***
28117325-G-T 25971178-G-T P1_b4 ***
28117326-G-T 25971179-G-T P1_b4 ***
28117334-G-T 25971187-G-T P1_b4 ***
28117336-G-T 25971189-G-T P1_b4 ***
28117338-C-T 25971191-C-T P1_b4 ***
28117342-A-T 25971195-A-T P1_b4 ***
28086193-G-A 25940046-G-A P1_Y2 ***
28117344-C-T 25971197-C-T P1_b4 ***
28117350-C-T 25971203-C-T P1_b4 ***
28117351-C-T 25971204-C-T P1_b4 ***
28117352-G-T 25971205-G-T P1_b4 ***
28117355-C-T 25971208-C-T P1_b4 ***
28117357-G-T 25971210-G-T P1_b4 ***
28117358-C-T 25971211-C-T P1_b4 ***
28117360-C-T 25971213-C-T P1_b4 ***
28086203-T-A 25940056-T-A P1_Y2 ***
28086188-C-A 25940041-C-A P1_Y2 ***
28117363-C-T 25971216-C-T P1_b4 ***
27947602-C-A 25801455-C-A P1_Y2 ***
27844434-A-C 25698287-A-C P1_Y2 ***
27864418-G-C 25718271-G-C P1_Y2 ***
27874304-C-T 25728157-C-T P1_Y2 ***
27893789-T-A 25747642-T-A P1_Y2 ***
27902262-A-C 25756115-A-C P1_Y2 ***
27902385-A-T 25756238-A-T P1_Y2 ***
27902499-C-T 25756352-C-T P1_Y2 ***
27902504-A-T 25756357-A-T P1_Y2 ***
27971792-C-A 25825645-C-A P1_Y2 ***
28065184-A-T 25919037-A-T P1_Y2 ***
28009094-C-T 25862947-C-T P1_Y2 ***
28017380-C-A 25871233-C-A P1_Y2 ***
28017440-G-T 25871293-G-T P1_Y2 ***
28024588-C-A 25878441-C-A P1_Y2 ***
28060368-T-C 25914221-T-C P1_Y2 ***
28062762-G-T 25916615-G-T P1_Y2 ***
28062767-A-C 25916620-A-C P1_Y2 ***
28065178-A-C 25919031-A-C P1_Y2 ***
28065180-T-C 25919033-T-C P1_Y2 ***
28117362-G-T 25971215-G-T P1_b4 ***
28117365-C-T 25971218-C-T P1_b4 ***
28797826-T-A 26651679-T-A ***
28797813-G-C 26651666-G-C ***
28794295-T-A 26648148-T-A ***
28794301-T-A 26648154-T-A ***
28794302-G-C 26648155-G-C ***
28794333-G-A 26648186-G-A ***
28794335-C-A 26648188-C-A ***
28797498-G-A 26651351-G-A ***
28797811-T-A 26651664-T-A ***
28797812-G-T 26651665-G-T ***
28797814-A-T 26651667-A-T ***
28794292-G-A 26648145-G-A ***
28797816-T-A 26651669-T-A ***
28797817-G-T 26651670-G-T ***
28797818-T-A 26651671-T-A ***
28797819-T-G 26651672-T-G ***
28797820-T-A 26651673-T-A ***
28797821-T-A 26651674-T-A ***
28797822-A-T 26651675-A-T ***
28797824-A-G 26651677-A-G ***
28797825-G-A 26651678-G-A ***
28794293-G-C 26648146-G-C ***
28794290-G-A 26648143-G-A ***
28136374-T-A 25990227-T-A P1_b4 ***
28245687-C-G 26099540-C-G P1_b4 ***
28149467-T-A 26003320-T-A P1_b4 ***
28157385-C-A 26011238-C-A P1_b4 ***
28157390-A-G 26011243-A-G P1_b4 ***
28157402-A-G 26011255-A-G P1_b4 ***
28160781-G-T 26014634-G-T P1_b4 ***
28160784-C-T 26014637-C-T P1_b4 ***
28206475-C-T 26060328-C-T P1_b4 ***
28214125-G-C 26067978-G-C P1_b4 ***
28253600-T-A 26107453-T-A P1_b4 ***
28793712-A-G 26647565-A-G ***
28253618-G-A 26107471-G-A P1_b4 ***
28507551-C-A 26361404-C-A ***
28529465-C-A 26383318-C-A ***
28550108-G-T 26403961-G-T ***
28614952-C-A 26468805-C-A ***
28771834-G-A 26625687-G-A ***
28773841-C-A 26627694-C-A ***
28777762-C-A 26631615-C-A ***
28793645-G-A 26647498-G-A ***
13725425-G-T 11569749-G-T ***
13725394-T-G 11569718-T-G ***
13725421-A-G 11569745-A-G ***
13864936-A-G 11744230-A-G ***
13859460-G-A 11738754-G-A ***
13859464-A-C,G 11738758-A-C,G ***
13859480-G-A 11738774-G-A Z7402 ***
13859503-T-A 11738797-T-A ***
13859792-T-A,C 11739086-T-A,C ***
13863499-T-G 11742793-T-G ***
13863583-C-T 11742877-C-T ***
13864879-A-T 11744173-A-T ***
13869980-C-A 11749274-C-A ***
13859413-T-C 11738707-T-C ***
13869995-G-C 11749289-G-C ***
13870154-T-A 11749448-T-A ***
13870159-T-A 11749453-T-A ***
13870160-A-C 11749454-A-C ***
13870163-A-G 11749457-A-G ***
13870168-C-A 11749462-C-A ***
13870170-C-G 11749464-C-G ***
13870178-A-G 11749472-A-G ***
13859414-G-T 11738708-G-T ***
13859399-G-A 11738693-G-A ***
22219966-C-T 20058080-C-T FGC4596 DYZ19 ***
13854606-T-A 11733900-T-A ***
13841495-T-C 11720789-T-C ***
13842084-G-A 11721378-G-A ***
13843850-A-G 11723144-A-G ***
13847184-GAATGGAATGGAATGGAATGGACTCA-G,GAATGGAATGGAATGGAGTGGACTCA 11726478-GAATGGAATGGAATGGAATGGACTCA-G,GAATGGAATGGAATGGAGTGGACTCA ***
13848278-T-A 11727572-T-A ***
13850475-A-G 11729769-A-G ***
13852747-A-G 11732041-A-G ***
13852753-A-G 11732047-A-G ***
13854608-C-G 11733902-C-G ***
13859383-T-C 11738677-T-C ***
13854621-C-T 11733915-C-T ***
13854622-A-G 11733916-A-G ***
13854650-G-A 11733944-G-A ***
13854675-A-G 11733969-A-G ***
13855239-T-A 11734533-T-A ***
13855938-A-T 11735232-A-T ***
13859295-A-G 11738589-A-G ***
13859358-T-C 11738652-T-C ***
13859359-G-C 11738653-G-C ***
13870183-T-A 11749477-T-A ***
22220033-T-C 20058147-T-C DYZ19 ***
13839756-TAATGG-G,T 11719050-TAATGG-G,T 11×AATGG***
28800322-G-A 26654175-G-A FGC30407 ***
28791773-G-GTGCAGTGGAT 26645626-G-GTGCAGTGGAT ***
28796694-T-G 26650547-T-G ***
28798897-G-C 26652750-G-C ***
28798917-G-A 26652770-G-A ***
28799136-T-A 26652989-T-A ***
28799244-C-G 26653097-C-G ***
28800106-GGAGTC-G 26653959-GGAGTC-G ***
28800307-G-A 26654160-G-A ***
28801009-T-G 26654862-T-G ***
28788090-T-G 26641943-T-G ***
28805575-A-G 26659428-A-G ***
28810131-G-T 26663984-G-T ***
28810144-C-A 26663997-C-A ***
28811222-T-G 26665075-T-G ***
58829921-T-G 56760950-A-C ***
58976262-T-C 56830115-T-C ***
58977221-A-T 56831074-A-T ***
58980008-A-T 56833861-A-T ***
28791635-A-G 26645488-A-G Z27086 ***
28787531-T-A 26641384-T-A ***
22267228-A-C 20105342-A-C DYZ19 ******
25064987-A-G 22918840-A-G g1 ***
22267233-C-G 20105347-C-G DYZ19 ******
22269595-T-A 20107709-T-A DYZ19 ***
22269597-C-T 20107711-C-T DYZ19 ***
22336298-C-T 20174412-C-T A4144 DYZ19 ***
22344960-T-G 20183074-T-G DYZ19 ***
22421036-C-T 20259150-C-T DYZ19 ***
22430289-A-T 20268403-A-T DYZ19 ***
22493048-T-C 20331162-T-C DYZ19 ***
28785581-G-A 26639434-G-A ***
28787529-A-G 26641382-A-G ***
28785686-TTATTG-G,T 26639539-TTATTG-G,T ***
28785707-G-T 26639560-G-T ***
28785880-T-C 26639733-T-C ***
28785885-T-G 26639738-T-G ***
28785927-G-A 26639780-G-A ***
28786586-A-G 26640439-A-G BZ4408 ***
28786597-TGGGAA-T 26640450-TGGGAA-T ***
28787331-G-A 26641184-G-A ***
28787341-G-A 26641194-G-A ***
13841234-T-A 11720528-T-A ***
13838685-A-T 11717979-A-T ***
58981956-C-T 56835809-C-T ***
13194025-C-T 11038349-C-T ***
9979644-AATG-A 10142035-AATG-A ***
9992944-T-A 10155335-T-A ***
9992953-T-C 10155344-T-C ***
13139504-T-C 10628990-T-C F10591 ***
13140333-A-T 10629819-A-T ***
13142282-T-C 10631768-T-C ***
13143306-T-A 10632792-T-A ***
13194020-C-T 11038344-C-T ***
13194736-T-A 11039060-T-A ***
9215565-C-G 9377956-C-G ***
13194740-T-C 11039064-T-C ***
13194744-T-C 11039068-T-C ***
13194765-T-C 11039089-T-C ***
13194802-G-C 11039126-G-C ***
13196155-T-A 11040479-T-A ***
13268904-T-C 11113228-T-C ***
13447696-T-C 11292020-T-C ***
13448841-T-C 11293165-T-C ***
9941268-T-TCCAG,TCTAA 10103659-T-TCCAG,TCTAA ***
9215562-A-G 9377953-A-G ***
13454363-C-A 11298687-C-A ***
25841842-T-G 23695695-T-G P1_b3 ***
21002535-TTC-T 18840649-TTC-T P4_Dst 16×TC***
26325206-ATG-A 24179059-ATG-A P1_Y1 14×TG******
13845483-T-A 11724777-T-A ***
13830100-A-G 11709394-A-G ***
58820546-C-A 56770325-G-T ***
9344791-G-A 9507182-G-A ***
13869209-G-C 11748503-G-C ***
13203966-A-G 11048290-A-G ***
9191076-AAC-A 9353467-AAC-A 20×AC***
9215557-A-G 9377948-A-G ***
13691246-TTGGAATGGAA-T 11535570-TTGGAATGGAA-T ***
13817625-A-G 11696919-A-G ***
13818280-C-A 11697574-C-A BY156344 ***
13868153-C-A 11747447-C-A ***
28798896-G-A 26652749-G-A ***
28798927-G-A 26652780-G-A ***
28798937-G-A 26652790-G-A ***
28799852-G-A 26653705-G-A ***
58912477-G-C 56678394-C-G 4×CATTC***
13449987-T-G 11294311-T-G ***
13456566-T-C 11300890-T-C ***
13838316-C-A 11717610-C-A ***
13801720-G-A 11681014-G-A ***
13713139-GACTGGAATCA-G 11557463-GACTGGAATCA-G ***
13713155-AATGGC-A 11557479-AATGGC-A ***
13720502-T-A 11564826-T-A ******
13734980-A-T 11579304-A-T ***
13736432-C-T 11580756-C-T ***
13737678-A-G 11582002-A-G ***
13737692-C-A 11582016-C-A ***
13801549-G-A 11680843-G-A ***
13804153-A-C 11683447-A-C ***
13704227-A-T 11548551-A-T ***
13805291-T-G 11684585-T-G ***
13805486-C-G 11684780-C-G ***
13810108-C-G 11689402-C-G ***
13810778-C-G 11690072-C-G ***
13812988-C-A 11692282-C-A ***
13815566-T-C 11694860-T-C ***
13817678-C-G 11696972-C-G ***
13832640-A-G 11711934-A-G ***
13706407-T-C 11550731-T-C BY1008 ***
13691129-C-A 11535453-C-A BY27333 ***
13459645-C-A 11303969-C-A ***
13658897-G-T 11503221-G-T ***
13459677-T-C 11304001-T-C ***
13459685-C-G 11304009-C-G ***
13461324-A-AT 11305648-A-AT ***
13464336-C-T 11308660-C-T ***
13465561-T-C 11309885-T-C ***
13475919-A-G 11320243-A-G ***
13488130-C-T 11332454-C-T ***
13650661-T-A 11494985-T-A ***
13664314-T-G 11508638-T-G ***
13681108-C-A,G 11525432-C-A,G ***
13664767-T-A 11509091-T-A ***
13680670-A-G 11524994-A-G ***
13680890-G-A 11525214-G-A ***
13680892-C-A,T 11525216-C-A,T ***
13680898-A-G 11525222-A-G ***
13680899-T-A 11525223-T-A ***
13680906-G-A 11525230-G-A BY88220 ***
13680916-A-T 11525240-A-T ***
13680945-CGAATG-T,TGAAAT 11525269-CGAATG-T,TGAAAT ***
58981921-T-A 56835774-T-A ***
58981961-C-A 56835814-C-A ***
28808707-A-G 26662560-A-G ZS4485 GG346 ***
9952737-T-G 10115128-T-G ***
27904476-CT-C 25758329-CT-C P1_Y2 11×T***
20622519-CA-C 18460633-CA-C P4_Prx 17×A***
9574853-CA-C 9737244-CA-C IR3_Prx 12×A***
7387383-CTTTCTTTCTTCTA-TTTTTTTTTTTTTTT 7519342-CTTTCTTTCTTCTA-TTTTTTTTTTTTTTT ***
22422026-TC-GT 20260140-TC-GT DYZ19 ***
23505519-C-AAA 21343633-C-AAA ***
13143656-AC-GG 10633142-AC-GG ***
9952738-T-C 10115129-T-C ***
9952699-G-A 10115090-G-A ***
13394165-A-ATT 11238489-A-ATT ***
22234368-TC-GA 20072482-TC-GA DYZ19 ***
27824063-G-GT 25677916-G-GT P1_Y2 10×T***
28797882-G-T 26651735-G-T ***
13488961-CCA-GCC 11333285-CCA-GCC ***
22354401-T-C 20192515-T-C DYZ19 ***
10015017-A-G 10177408-A-G ***
58885041-T-C 56705830-A-G ***
22245000-T-A 20083114-T-A DYZ19 ***
13449515-TCC-T 11293839-TCC-T ***
14696023-CAGAAAG-AAAAAAA 12584089-CAGAAAG-AAAAAAA ***
27809543-G-A 25663396-G-A P1_Y2 ***
26117889-TAAC-AAAA 23971742-TAAC-AAAA P1_Y1 ***
25312610-AAG-A 23166463-AAG-A P2_r1 ***
25412653-CT-C 23266506-CT-C P2_r2 16×T***
25415037-C-CT 23268890-C-CT P2_r2 17×T***
25417422-CT-C 23271275-CT-C P2_r2 16×T***
25422190-CT-C 23276043-CT-C P2_r2 16×T***
25426962-A-AT 23280815-A-AT P2_r2 10×T***
25689959-T-TA 23543812-T-TA P1_b3 13×A***
25766541-C-CA 23620394-C-CA P1_b3 16×A***
27033095-C-CT 24886948-C-CT P1_r4 17×T***
22365767-A-T 20203881-A-T DYZ19 ***
27214310-CT-C 25068163-CT-C P1_g3 10×T***
28008036-CA-C 25861889-CA-C P1_Y2 17×A***
28027982-AT-A 25881835-AT-A P1_Y2 17×T***
28360492-TA-T 26214345-TA-T P1_gr2 13×A***
58862488-GCATTC-G 56728358-CAATGG-C 4×CATTC***
58862994-GATTTG-CATTAT 56727872-CAAATC-ATAATG ***
22360387-TC-T 20198501-TC-T DYZ19 ***
22361069-CA-C 20199183-CA-C DYZ19 ***
58820555-G-C 56770316-C-G ***
27809505-C-T 25663358-C-T P1_Y2 ***
20197205-GA-G 18035319-GA-G P5_Dst 14×A***
25289839-G-GT 23143692-G-GT P2_r1 8×T***
9956705-G-C 10119096-G-C ***
28805796-CGT-TGG 26659649-CGT-TGG ***
28802524-C-G 26656377-C-G S835 ***
28802525-G-A 26656378-G-A ***
13461335-T-G 11305659-T-G ***
58995224-G-T 56849077-G-T ***
58887515-C-T 56703356-G-A ***
13740650-CTGG-ATGA 11584974-CTGG-ATGA ***
4841726-A-C 4973685-A-C ***
9956706-A-T 10119097-A-T ***
22501912-T-C 20340026-T-C DYZ19 ***
10014627-T-G 10177018-T-G ***
10014714-A-G 10177105-A-G ***
10014734-A-T 10177125-A-T ***
10048759-A-G 10211150-A-G ***
10048933-A-T 10211324-A-T ***
10048936-A-G 10211327-A-G ***
10048945-T-C 10211336-T-C ***
13287192-A-T 11131516-A-T ***
22236796-TCAAGAGCCTC-GGAACAAACTA 20074910-TCAAGAGCCTC-GGAACAAACTA DYZ19 ***
22356064-G-C 20194178-G-C DYZ19 ***
28147152-GCA-G 26001005-GCA-G P1_b4 13×CA***
13496734-A-G 11341058-A-G ***
13287202-A-G 11131526-A-G ***
18511195-CA-C 16399315-CA-C P6_Dst 30×A***
13437713-C-T 11282037-C-T ***
13445160-G-T 11289484-G-T ***
13253782-A-G 11098106-A-G ***
13733672-C-T 11577996-C-T ***
13725417-T-A 11569741-T-A ***
13725418-C-T 11569742-C-T ***
58838785-A-C 56752086-T-G ***
22226464-A-T 20064578-A-T DYZ19 ***
22344617-G-C 20182731-G-C DYZ19 ***
9345055-C-G 9507446-C-G ***
22344592-A-C 20182706-A-C DYZ19 ***
9952050-T-G 10114441-T-G ***
17994811-G-A 15882931-G-A P7_Prx ***
16136069-AT-A 14024189-AT-A P8_Dst 15×T***
24618868-CT-C 22472721-CT-C P3_t2 12×T***
26873983-C-CT 24727836-C-CT P1_r3 23×T***
27776111-GA-G 25629964-GA-G P1_Y2 9×A***
25301411-GA-G 23155264-GA-G P2_r1 ***
25288412-T-TA 23142265-T-TA P2_r1 17×A***
58981966-C-T 56835819-C-T ***
20206644-T-TA 18044758-T-TA P5_Dst 11×A***
25356955-TA-T 23210808-TA-T P2_r2 10×A***
25652602-CT-C 23506455-CT-C P1_b3 11×T***
27976945-CA-C 25830798-CA-C P1_Y2 12×A***
25207880-T-A 23061733-T-A P2_r1 ***
25207886-T-A 23061739-T-A P2_r1 ***
25207822-C-CAA 23061675-C-CAA P2_r1 51×A***
25491429-CA-C 23345282-CA-C P2_r2 19×A***
13842790-ATCAACCTGAG-A 11722084-ATCAACCTGAG-A ***
28802531-G-A 26656384-G-A ***
9945157-G-C 10107548-G-C ***
13457716-G-GATTCCATTCC 11302040-G-GATTCCATTCC 12×ATTCC***
28797827-G-A 26651680-G-A ***
25207874-G-A 23061727-G-A P2_r1 ***
25441211-ATT-A 23295064-ATT-A P2_r2 22×T***
27809502-T-A 25663355-T-A P1_Y2 ***
13680778-C-A,T 11525102-C-A,T 4×TGGAA***
26730213-G-A 24584066-G-A P1_g2 ***
28149455-G-A 26003308-G-A P1_b4 ***
20141149-CT-C 18029269-CT-C P5_Dst 12×T***
25845104-G-A 23698957-G-A P1_b3 ***
23702223-G-GT 21540337-G-GT 14×T***
27815070-CT-C 25668923-CT-C P1_Y2 10×T***
58981975-AT-A,AC 56835828-AT-A,AC ***
58982800-G-C 56836653-G-C A18570 ***
59004620-G-C 56858473-G-C ***
13702761-A-G 11547085-A-G ***
58844522-T-A 56746349-A-T ***
58844528-G-T 56746343-C-A ***
58885152-C-A 56705719-G-T ***
58885176-T-C 56705695-A-G ***
26953179-G-A 24807032-G-A P1_r3 ***
25207883-G-A 23061736-G-A P2_r1 ***
27785784-TA-T 25639637-TA-T P1_Y2 10×A***
20348763-G-GT 18186877-G-GT P5_Dst 9×T***
20989908-CT-C 18828022-CT-C P4_Dst 11×T***
27739907-GA-G 25593760-GA-G P1_Y2 10×A***
13203964-G-T 11048288-G-T ***
20949941-T-C 18788055-T-C P4_Dst ***
20949945-T-C 18788059-T-C P4_Dst ***
20949946-G-A 18788060-G-A P4_Dst ***
20949951-T-TG 18788065-T-TG P4_Dst ***
25461433-C-T 23315286-C-T P2_r2 26×T***
13203979-C-T 11048303-C-T ***
25272972-G-GA 23126825-G-GA P2_r1 19×A***
20255094-TA-T 18093208-TA-T P5_Dst 20×A***
28253578-C-T 26107431-C-T P1_b4 ***
58984308-CTG-TTA 56838161-CTG-TTA ***
19052438-AG-A 16940558-AG-A ***
13842630-CC-AT 11721924-CC-AT ***
13521662-AG-CA 11365986-AG-CA ***
13801031-TAGTAATAGAATGGAG-ATCAGTTGGAGTAGAA 11680325-TAGTAATAGAATGGAG-ATCAGTTGGAGTAGAA ***
13801053-TGGATAGAACGG-GGAATGGAGATT 11680347-TGGATAGAACGG-GGAATGGAGATT ***
18984946-CTTTC-TTTTT 16873066-CTTTC-TTTTT ***
20954340-CA-C 18792454-CA-C P4_Dst 23×A***
27080501-A-T 24934354-A-T P1_r4 ***
20991160-AT-A 18829274-AT-A P4_Dst 18×T***
20993598-CA-C 18831712-CA-C P4_Dst 17×A***
22256872-ATGAAGC-TGTTATG 20094986-ATGAAGC-TGTTATG DYZ19 ***
22358173-TTTCG-GTTCA 20196287-TTTCG-GTTCA DYZ19 ***
22503218-TC-T 20341332-TC-T DYZ19 ***
24035198-T-TA 21889051-T-TA 14×A***
24582352-CT-C 22436205-CT-C P3_t2 17×T***
24760000-T-TTA 22613853-T-TTA P3_b2 11×TA***
28253572-G-A 26107425-G-A P1_b4 ***
26902359-G-A 24756212-G-A P1_r3 ***
13203978-C-G 11048302-C-G ***
9304875-A-G 9467266-A-G ***
13203975-C-A 11048299-C-A ***
13203973-C-T 11048297-C-T ***
13203974-C-G 11048298-C-G ***
13203971-C-A 11048295-C-A ***
9956763-T-A 10119154-T-A ***
13523585-T-G 11367909-T-G ***
9215993-A-G 9378384-A-G ***
9304872-A-G 9467263-A-G ***
9311499-T-G 9473890-T-G ***
25312613-T-A 23166466-T-A P2_r1 ***
9325208-C-G 9487599-C-G ***
9956771-T-C 10119162-T-C ***
13203958-C-T 11048282-C-T ***
13203959-A-G 11048283-A-G ***
13203960-T-A 11048284-T-A ***
13203963-T-A 11048287-T-A ***
13275918-C-T 11120242-C-T ***
20886850-G-A 18724964-G-A P4_Dst ***
24895723-G-T 22749576-G-T g1 ***
28811311-C-T 26665164-C-T BY27896 ***
28807630-T-C 26661483-T-C BY27886 ***
13329172-A-G 11173496-A-G ***
28799890-C-G 26653743-C-G ***
28799810-GTGGCA-G 26653663-GTGGCA-G ***
28799816-T-A 26653669-T-A ***
28799832-G-A 26653685-G-A ***
28799835-T-G 26653688-T-G ***
28799840-G-T 26653693-G-T BY151603 ***
28799843-G-T 26653696-G-T ***
28799851-T-A 26653704-T-A ***
28799853-G-T 26653706-G-T ***
28799895-C-G 26653748-C-G 5×TGGAA***
28788080-G-A 26641933-G-A ***
28805236-ATGGAATGGAATGGAAT-A 26659089-ATGGAATGGAATGGAAT-A ***
28811220-A-G 26665073-A-G ***
58981055-A-T 56834908-A-T ***
58981063-A-C 56834916-A-C ***
58981065-T-A 56834918-T-A ***
58981075-T-A 56834928-T-A ***
13819959-TGAATG-G,T 11699253-TGAATG-G,T 14×GAATG***
20645840-TTTC-T 18483954-TTTC-T P4_Prx ***
28793368-A-G 26647221-A-G ***
28787264-GAATGGAATTC-G 26641117-GAATGGAATTC-G ***
13143780-CACTGCACTGCACATCACTCT-C 10633266-CACTGCACTGCACATCACTCT-C ******
13851486-T-G 11730780-T-G ***
13842227-A-C 11721521-A-C ***
13842277-A-G 11721571-A-G ***
13846297-T-A,C 11725591-T-A,C ***
13847328-A-G 11726622-A-G ***
13850326-G-C 11729620-G-C ***
13850366-G-A 11729660-G-A ***
13851460-T-A 11730754-T-A ***
13851476-A-G 11730770-A-G ***
13859324-A-G 11738618-A-G ***
28785627-A-G,T 26639480-A-G,T ***
13859467-A-G 11738761-A-G ***
13859479-C-G 11738773-C-G ***
22243099-T-A 20081213-T-A DYZ19 ***
28785521-A-G 26639374-A-G ***
28785524-A-C 26639377-A-C ***
28785536-G-T 26639389-G-T ***
28785541-A-G 26639394-A-G ***
28785543-A-C 26639396-A-C ***
28785586-G-T 26639439-G-T ***
27809465-T-C 25663318-T-C P1_Y2 ***
13194842-A-T 11039166-A-T ***
13832984-C-A 11712278-C-A ***
13689189-A-T 11533513-A-T ***
13869965-G-C 11749259-G-C ***
13869999-T-A 11749293-T-A ***
13870003-C-A 11749297-C-A ***
13870053-T-C 11749347-T-C ***
13870055-G-C 11749349-G-C ***
13870131-A-G 11749425-A-G ***
13870141-C-G 11749435-C-G S15185 ***
58976247-C-T 56830100-C-T ***
13805179-A-C 11684473-A-C ***
13865605-T-G 11744899-T-G ***
13838257-G-A 11717551-G-A FT228786 ***
27134986-GA-G 24988839-GA-G P1_g3 11×A***
58819373-C-G 56771498-G-C ***
13842115-G-A 11721409-G-A FT236411 ***
13459696-T-A 11304020-T-A ***
13805184-C-A 11684478-C-A ***
13857586-G-A 11736880-G-A ***
20096628-AT-A 17984748-AT-A P5_Dst 13×T***
13868869-C-T 11748163-C-T BY91721 ***
13859442-A-G 11738736-A-G ***
13452653-C-T 11296977-C-T ***
13459383-T-C 11303707-T-C ***
13693927-GCTATCGAATA-G 11538251-GCTATCGAATA-G ***
13850411-C-G 11729705-C-G ***
13870125-A-G 11749419-A-G ***
58865997-A-C 56724874-T-G ***
58977633-T-C 56831486-T-C ***
58981926-T-C 56835779-T-C ***
28132475-C-CT 25986328-C-CT P1_b4 15×T***
13447706-T-C 11292030-T-C ***
13459393-T-C 11303717-T-C ***
13850450-A-T 11729744-A-T ***
13689194-C-T 11533518-C-T ***
13801484-A-G 11680778-A-G ***
13801702-A-C 11680996-A-C ***
13818670-A-G 11697964-A-G ***
13818672-G-C 11697966-G-C ***
13832413-C-G 11711707-C-G ***
13850409-C-A 11729703-C-A ***
13850425-A-T 11729719-A-T ***
13850431-T-G 11729725-T-G BY40268 ***
13838244-A-G 11717538-A-G ***
13832535-A-G 11711829-A-G ***
28043512-GA-G 25897365-GA-G P1_Y2 10×A***
13858460-T-G 11737754-T-G ***
13830135-C-G 11709429-C-G ***
13830162-G-A 11709456-G-A ***
13833826-A-G 11713120-A-G ***
13839010-C-G 11718304-C-G ***
13846284-C-G 11725578-C-G ***
13846725-A-G 11726019-A-G ***
13851475-C-T 11730769-C-T ***
13856417-C-G 11735711-C-G ***
13860240-G-A 11739534-G-A FT328823 ***
13824094-G-A 11703388-G-A Y23138 ***
58976237-C-T 56830090-C-T ***
13461115-T-C 11305439-T-C ***
13680870-G-C 11525194-G-C ***
13843864-T-G 11723158-T-G ***
13843879-C-G 11723173-C-G ***
13856409-T-A 11735703-T-A ***
13856432-C-G 11735726-C-G ***
24015843-CTCT-C 21869696-CTCT-C 5×TCT***
13824952-A-T 11704246-A-T ***
13823239-G-A 11702533-G-A ***
13456344-C-A 11300668-C-A ***
13843764-G-C 11723058-G-C ***
13813392-C-G 11692686-C-G ***
13813395-G-T 11692689-G-T ***
13846552-A-T 11725846-A-T ***
13867932-A-G 11747226-A-G ***
28787565-G-A 26641418-G-A ***
13688450-A-T 11532774-A-T ***
28793613-T-C 26647466-T-C ***
13664626-G-A 11508950-G-A ***
25860053-CT-C 23713906-CT-C P1_Y1 11×T***
13813203-G-A 11692497-G-A ***
58820795-C-CCATTCCATTCGATTG 56770048-T-TTCGAATGGAATGCAA ***
13142008-C-T 10631494-C-T ***
13455365-T-A 11299689-T-A ***
13459689-T-C 11304013-T-C ***
13459691-T-A 11304015-T-A ***
13459699-G-C 11304023-G-C ***
13680688-A-G 11525012-A-G ***
13680689-T-A 11525013-T-A ***
13810068-C-G 11689362-C-G ***
13869404-C-G 11748698-C-G 9×GAATG***
13457891-A-C 11302215-A-C ***
13832530-A-G 11711824-A-G ***
13680904-T-C 11525228-T-C ***
13680673-A-G 11524997-A-G ***
13680679-T-G 11525003-T-G ***
13680694-A-T 11525018-A-T ***
13680695-G-C 11525019-G-C ***
13680696-G-A 11525020-G-A BY88211 ***
13680701-A-G 11525025-A-G ***
13680705-A-G 11525029-A-G ***
13680889-T-C 11525213-T-C ***
13729952-GTGGAATCAAGTGGAA-G 11574276-GTGGAATCAAGTGGAA-G ***
13677944-A-G 11522268-A-G ***
13803092-C-G 11682386-C-G 5×GAATG***
13803117-GGAATT-G,GCAATT 11682411-GGAATT-G,GCAATT ***
13805217-A-G 11684511-A-G ***
13805505-C-T 11684799-C-T ***
13812971-A-G 11692265-A-G BY25797 ***
13817517-C-G 11696811-C-G ***
13818637-C-G 11697931-C-G ***
13818641-C-T 11697935-C-T ***
13677949-A-G 11522273-A-G ***
13664768-T-G 11509092-T-G ***
13458212-T-A 11302536-T-A ***
13669533-AATGGT-A 11513857-AATGGT-A ***
13459373-T-C 11303697-T-C ***
13731468-T-A 11575792-T-A ***
13801218-G-A 11680512-G-A ***
13824962-A-T 11704256-A-T ***
22256898-T-G 20095012-T-G DYZ19 ***
22488513-TG-T 20326627-TG-T DYZ19 ***
28784321-C-G 26638174-C-G ***
28784713-G-A 26638566-G-A ***
20084494-C-T 17972614-C-T P5_Dst ***
13467150-G-A 11311474-G-A ***
13842085-T-A 11721379-T-A ***
28785575-A-T 26639428-A-T ***
13137442-G-C 10626928-G-C ***
13138746-G-C 10628232-G-C 4×ACTCC***
13138813-T-C 10628299-T-C ***
13138833-T-C 10628319-T-C ***
13446960-A-C 11291284-A-C ***
13459208-T-C 11303532-T-C ***
13464328-G-C 11308652-G-C ***
20197604-C-CT 18035718-C-CT P5_Dst 11×T***
59004617-A-G 56858470-A-G ***
21009205-CAT-C 18847319-CAT-C P4_Dst 9×AT***
13850310-T-A 11729604-T-A ***
13817666-A-T 11696960-A-T ***
13817669-G-A 11696963-G-A ***
13818275-C-A 11697569-C-A ***
13833811-C-G 11713105-C-G ***
13842096-C-T 11721390-C-T ***
13846185-A-G 11725479-A-G ***
13848362-A-G 11727656-A-G ***
13848363-T-G 11727657-T-G ***
13854607-T-G 11733901-T-G FT98013 ***
13817660-T-C 11696954-T-C ***
13855200-A-T 11734494-A-T ***
13856427-C-G 11735721-C-G ***
13858121-G-A 11737415-G-A ***
13858128-A-T 11737422-A-T ***
13870161-C-G 11749455-C-G ***
22269590-C-G 20107704-C-G DYZ19 ***
28786069-C-T 26639922-C-T ***
28787490-A-G 26641343-A-G ***
13817662-C-G 11696956-C-G ***
13817648-G-A 11696942-G-A ***
28787532-T-A 26641385-T-A ***
24232093-C-CA 22085946-C-CA P3_b1 21×A***
58981931-C-G 56835784-C-G ***
58981936-T-C 56835789-T-C ***
58981941-T-C 56835794-T-C ***
58981951-T-A 56835804-T-A ***
26990078-T-TA 24843931-T-TA P1_r4 11×A***
27147441-AT-A 25001294-AT-A P1_g3 12×T***
27808854-TA-T 25662707-TA-T P1_Y2 10×A***
22258592-C-T 20096706-C-T BY20912 DYZ19 ***
10037325-G-C 10199716-G-C ***
13817646-T-A 11696940-T-A ***
13194783-A-T 11039107-A-T ***
13838607-A-G 11717901-A-G ***
13142091-A-C 10631577-A-C ***
13454727-T-C 11299051-T-C ***
13461325-C-A 11305649-C-A ***
13658958-G-A 11503282-G-A FGC40602 ***
13739663-G-C 11583987-G-C ***
13817638-G-C 11696932-G-C ***
13817640-A-G 11696934-A-G ***
28787515-A-G 26641368-A-G ***
28787540-G-T 26641393-G-T ***
58981084-A-C 56834937-A-C ***
58873382-G-A 56717489-C-T ***
13870050-G-T 11749344-G-T FT328890 ***
13870110-GA-G 11749404-GA-G ***
13870128-A-C 11749422-A-C ***
13870134-T-A 11749428-T-A ***
13870143-A-C 11749437-A-C ***
22421068-T-G 20259182-T-G DYZ19 ***
27864383-CTT-C 25718236-CTT-C P1_Y2 22×T***
28798928-C-T 26652781-C-T FGC68604 ***
58977130-G-A,GCTCTA 56830983-G-A,GCTCTA ***
13870005-C-A 11749299-C-A ***
58981087-T-C 56834940-T-C ***
9540686-CA-C 9703077-CA-C IR3_Prx 9×A***
20084142-TAG-T 17972262-TAG-T P5_Dst 13×AG***
22239331-A-G 20077445-A-G DYZ19 ***
22421018-G-T 20259132-G-T DYZ19 ***
22505199-T-G 20343313-T-G DYZ19 ***
27062945-GGTA-G 24916798-GGTA-G P1_r4 11×GTA***
13830085-A-G 11709379-A-G ***
13870029-C-A 11749323-C-A BY156382 ***
13817507-A-G 11696801-A-G ***
28798965-A-G 26652818-A-G ***
13467034-T-G 11311358-T-G ***
58972530-G-C 56826383-G-C ***
58976780-C-T 56830633-C-T ***
58976784-T-C 56830637-T-C ***
58983214-C-A 56837067-C-A ***
13140566-C-T 10630052-C-T ***
13194037-T-C 11038361-T-C ***
13194045-T-C 11038369-T-C ***
13446908-T-C 11291232-T-C ***
13680672-T-A 11524996-T-A 4×ATGGA***
13450014-C-A 11294338-C-A ***
13833684-A-G 11712978-A-G ***
13838224-A-C 11717518-A-C ***
28801003-A-G 26654856-A-G ***
58983155-C-T 56837008-C-T ***
22244999-T-A 20083113-T-A DYZ19 ***
13458046-A-C 11302370-A-C ***
13735162-A-G 11579486-A-G 4×AATGG***
13824095-A-T 11703389-A-T Y23139 ***
28811215-T-G 26665068-T-G ***
58981088-G-C 56834941-G-C ***
58981078-G-C 56834931-G-C ***
13454718-T-A 11299042-T-A ***
13868751-G-A 11748045-G-A ***
58844543-G-T 56746328-C-A ***
58844546-T-C 56746325-A-G FGC44146 FGC77541 ***
9943805-T-C 10106196-T-C ***
13713707-A-G 11558031-A-G ***
13817183-T-G 11696477-T-G FT29516 ***
13854096-A-T 11733390-A-T ***
13854097-C-G 11733391-C-G ***
13854098-A-C 11733392-A-C ***
28253529-G-A 26107382-G-A P1_b4 ***
28801033-C-G 26654886-C-G ***
13140342-A-T 10629828-A-T ***
13140408-T-C 10629894-T-C ***
13143909-G-C 10633395-G-C ***
13452550-G-C 11296874-G-C ***
13669442-T-G 11513766-T-G ***
13669460-A-T 11513784-A-T ***
13703586-G-C 11547910-G-C ***
13703588-A-G 11547912-A-G ***
28801038-T-G 26654891-T-G ***
28798972-G-A 26652825-G-A ***
13703626-G-T 11547950-G-T ***
13654369-GGCTCA-G 11498693-GGCTCA-G ***
13654364-T-G 11498688-T-G ***
13810110-G-A 11689404-G-A 5×ATGGA***
13832520-A-G 11711814-A-G ***
13138460-C-T 10627946-C-T ***
13809751-A-C 11689045-A-C ***
13813479-T-C 11692773-T-C ***
13454351-G-C 11298675-G-C ***
13654358-A-G 11498682-A-G ***
13801709-A-G 11681003-A-G ***
28798967-G-A 26652820-G-A ***
13805210-T-C 11684504-T-C ***
13817515-C-A 11696809-C-A ***
13817643-A-G 11696937-A-G ***
13824523-TATGGAATTGATTCAA-T 11703817-TATGGAATTGATTCAA-T ***
13828038-T-A 11707332-T-A ***
13830109-T-G 11709403-T-G ***
13830113-C-T 11709407-C-T ***
13862305-A-G 11741599-A-G ***
22341523-C-G 20179637-C-G DYZ19 ***
13703596-G-A 11547920-G-A ***
13703629-T-A 11547953-T-A ***
58978281-T-A 56832134-T-A ***
28800342-A-G 26654195-A-G ***
13867731-T-G 11747025-T-G ***
13870130-C-G 11749424-C-G ***
22446803-T-C 20284917-T-C DYZ19 ***
28785528-A-C 26639381-A-C ***
28787520-G-A 26641373-G-A ***
28788098-C-G 26641951-C-G ***
28799118-A-G 26652971-A-G ***
28799131-A-G 26652984-A-G ***
28804258-T-C 26658111-T-C KMS171 ***
13857571-G-T 11736865-G-T ***
28808660-A-G 26662513-A-G ***
28811401-C-T 26665254-C-T BY2568 ***
28811403-A-G 26665256-A-G ***
28811407-G-A 26665260-G-A ***
28811410-G-T 26665263-G-T ***
28811413-T-C 26665266-T-C ***
28811419-C-A 26665272-C-A BY45277 ***
58976348-C-T 56830201-C-T ***
58976349-A-C 56830202-A-C ***
13861686-A-T 11740980-A-T ***
13851287-G-T 11730581-G-T BY91421 ***
13703636-G-C 11547960-G-C ***
13805211-G-A 11684505-G-A ***
13703637-G-T 11547961-G-T ***
13703646-G-A 11547970-G-A ***
13703649-C-A 11547973-C-A ***
13703650-C-T 11547974-C-T A15804 ***
13703652-T-A 11547976-T-A ***
13703666-G-C 11547990-G-C ***
13703671-T-G 11547995-T-G ***
13703680-A-T 11548004-A-T ***
13818857-C-G 11698151-C-G ***
13851124-A-G 11730418-A-G ***
13828028-G-A 11707322-G-A ***
13832411-C-A 11711705-C-A ***
13833525-A-C 11712819-A-C ***
13833535-T-A 11712829-T-A ***
13833698-G-A 11712992-G-A ***
13838977-C-A 11718271-C-A ***
13846582-A-T 11725876-A-T ***
13846596-A-C 11725890-A-C ***
13851121-G-A 11730415-G-A ***
13287288-A-T 11131612-A-T ***
13433088-TAA-T 11277412-TAA-T ***
13725419-T-C 11569743-T-C ***
9344798-G-A 9507189-G-A ***
9344789-C-T 9507180-C-T ***
9344790-A-C 9507181-A-C ***
9344792-C-A 9507183-C-A ***
9344793-A-T 9507184-A-T ***
9344794-A-C 9507185-A-C ***
9344795-C-T 9507186-C-T ***
9344796-C-A 9507187-C-A ***
9344797-A-T 9507188-A-T ***
9344801-A-C 9507192-A-C ***
9344787-C-G 9507178-C-G ***
9344802-G-T 9507193-G-T ***
9344803-A-C 9507194-A-C ***
9344804-G-A 9507195-G-A ***
9344806-T-A 9507197-T-A ***
9344807-C-T 9507198-C-T ***
9344808-T-G 9507199-T-G ***
9344809-C-T 9507200-C-T ***
9344810-T-G 9507201-T-G ***
9344788-C-T 9507179-C-T ***
9344786-C-T 9507177-C-T ***
9344813-A-C 9507204-A-C ***
9304881-A-C 9467272-A-C ***
9296016-T-C 9458407-T-C ***
9296020-A-G 9458411-A-G ***
9296030-C-T 9458421-C-T ***
9296031-A-G 9458422-A-G ***
9296032-G-T 9458423-G-T ***
9296033-A-G 9458424-A-G ***
9296035-T-C 9458426-T-C ***
9298915-A-C 9461306-A-C ***
9304887-C-G 9467278-C-G ***
9344785-G-A 9507176-G-A ***
9325218-A-G 9487609-A-G ***
9325220-A-C 9487611-A-C ***
9336340-A-G 9498731-A-G ***
9344778-C-T 9507169-C-T ***
9344779-G-C 9507170-G-C ***
9344781-C-A 9507172-C-A ***
9344782-C-G 9507173-C-G ***
9344783-T-G 9507174-T-G ***
9344784-A-G 9507175-A-G ***
9344811-G-T 9507202-G-T ***
9344814-T-A 9507205-T-A ***
9296013-G-T 9458404-G-T ***
9345525-C-G 9507916-C-G ***
9345505-A-C 9507896-A-C ***
9345506-G-A 9507897-G-A ***
9345508-C-G 9507899-C-G ***
9345510-G-C 9507901-G-C ***
9345512-G-T 9507903-G-T ***
9345513-C-G 9507904-C-G ***
9345516-G-T 9507907-G-T ***
9345521-T-C 9507912-T-C ***
9345531-A-G 9507922-A-G ***
9344845-G-C 9507236-G-C ***
9365316-A-G 9527707-A-G ***
9365337-A-G 9527728-A-G ***
9365346-C-G 9527737-C-G ***
9365790-C-G 9528181-C-G ***
9384549-C-G 9546940-C-G ***
9384551-A-G 9546942-A-G ***
9529047-C-G 9691438-C-G ***
9540319-C-A 9702710-C-A IR3_Prx ***
9345022-A-G 9507413-A-G ***
9344844-G-C 9507235-G-C ***
9344815-C-A 9507206-C-A ***
9344828-T-C 9507219-T-C ***
9344816-T-C 9507207-T-C ***
9344817-G-A 9507208-G-A ***
9344819-T-C 9507210-T-C ***
9344820-G-C 9507211-G-C ***
9344821-T-A 9507212-T-A ***
9344822-A-C 9507213-A-C ***
9344826-C-T 9507217-C-T ***
9344827-C-T 9507218-C-T ***
9344831-G-T 9507222-G-T ***
9344842-C-T 9507233-C-T ***
9344832-T-C 9507223-T-C ***
9344833-A-C 9507224-A-C ***
9344834-C-A 9507225-C-A ***
9344835-C-A 9507226-C-A ***
9344836-A-T 9507227-A-T ***
9344837-T-A 9507228-T-A ***
9344839-T-A 9507230-T-A ***
9344840-A-T 9507231-A-T ***
9344841-C-T 9507232-C-T ***
9296015-A-G 9458406-A-G ***
9296012-T-G 9458403-T-G ***
9615410-C-T 9777801-C-T IR3_Prx ***
7310543-C-A 7442502-C-A ***
6709332-C-A 6841291-C-A ***
6901284-A-G 7033243-A-G ***
6903588-C-A 7035547-C-A ***
6977442-C-A 7109401-C-A ***
7127413-C-A 7259372-C-A ***
7149453-G-A 7281412-G-A ***
7199423-C-A 7331382-C-A ***
7303498-G-A 7435457-G-A ***
7312633-G-A 7444592-G-A ***
6648166-G-T 6780125-G-T ***
7313384-C-A 7445343-C-A ***
7320375-G-A 7452334-G-A ***
7321848-C-A 7453807-C-A ***
7338459-A-G 7470418-A-G ***
7362171-C-A 7494130-C-A ***
7371972-C-A 7503931-C-A ***
7414129-T-A 7546088-T-A ***
7473196-T-C 7605155-T-C IR1_L ***
6648538-C-A 6780497-C-A ***
6593504-C-A 6725463-C-A ***
7886240-C-T 8018199-C-T ***
6146508-T-A 6278467-T-A IR3_Dst ***
5293993-T-C 5425952-T-C ***
5774865-A-G 5906824-A-G ***
5860975-C-A 5992934-C-A ***
5937209-T-C 6069168-T-C ***
5937210-C-A 6069169-C-A ***
6134445-C-G 6266404-C-G ***
6134448-A-G 6266407-A-G ***
6140561-A-T 6272520-A-T IR3_Dst ***
6148266-T-G 6280225-T-G IR3_Dst ***
6592372-C-A 6724331-C-A ***
6149780-G-T 6281739-G-T IR3_Dst ***
6232708-C-A 6364667-C-A IR3_Dst ***
6258554-G-T 6390513-G-T IR3_Dst ***
6280379-C-A 6412338-C-A IR3_Dst ***
6341165-C-T 6473124-C-T IR3_Dst ***
6377005-C-A 6508964-C-A ***
6377072-C-A 6509031-C-A ***
6382210-C-T 6514169-C-T ***
6398215-C-A 6530174-C-A ***
7753232-C-A 7885191-C-A ***
8085601-T-C 8217560-T-C ***
9296011-T-G 9458402-T-G ***
9216151-G-C 9378542-G-C ***
9013235-G-C 9175626-G-C ***
9025409-C-A 9187800-C-A ***
9063520-C-A 9225911-C-A ***
9127497-G-T 9289888-G-T ***
9186041-T-G 9348432-T-G ***
9216018-T-C 9378409-T-C ***
9216110-G-C 9378501-G-C ***
9216150-C-G 9378541-C-G ***
9217171-A-G 9379562-A-G ***
8786800-T-G 8918759-T-G ***
9224946-A-C 9387337-A-C ***
9230363-A-C 9392754-A-C ***
9236257-A-G 9398648-A-G ***
9295048-T-C 9457439-T-C ***
9296005-C-G 9458396-C-G ***
9296006-A-G 9458397-A-G ***
9296007-G-C 9458398-G-C ***
9296008-A-G 9458399-A-G ***
8856145-C-A 8988104-C-A ***
8786789-C-A 8918748-C-A ***
8181216-G-A 8313175-G-A ***
8181288-C-G 8313247-C-G ***
8181259-G-T 8313218-G-T ***
8181260-A-T 8313219-A-T ***
8181262-C-T 8313221-C-T ***
8181267-C-A 8313226-C-A ***
8181268-T-C 8313227-T-C ***
8181273-G-C 8313232-G-C ***
8181279-T-C 8313238-T-C ***
8181282-G-C 8313241-G-C ***
8181295-A-C 8313254-A-C ***
8786781-T-A 8918740-T-A ***
8293355-C-A 8425314-C-A ***
8408450-A-T 8540409-A-T ***
8732304-G-T 8864263-G-T ***
8739045-G-C 8871004-G-C ***
8739046-T-C 8871005-T-C ***
8739078-C-G 8871037-C-G FT174575 ***
8739084-A-C 8871043-A-C ***
8739092-A-G 8871051-A-G ***
8786771-A-C 8918730-A-C ***
9583288-T-C 9745679-T-C IR3_Prx ***
9626973-A-T 9789364-A-T IR3_Prx ***
5267517-T-A 5399476-T-A ***
13460518-C-A 11304842-C-A ***
13372140-A-C 11216464-A-C ***
13372148-A-G 11216472-A-G ***
13394921-T-C 11239245-T-C ***
13394925-T-A 11239249-T-A ***
13394929-A-T 11239253-A-T ***
13394932-G-T 11239256-G-T ***
13446389-C-T 11290713-C-T ***
13446392-T-G 11290716-T-G ***
13460522-A-G 11304846-A-G ***
13331681-C-A 11176005-C-A ***
13460524-G-C 11304848-G-C ***
13460526-A-G 11304850-A-G ***
13460535-C-A 11304859-C-A ***
13460538-G-A 11304862-G-A ***
13460539-A-G 11304863-A-G ***
13460727-C-G 11305051-C-G ***
13460731-T-A 11305055-T-A ***
13460748-T-A 11305072-T-A ***
13372126-A-C 11216450-A-C ***
13329524-G-T 11173848-G-T ***
13460762-A-T 11305086-A-T ***
13203907-T-A 11048231-T-A ***
13143257-A-C 10632743-A-C ***
13143480-A-C 10632966-A-C ***
13143491-G-T 10632977-G-T ***
13143952-T-C 10633438-T-C ***
13193955-G-C 11038279-G-C ***
13193956-A-T 11038280-A-T ***
13193957-T-C 11038281-T-C ***
13193984-T-G 11038308-T-G ***
13203908-C-T 11048232-C-T ***
13329192-A-G 11173516-A-G ***
13203910-C-A 11048234-C-A ***
13203911-G-T 11048235-G-T ***
13227907-C-A 11072231-C-A ***
13236129-A-T 11080453-A-T ***
13252868-C-T 11097192-C-T ***
13253199-G-T 11097523-G-T 14×T***
13316695-G-A 11161019-G-A ***
13326153-C-T 11170477-C-T 12×T***
13326154-T-C 11170478-T-C ***
13460760-T-A 11305084-T-A ***
13460783-G-A 11305107-G-A ***
13140080-G-C 10629566-G-C ***
13725399-C-G 11569723-C-G ***
13720891-A-T 11565215-A-T ***
13720907-A-G 11565231-A-G ***
13720933-A-C 11565257-A-C ***
13725393-A-T 11569717-A-T ***
13813390-A-T 11692684-A-T ***
13725395-A-T 11569719-A-T ***
13725396-G-A 11569720-G-A ***
13725398-A-T 11569722-A-T ***
13725401-G-A 11569725-G-A ***
13720887-G-A 11565211-G-A ***
13725403-A-T 11569727-A-T ***
13725404-T-G 11569728-T-G ***
13725406-G-A 11569730-G-A FGC68622 ***
13725410-G-A 11569734-G-A ***
13725411-G-A 11569735-G-A ***
13725413-A-T 11569737-A-T ***
13725414-A-G 11569738-A-G ***
13725416-G-A 11569740-G-A ***
13720890-C-A 11565214-C-A ***
13720883-G-A 11565207-G-A ***
13460907-A-T 11305231-A-T ***
13552588-T-G 11396912-T-G ***
13460908-T-C 11305232-T-C ***
13461342-G-A 11305666-G-A ***
13489194-G-A 11333518-G-A ***
13496731-G-C 11341055-G-C ***
13523596-C-A 11367920-C-A ***
13523597-T-G 11367921-T-G ***
13524079-G-T 11368403-G-T ***
13543294-A-G 11387618-A-G ***
13571646-A-C 11415970-A-C ***
13703383-G-A 11547707-G-A ***
13585082-G-A 11429406-G-A ***
13597057-C-A 11441381-C-A ***
13689950-G-A 11534274-G-A ***
13692481-A-C 11536805-A-C ***
13692482-G-T 11536806-G-T ***
13692483-T-G 11536807-T-G ***
13702759-G-A 11547083-G-A ***
13703376-G-C 11547700-G-C ***
13703377-T-A 11547701-T-A ***
13140082-G-A 10629568-G-A ***
13140073-C-T 10629559-C-T ***
9628537-G-T 9790928-G-T IR3_Prx ***
9951026-A-G 10113417-A-G ***
9930205-G-C 10092596-G-C ***
9930208-A-T 10092599-A-T ***
9930209-G-A 10092600-G-A ***
9930210-C-A 10092601-C-A ***
9942180-C-G 10104571-C-G ***
9945001-C-A 10107392-C-A ***
9950937-T-A 10113328-T-A ***
9950938-A-C 10113329-A-C ***
9951042-G-A 10113433-G-A ***
9930202-C-G 10092593-C-G ***
9952707-G-A 10115098-G-A ***
9952711-C-G 10115102-C-G ***
9952723-C-T 10115114-C-T ***
9952735-A-G 10115126-A-G ***
9956533-C-A 10118924-C-A ***
9957834-T-C 10120225-T-C ***
9962287-A-G 10124678-A-G ***
9990104-G-T 10152495-G-T ***
9930203-C-A 10092594-C-A ***
9930201-T-A 10092592-T-A ***
10014749-A-T 10177140-A-T ***
9799324-C-A 9961715-C-A ***
9636564-G-T 9798955-G-T IR3_Prx ***
9637196-C-T 9799587-C-T IR3_Prx ***
9689956-G-T 9852347-G-T IR3_Prx ***
9706039-C-A 9868430-C-A IR3_Prx ***
9706166-A-C 9868557-A-C IR3_Prx ***
9706175-A-C 9868566-A-C IR3_Prx ***
9725007-C-T 9887398-C-T IR3_Prx ***
9725048-T-G 9887439-T-G IR3_Prx ***
9930171-G-T 10092562-G-T FT361790 ***
9930199-A-G 10092590-A-G ***
9930186-A-T 10092577-A-T ***
9930188-A-C 10092579-A-C ***
9930189-A-C 10092580-A-C ***
9930191-T-G 10092582-T-G ***
9930193-C-G 10092584-C-G ***
9930195-T-G 10092586-T-G ***
9930196-G-T 10092587-G-T ***
9930197-G-C 10092588-G-C ***
9930198-G-C 10092589-G-C ***
10014738-T-C 10177129-T-C ***
10014761-G-A 10177152-G-A ***
13140070-A-C 10629556-A-C ***
10086325-T-A 10248716-T-A ***
10068261-A-T 10230652-A-T ***
10068265-T-G 10230656-T-G ***
10068281-G-A 10230672-G-A ***
10068286-C-T 10230677-C-T ***
10068325-G-T 10230716-G-T ***
10068327-G-C 10230718-G-C ***
10068852-G-A 10231243-G-A ***
10068876-T-A 10231267-T-A A3766 ***
10086348-A-G 10248739-A-G ***
10068247-G-A 10230638-G-A ***
10102744-C-G 10265135-C-G ***
10102910-T-C 10265301-T-C ***
13109159-C-T 10598645-C-T ***
13120598-A-C 10610084-A-C ***
13140055-A-C 10629541-A-C ***
13140060-A-C 10629546-A-C ***
13140065-A-C 10629551-A-C ***
13140067-T-A 10629553-T-A ***
10068251-T-A 10230642-T-A ***
10068239-T-G 10230630-T-G ***
10015013-A-G 10177404-A-G ***
10015030-T-C 10177421-T-C ***
10015015-A-G 10177406-A-G ***
10015016-C-G 10177407-C-G ***
10015019-A-C 10177410-A-C ***
10015021-T-C 10177412-T-C ***
10015022-C-T 10177413-C-T ***
10015023-T-C 10177414-T-C ***
10015025-A-C 10177416-A-C ***
10015028-C-T 10177419-C-T ***
10015033-G-T 10177424-G-T ***
10068232-T-A 10230623-T-A ***
10015037-A-C 10177428-A-C ***
10018264-C-A 10180655-C-A ***
10025236-C-A 10187627-C-A ***
10033210-G-A 10195601-G-A ***
10048793-A-G 10211184-A-G ***
10048797-T-G 10211188-T-G ***
10048924-T-G 10211315-T-G ***
10048931-T-C 10211322-T-C ***
10068221-G-C 10230612-G-C ***
5274773-C-A 5406732-C-A ***
5267513-T-A 5399472-T-A ***
13543271-A-C 11387595-A-C ***
28253584-C-A 26107437-C-A P1_b4 ***
27585905-A-T 25439758-A-T P1_Y2 ***
28253528-T-A 26107381-T-A P1_b4 ***
28253532-G-A 26107385-G-A P1_b4 ***
28253545-G-A 26107398-G-A P1_b4 ***
28253548-C-A 26107401-C-A P1_b4 ***
28253580-T-A 26107433-T-A P1_b4 ***
28253581-T-A 26107434-T-A P1_b4 ***
28253583-C-A 26107436-C-A P1_b4 ***
28253586-C-A 26107439-C-A P1_b4 ***
26991377-G-A 24845230-G-A P1_r4 ***
28253587-C-A 26107440-C-A P1_b4 ***
28253588-T-A 26107441-T-A P1_b4 ***
28253589-C-A 26107442-C-A P1_b4 ***
28253592-C-A 26107445-C-A P1_b4 ***
28253593-C-A 26107446-C-A P1_b4 ***
28253594-T-A 26107447-T-A P1_b4 ***
28253595-G-A 26107448-G-A P1_b4 ***
28253597-T-A 26107450-T-A P1_b4 ***
27585891-A-T 25439744-A-T P1_Y2 ***
26991375-G-A 24845228-G-A P1_r4 ***
28253601-C-A 26107454-C-A P1_b4 ***
25845055-C-A 23698908-C-A P1_b3 ***
22358798-T-G 20196912-T-G DYZ19 ***
23667682-T-G 21505796-T-G ***
24084229-A-C 21938082-A-C P3_b1 ***
24084251-A-C 21938104-A-C P3_b1 ***
24216307-G-T 22070160-G-T P3_b1 ***
24420937-C-T 22274790-C-T ***
25165722-G-A 23019575-G-A g1 ***
25207893-G-A 23061746-G-A P2_r1 ***
25845058-T-A 23698911-T-A P1_b3 ***
26991369-G-A 24845222-G-A P1_r4 ***
26089870-A-T 23943723-A-T P1_Y1 ***
26089873-C-T 23943726-C-T P1_Y1 ***
26089876-C-T 23943729-C-T P1_Y1 ***
26089879-C-T 23943732-C-T P1_Y1 ***
26089881-G-T 23943734-G-T P1_Y1 ***
26089882-A-T 23943735-A-T P1_Y1 ***
26089884-C-T 23943737-C-T P1_Y1 ***
26089887-C-T 23943740-C-T P1_Y1 ***
26907499-A-T 24761352-A-T P1_r3 ***
28253599-C-A 26107452-C-A P1_b4 ***
28253603-T-A 26107456-T-A P1_b4 ***
22341578-G-A 20179692-G-A DYZ19 ***
13740761-GGA-CGG 11585085-GGA-CGG ***
13275922-C-CA 11120246-C-CA ***
13446403-CA-TG 11290727-CA-TG ***
13681005-GA-CG 11525329-GA-CG ***
13681013-GTGGA-ACAAT 11525337-GTGGA-ACAAT ***
13699393-ATGGAGAAGAGATAAAT-TCAGAACGGACTGGAGA 11543717-ATGGAGAAGAGATAAAT-TCAGAACGGACTGGAGA ***
13699416-GAAACGAATTC-TACACAAATGG 11543740-GAAACGAATTC-TACACAAATGG ***
13729554-CA-GG 11573878-CA-GG ***
13740632-GAACTC-CGAACG 11584956-GAACTC-CGAACG ***
13801012-TGCAATG-AGGAATA 11680306-TGCAATG-AGGAATA ***
20428140-AT-A 18266254-AT-A P5_Dst 17×T***
13856627-TA-GG 11735921-TA-GG ***
16099087-CTG-C 13987207-CTG-C P8_Prx 23×TG***
18369645-TAC-AAA 16257765-TAC-AAA P6_Prx ***
18533135-CTTTGTTTCTTGC-TTTTTTTTTTTGT 16421255-CTTTGTTTCTTGC-TTTTTTTTTTTGT P6_Dst ***
19727393-TA-CC 17615513-TA-CC P5_Prx ***
20229254-G-GT 18067368-G-GT P5_Dst 15×T***
20717039-C-AA 18555153-C-AA P4_Prx 35×A***
20917254-CA-C 18755368-CA-C P4_Dst 14×A***
13120632-TA-T 10610118-TA-T 8×A***
9540246-CT-C 9702637-CT-C IR3_Prx 18×T***
28253604-G-A 26107457-G-A P1_b4 ***
28797872-G-T 26651725-G-T ***
28253606-C-A 26107459-C-A P1_b4 ***
28253610-T-A 26107463-T-A P1_b4 ***
28797860-G-T 26651713-G-T ***
28797862-G-T 26651715-G-T ***
28797865-G-A 26651718-G-A ***
28797868-A-G 26651721-A-G ***
28797869-A-C 26651722-A-C ***
28797870-G-A 26651723-G-A ***
28797875-T-A 26651728-T-A ***
10014645-C-CTAAT 10177036-C-CTAAT 4×TAAT***
28802529-A-G 26656382-A-G ***
28802532-T-A 26656385-T-A ***
28802536-G-A 26656389-G-A ***
28802541-T-A 26656394-T-A ***
28802543-G-T 26656396-G-T ***
28802561-A-G 26656414-A-G ***
28802562-T-A 26656415-T-A ***
13488715-CA-GG 11333039-CA-GG ***
13488987-CAGGGT-TGGGGC 11333311-CAGGGT-TGGGGC ***
22341586-G-C 20179700-G-C DYZ19 ***
22341567-C-A 20179681-C-A DYZ19 ***
22269595-TTCG-ATTA 20107709-TTCG-ATTA DYZ19 ***
13203927-T-A 11048251-T-A ***
13203917-G-T 11048241-G-T ***
13203919-T-A 11048243-T-A ***
13203920-G-T 11048244-G-T ***
13203921-A-G 11048245-A-G ***
13203922-C-A 11048246-C-A ***
13203923-G-T 11048247-G-T ***
13203925-C-G 11048249-C-G ***
13203926-A-T 11048250-A-T ***
13203929-G-T 11048253-G-T ***
13203915-A-G 11048239-A-G ***
13203930-T-A 11048254-T-A ***
13203931-G-T 11048255-G-T ***
13203932-A-G 11048256-A-G ***
13203933-T-A 11048257-T-A ***
13203934-A-T 11048258-A-T ***
13203935-G-A 11048259-G-A ***
13203936-A-G 11048260-A-G ***
13203937-G-T 11048261-G-T ***
13203916-T-A 11048240-T-A ***
13203914-G-T 11048238-G-T ***
13203939-T-A 11048263-T-A ***
6134451-A-G 6266410-A-G ***
17926565-G-A 15814685-G-A ***
28797878-G-A 26651731-G-A ***
28797880-G-A 26651733-G-A ***
22257958-G-T 20096072-G-T DYZ19 ***
13437416-A-C 11281740-A-C ***
28802553-T-G 26656406-T-G ***
28802556-A-G 26656409-A-G ***
22315987-A-T 20154101-A-T DYZ19 ***
9202323-C-T 9364714-C-T ***
13203913-C-G 11048237-C-G ***
9215996-A-G 9378387-A-G ***
9215999-C-G 9378390-C-G ***
9216002-A-C 9378393-A-C ***
9304878-C-G 9467269-C-G ***
9325211-A-C 9487602-A-C ***
9930204-A-G 10092595-A-G ***
9930207-A-G 10092598-A-G ***
9930211-C-G 10092602-C-G ***
10068837-T-C 10231228-T-C A4931 ***
13203938-A-G 11048262-A-G ***
13203940-G-T 11048264-G-T ***
22256897-G-A 20095011-G-A DYZ19 ***
18008794-C-T 15896914-C-T P7_Dst ***
18008757-C-T 15896877-C-T P7_Dst ***
18008764-C-T 15896884-C-T P7_Dst ***
18008766-G-T 15896886-G-T P7_Dst ***
18008781-G-T 15896901-G-T P7_Dst ***
18008782-G-T 15896902-G-T P7_Dst ***
18008788-G-T 15896908-G-T P7_Dst ***
18008789-C-T 15896909-C-T P7_Dst ***
18008791-A-T 15896911-A-T P7_Dst ***
18008796-C-T 15896916-C-T P7_Dst ***
18008754-C-T 15896874-C-T P7_Dst ***
18008799-G-T 15896919-G-T P7_Dst ***
18008803-C-T 15896923-C-T P7_Dst ***
19727382-A-C 17615502-A-C P5_Prx ***
20217481-A-C 18055595-A-C P5_Dst ***
20252829-G-A 18090943-G-A P5_Dst ***
20886833-G-A 18724947-G-A P4_Dst ***
22256895-G-T 20095009-G-T DYZ19 ***
22256896-A-C 20095010-A-C DYZ19 ***
18008756-G-T 15896876-G-T P7_Dst ***
18008752-C-T 15896872-C-T P7_Dst ***
13203941-A-G 11048265-A-G ***
13203954-T-G 11048278-T-G ***
13203942-T-A 11048266-T-A ***
13203945-A-G 11048269-A-G ***
13203946-G-T 11048270-G-T ***
13203948-T-G 11048272-T-G ***
13203949-G-T 11048273-G-T ***
13203950-A-G 11048274-A-G ***
13203951-T-A 11048275-T-A ***
13203952-G-T 11048276-G-T ***
13203955-C-T 11048279-C-T ***
18008748-C-T 15896868-C-T P7_Dst ***
13203956-A-G 11048280-A-G ***
13203957-T-A 11048281-T-A ***
13275934-A-G 11120258-A-G ***
13731459-T-A 11575783-T-A ***
18008739-G-T 15896859-G-T P7_Dst ***
18008740-C-T 15896860-C-T P7_Dst ***
18008744-G-T 15896864-G-T P7_Dst ***
18008745-G-T 15896865-G-T P7_Dst ***
18008746-C-T 15896866-C-T P7_Dst ***
21006509-GAC-G 18844623-GAC-G P4_Dst 16×AC***
22273537-GACTTCA-CACCTT 20111651-GACTTCA-CACCTT DYZ19 ***
5186768-G-T 5318727-G-T ***
25231949-A-G 23085802-A-G P2_r1 ***
25464587-AT-A 23318440-AT-A P2_r2 11×T***
27001771-CTT-C 24855624-CTT-C P1_r4 24×T***
22234331-TCTATCAGT-CCACCGTA 20072445-TCTATCAGT-CCACCGTA DYZ19 ***
17349364-G-A 15237484-G-A ***
24794438-T-G 22648291-T-G P3_b2 ***
25467010-A-C 23320863-A-C P2_r2 ***
9945123-A-G 10107514-A-G ***
9325217-C-G 9487608-C-G ***
25717453-C-A 23571306-C-A P1_b3 ***
20323695-CT-C 18161809-CT-C P5_Dst 9×T***
27585894-C-T 25439747-C-T P1_Y2 ***
22328388-A-G 20166502-A-G DYZ19 ***
24207437-A-C 22061290-A-C P3_b1 ***
13661287-A-AATGGC 11505611-A-AATGGC ***
14491296-T-G ***
13287270-T-A 11131594-T-A ***
13287275-C-G 11131599-C-G ***
13287206-G-T 11131530-G-T ***
25460675-TATA-T 23314528-TATA-T P2_r2 13×ATA***
13861579-GAT-CAG 11740873-GAT-CAG ***
13287263-C-A 11131587-C-A ***
27585908-A-T 25439761-A-T P1_Y2 ***
20243030-G-A 18081144-G-A P5_Dst ***
26277719-A-T 24131572-A-T P1_Y1 ***
26900301-G-A 24754154-G-A P1_r3 ***
26986481-C-T 24840334-C-T P1_r4 ***
27585896-A-T 25439749-A-T P1_Y2 ***
27585901-G-T 25439754-G-T P1_Y2 ***
27585902-C-T 25439755-C-T P1_Y2 ***
27585907-C-T 25439760-C-T P1_Y2 ***
28806573-G-T 26660426-G-T ***
13861497-TCGA-AGAT 11740791-TCGA-AGAT ***
28806577-T-A 26660430-T-A ***
28806578-G-T 26660431-G-T ***
13868769-CA-TG 11748063-CA-TG ***
13140125-G-CACTC 10629611-G-CACTC 6×CACTC***
13140214-CCT-TCC 10629700-CCT-TCC ***
13447311-GCATTCCACTCCACTCCACTCCACTCCACTCCACTCCACT-ACATTCCACTCCACTCCACTCCACA 11291635-GCATTCCACTCCACTCCACTCCACTCCACTCCACTCCACT-ACATTCCACTCCACTCCACTCCACA ***
13681022-TCTCCAATGT-AATGGTACCG 11525346-TCTCCAATGT-AATGGTACCG ***
13860093-AT-TG 11739387-AT-TG ***
13860133-TTCGTTGGAACTT-AGGAATAGAATGG 11739427-TTCGTTGGAACTT-AGGAATAGAATGG ***
9957802-T-C 10120193-T-C FT373548 ***
2979289-G-T 3111248-G-T ***
19189470-C-G 17077590-C-G ***
3559887-C-A 3691846-C-A ***
2845200-C-T 2977159-C-T ***
2845201-A-G 2977160-A-G ***
2845202-G-A 2977161-G-A ***
2979275-C-T 3111234-C-T ***
2979281-C-T 3111240-C-T ***
2979296-C-T 3111255-C-T 15×T***
3115899-C-A 3247858-C-A ***
3164984-G-T 3296943-G-T ***
3705166-C-A 3837125-C-A ***
2719068-T-G 2851027-T-G ***
4062509-C-A 4194468-C-A ***
4472320-C-A 4604279-C-A ***
4504681-T-A 4636640-T-A ***
4554469-T-C 4686428-T-C ***
4554470-G-T 4686429-G-T ***
4554471-A-G 4686430-A-G ***
5000599-C-A 5132558-C-A ***
5059718-A-C 5191677-A-C ***
2845197-G-A 2977156-G-A ***
2697578-C-A 2829537-C-A ***
22263743-G-T 20101857-G-T DYZ19 ***
13193978-T-C 11038302-T-C ***
22311536-A-G 20149650-A-G DYZ19 ***
58994554-G-C 56848407-G-C ***
58994580-A-G 56848433-A-G ***
13143263-A-T 10632749-A-T ***
58994586-T-A 56848439-T-A ***
13143264-T-C 10632750-T-C ***
14491270-A-G ***
10068230-G-C 10230621-G-C ***
58986090-G-T 56839943-G-T ***
2649734-C-G 2781693-C-G ***
58994560-C-G 56848413-C-G ***
22349092-A-T 20187206-A-T DYZ19 ***
14491260-C-A ***
14491261-A-G ***
22316744-G-T 20154858-G-T DYZ19 ***
9952739-A-G 10115130-A-G ***
27546172-G-A 25400025-G-A P1_Y2 ***
2649725-C-A 2781684-C-A ***
2649728-G-C 2781687-G-C ***
19727366-T-C 17615486-T-C P5_Prx ***
18008714-G-T 15896834-G-T P7_Dst ***
22337965-ACTTT-CCTTC 20176079-ACTTT-CCTTC DYZ19 ***
2758620-T-A 2890579-T-A ***
9940961-C-G 10103352-C-G ***
13143459-C-A 10632945-C-A ***
14088854-C-A 11968148-C-A ***
19727364-A-C 17615484-A-C P5_Prx ***
24794448-C-G 22648301-C-G P3_b2 ***
18340731-GT-G 16228851-GT-G P6_Prx 13×T***
58846004-G-C 56744867-C-G ***
22236782-CGA-TGC 20074896-CGA-TGC DYZ19 ***
13552721-C-T 11397045-C-T ***
58823383-CTCTATC-TTCCATT 56767482-GATAGAG-AATGGAA ***
26997351-G-T 24851204-G-T P1_r4 ***
27082215-G-A 24936068-G-A P1_r4 ***
27398234-T-A 25252087-T-A P1_g3 ***
9202348-TGGT-GGGG 9364739-TGGT-GGGG ***
13744426-GGAAC-AGAAT 11588750-GGAAC-AGAAT ***
19510292-GTA-TTT 17398412-GTA-TTT ***
19682558-TGGGT-GGGGG 17570678-TGGGT-GGGGG P5_Prx ***
9216030-T-C 9378421-T-C ***
9293361-C-T 9455752-C-T ***
25176848-TTC-T 23030701-TTC-T g1 ***
20500942-GA-G 18339056-GA-G P5_Dst 15×A***
25675782-T-TA 23529635-T-TA P1_b3 12×A***
22505217-TG-T 20343331-TG-T DYZ19 ***
24582837-CA-C 22436690-CA-C P3_t2 17×A***
24684828-TAC-T 22538681-TAC-T P3_b2 15×AC***
24785778-C-CT 22639631-C-CT P3_b2 14×T***
25300414-CA-C 23154267-CA-C P2_r1 8×A***
25301996-CT-C 23155849-CT-C P2_r1 ***
25310157-AAG-A 23164010-AAG-A P2_r1 ***
25437894-T-TA 23291747-T-TA P2_r2 12×A***
26880198-CT-C 24734051-CT-C P1_r3 25×T***
58823840-TG-AT 56767030-CA-AT ***
26900719-GA-G 24754572-GA-G P1_r3 17×A***
26907510-A-AT 24761363-A-AT P1_r3 22×T***
26931754-C-CA 24785607-C-CA P1_r3 8×A***
27186323-G-GA 25040176-G-GA P1_g3 19×A***
27398536-GCAAAC-AAAAAA 25252389-GCAAAC-AAAAAA P1_g3 ***
27412214-CA-C 25266067-CA-C P1_g3 8×A***
27736672-G-GA 25590525-G-GA P1_Y2 10×A***
27971756-CACACACACACAAAG-AAAAAAAAAAAAAAA 25825609-CACACACACACAAAG-AAAAAAAAAAAAAAA P1_Y2 ***
28180701-CA-C 26034554-CA-C P1_b4 16×A***
24040739-G-T 21894592-G-T ***
13437739-CA-GC 11282063-CA-GC ***
18008711-G-T 15896831-G-T P7_Dst ***
28802712-A-T 26656565-A-T ***
13435833-A-G 11280157-A-G ***
13445157-C-G 11289481-C-G ***
13446330-G-T 11290654-G-T ***
14267133-C-A 12146427-C-A Z24295 ***
17203349-C-T 15091469-C-T ***
18184647-G-T 16072767-G-T ***
22238337-A-G 20076451-A-G DYZ19 ***
28797847-T-C 26651700-T-C ***
58884623-T-A 56706248-A-T ***
13423948-A-G 11268272-A-G ***
28025169-GA-G 25879022-GA-G P1_Y2 11×A***
26900291-G-A 24754144-G-A P1_r3 ***
8181242-C-G 8313201-C-G ***
8181256-C-G 8313215-C-G ***
9345434-T-G 9507825-T-G ***
9372453-T-G 9534844-T-G ***
13140094-A-C 10629580-A-C ***
15364005-A-G 13252125-A-G ***
16292641-A-T 14180761-A-T ***
13423950-T-G 11268274-T-G ***
13268004-A-T 11112328-A-T ***
28117346-C-T 25971199-C-T P1_b4 ***
26730212-A-G 24584065-A-G P1_g2 ***
13320385-CAT-GAA 11164709-CAT-GAA ***
9746248-T-G 9908639-T-G ***
22346982-A-C 20185096-A-C DYZ19 ***
24794491-A-G 22648344-A-G P3_b2 ***
25727456-G-A 23581309-G-A P1_b3 ***
26505318-T-G 24359171-T-G P1_Y1 ***
22229643-AGGAA-TGGAG 20067757-AGGAA-TGGAG DYZ19 ***
26267693-TAC-AAA 24121546-TAC-AAA P1_Y1 ***
7044413-G-T 7176372-G-T Z14994 ***
10068256-T-G 10230647-T-G ***
9939797-AT-A 10102188-AT-A ***
9945130-T-C 10107521-T-C ***
9945172-A-G 10107563-A-G ***
9956692-G-A 10119083-G-A ***
10014639-T-C 10177030-T-C ***
10014729-A-G 10177120-A-G ***
10048872-C-T 10211263-C-T ***
10048873-A-G 10211264-A-G ***
10048961-T-C 10211352-T-C ***
58866431-TCCATTTGATGCCATC-T,TCCATTTGATGCCATT 56724420-CATGGGATGGCATCAA-C,CATGGAATGGCATCAA ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Haplotype Progression

The data below reveals the progression of changes in the haplotype. The bottom row is the haplotype for this man and above him are the inferred ancestral haplotypes for various upstream blocks. These inferred haplotypes are very much a work in progress, and any suggested modifications are appreciated. I think we can use our vast collection of haplotype data to refine these haplotypes. Mutations made from each upstream block are shown in sequence. The cell color is determined by the block in which the mutation took place.

DYS393
DYS390
DYS19
DYS391
DYS385
DYS426
DYS388
DYS439
DYS389i
DYS392
DYS389ii
DYS458
DYS459
DYS455
DYS454
DYS447
DYS437
DYS448
DYS449
DYS464
DYS460
Y-GATA-H4
YCAII
DYS456
DYS607
DYS576
DYS570
CDY
DYS442
DYS438
DYS531
DYS578
DYF395S1
DYS590
DYS537
DYS641
DYS472
DYF406S1
DYS511
DYS425
DYS413
DYS557
DYS594
DYS436
DYS490
DYS534
DYS450
DYS444
DYS481
DYS520
DYS446
DYS617
DYS568
DYS487
DYS572
DYS640
DYS492
DYS565
DYS710
DYS485
DYS632
DYS495
DYS540
DYS714
DYS716
DYS717
DYS505
DYS556
DYS549
DYS589
DYS522
DYS494
DYS533
DYS636
DYS575
DYS638
DYS462
DYS452
DYS445
Y-GATA-A10
DYS463
DYS441
Y-GGAAT-1B07
DYS525
DYS712
DYS593
DYS650
DYS532
DYS715
DYS504
DYS513
DYS561
DYS552
DYS726
DYS635
DYS587
DYS643
DYS497
DYS510
DYS434
DYS461
DYS435
FTY371
FTY303
FTY10
FTY284
FTY219
FTY324
FTY327
FTY394
DYS538
FTY220
FTY254
FTY19
FTY4
DYS577
FTY24
FTY346
FTY160
FTY62
FTY400
FTY114
FTY246
FTY26
FTY368
FTY173
FTY209
FTY337
FTY81
FTY387
FTY361
FTY330
FTY65
FTY168
FTY171
FTY136
FTY53
FTY40
FTY386
FTY100
FTY152
FTY55
FTY297
FTY370
FTY103
FTY64
FTY174
FTY313
FTY362
FTY342
FTY161
FTY374
FTY316
FTY101
FTY204
DYS477
FTY192
DYS502
FTY341
DYS493
FTY1
FTY227
DYS499
FTY391
FTY353
FTY332
FTY163
DYS483
FTY172
FTY180
DYS581
FTY179
FTY188
FTY369
FTY70
FTY63
DYS508
FTY347
FTY83
FTY277
FTY276
FTY195
FTY109
FTY356
FTY215
FTY105
FTY123
FTY242
FTY214
FTY132
FTY262
FTY333
FTY208
DYF398B
FTY43
FTY166
FTY13
FTY11
DYS584
DYS608
FTY95
FTY151
FTY388
FTY256
DYS580
FTY234
FTY268
FTY139
FTY27
FTY75
DYS512
FTY329
FTY320
FTY7
FTY247
FTY211
DYS474
FTY39
FTY376
FTY37
FTY373
DYS475
FTY138
FTY288
FTY264
FTY93
FTY380
FTY18
FTY115
DYS569
FTY390
FTY46
FTY243
FTY322
FTY281
FTY153
FTY181
FTY184
FTY359
FTY121
FTY74
FTY279
DYS530
FTY45
DYS573
DYS542
FTY36
FTY304
FTY203
FTY291
FTY142
FTY191
FTY183
FTY141
FTY299
FTY193
FTY124
FTY16
FTY236
FTY185
FTY378
FTY225
FTY397
FTY3
FTY67
FTY182
FTY334
DYS623
FTY348
FTY357
FTY275
FTY306
FTY383
FTY253
FTY285
DYS645
FTY17
FTY85
DYS598
FTY375
FTY325
FTY12
FTY365
FTY35
FTY237
FTY238
FTY305
FTY56
FTY129
FTY352
FTY292
FTY154
DYS539
FTY301
FTY366
FTY231
DYS618
FTY216
FTY82
FTY393
FTY155
FTY68
FTY32
FTY265
FTY300
FTY143
FTY201
FTY199
FTY86
FTY98
FTY144
DYS541
DYS507
FTY20
FTY116
FTY308
FTY177
FTY89
FTY158
FTY22
FTY84
FTY186
FTY396
FTY91
FTY29
FTY78
FTY229
FTY260
FTY250
FTY364
DYS476
FTY221
FTY57
FTY377
FTY384
DYS466
FTY363
FTY137
FTY69
FTY72
FTY251
FTY2
FTY217
FTY257
FTY120
FTY25
FTY252
FTY33
FTY42
FTY54
FTY372
DYS480
FTY176
FTY76
FTY66
FTY197
FTY385
FTY270
FTY298
FTY198
FTY117
DYS544
FTY159
FTY232
FTY156
FTY343
FTY296
FTY311
FTY344
FTY178
FTY367
FTY73
FTY112
FTY295
DYS616
FTY338
FTY196
FTY157
FTY162
DYS551
FTY148
FTY94
FTY52
FTY131
FTY9
FTY194
FTY8
FTY318
FTY317
FTY99
FTY289
FTY169
FTY51
FTY345
FTY398
FTY111
FTY273
FTY382
FTY47
FTY30
FTY147
DYS615
FTY302
FTY354
FTY326
FTY88
FTY248
FTY267
FTY170
FTY60
DYS453
FTY249
FTY167
DYS624
FTY134
FTY235
FTY145
FTY14
FTY80
FTY50
DYS514
FTY340
DYS585
DYS516
FTY293
FTY207
FTY278
FTY210
DYS523
FTY269
FTY530
FTY1156
FTY1070
FTY906
FTY1004
FTY331
FTY31
FTY226
FTY335
DYS583
FTY339
FTY113
FTY280
FTY255
FTY59
DYS620
FTY349
FTY130
FTY119
DYF398A
FTY58
FTY127
FTY321
FTY92
FTY392
DYF392
FTY290
FTY312
FTY135
FTY150
FTY294
FTY244
FTY48
FTY282
DYS489
FTY272
FTY239
FTY258
FTY49
DYS574
FTY41
FTY905
FTY1103
FTY502
FTY743
FTY443
FTY670
FTY883
DYS631
FTY1042
FTY510
DYS389B
FTY512
FTY837
DYS642
FTY407
FTY935
FTY563
FTY1016
FTY1091
FTY1049
FTY1155
DYS602
FTY587
FTY635
FTY904
DYS543
FTY1148
FTY861
FTY742
FTY433
FTY1039
FTY71
FTY259
FTY108
FTY336
FTY44
FTY233
FTY274
FTY34
FTY942
FTY1068
FTY945
FTY1051
FTY658
FTY625
FTY800
FTY818
FTY971
FTY509
FTY1025
FTY835
FTY984
DYS637
FTY832
FTY689
FTY998
FTY520
FTY445
FTY809
FTY428
FTY562
FTY897
FTY1064
FTY1088
FTY1052
DYF405
FTY310
FTY189
DYS488
FTY283
FTY28
FTY578
DYS484
FTY858
FTY596
FTY915
FTY446
FTY452
FTY1006
FTY612
FTY507
FTY614
FTY824
FTY1055
FTY690
FTY2318
FTY981
FTY946
FTY1040
DYS718
FTY15
FTY2025
DYS685u1
DYS596u5
FTY1511
FTY769
FTY923
FTY1167
FTY415
FTY505
FTY241
FTY2263
FTY517
FTY2180
FTY775
DYS567
FTY444
FTY691
FTY1120
FTY223
DYF393u3
FTY1850
FTY645
FTY696
FTY1166
FTY991
FTY912
DYS551u4
FTY447
DYS518u3
FTY875
DYS536u1
FTY585
FTY896
FTY731
FTY401
FTY2011
FTY665
FTY814
FTY2050
DYS626u3
FTY750
FTY471
FTY985
FTY589
FTY420
FTY921
FTY457
FTY657
FTY1110
FTY485
FTY315
FTY1852
FTY1107
FTY489
FTY522
FTY654
FTY110
FTY881
DYS470
FTY534
FTY1101
FTY1933
FTY936
FTY772
FTY1047
FTY2351
FTY680
FTY2254
FTY1030
FTY2083
FTY287
FTY797
FTY2366
FTY951
FTY774
FTY1116
DYS621
FTY885
FTY1012
DYF394u1
FTY888
FTY648
FTY725
FTY643
FTY927
FTY1022
DYS559
FTY933
FTY633
FTY900
FTY1848
FTY478
FTY533
FTY467
FTY1900
FTY421
DYS612u5
DYS595
FTY668
FTY1028
DYS579
FTY646
FTY1026
FTY801
FTY432
FTY2301
FTY466
FTY531
FTY1083
FTY997
FTY1114
FTY830
FTY655
FTY910
FTY1143
FTY572
DYS506
DYS558u2
FTY1127
FTY712
FTY634
FTY499
FTY1094
FTY724
FTY535
FTY552
FTY430
FTY588
DYS609
FTY961
FTY813
FTY656
FTY839
FTY882
FTY789
FTY459
FTY1037
FTY435
FTY1157
FTY1546
FTY2242
FTY720
DYS614u10
FTY887
FTY473
FTY816
FTY1060
FTY472
FTY943
FTY1482
FTY565
DYS629
FTY891
FTY438
DYS582
FTY468
FTY649
FTY606
FTY792
FTY1087
FTY895
DYS614u3
FTY574
FTY1556
FTY560
FTY694
FTY1097
DYS518u6
FTY876
FTY2443
FTY990
FTY934
FTY465
FTY1046
FTY1312
FTY751
FTY1915
FTY678
FTY419
FTY958
FTY456
DYS592u1
FTY1172
FTY416
FTY650
FTY808
FTY1542
DYS721u1
FTY746
FTY2233
FTY892
FTY845
FTY1034
FTY498
DYF382u1
FTY637
DYS588
FTY947
DYS543u3
FTY644
DYS703
DYS649
FTY212
FTY781
FTY1106
FTY592
FTY848
FTY940
FTY903
FTY1081
FTY952
DYS706u2
FTY1084
FTY700
FTY482
DYS625u7
FTY960
FTY586
FTY1330
FTY1119
FTY1762
FTY1010
FTY417
FTY716
DYS627u3
FTY1942
FTY1067
FTY841
FTY1031
FTY1082
FTY1023
FTY475
FTY222
FTY962
FTY423
FTY664
DYS517u1
FTY1076
FTY1557
FTY1154
DYS681
FTY1002
DYS706u1
FTY1174
FTY986
FTY651
FTY886
FTY1078
DYS546u4
FTY1092
FTY2471
FTY1111
FTY461
FTY323
FTY1013
FTY506
FTY550
FTY767
FTY721
DYS548
FTY559
DYS705
FTY640
FTY613
FTY402
FTY2426
FTY755
P312/S1161324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123315916122626191211131210912121011113012132413101020151913241712152412231810141791211
L21/S1451324141111-14121212131329179-1011112515192915-15-17-17111119-231615181736-38121211915-1681010810101223-231610121215812222013121113111112123515916122526191211131211912121011113012132413101020151913241712152412231810141791211
McConnaughhay1325141111-12121211121428179-1111112515183015-15-16-17111119-231716191739-39121211915-1681010810101221-231610121216812262013121113111112123515916122426191211121211913121011113012132413101022151913241713152412231810141791211

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 2052971102098680396408132801
Used in age calculations1102098680396408132801
Counts of SNPs00
Variant counts last updated 2020-09-08 03:12:05.



Big Tree Main Page