Tree Position

R-P312/S116 > Z46577 > Z290 > L21/S145 > S552 > DF13 > Z39589 > DF49/S474 > Z2980 > Z2976 > DF23 > Z2961 > Z2956 > M222 > Z2959 > Z46375 > DF106 > DF104 > DF105 > ZZ87 > FGC4108/S588 > S7814 > BY81188

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

Position Blocks Names Region McDonald BED combBED STRBigY3
B908902
hg19:Y:19697556-C-CT hg38:Y:17585676-C-CT DF25Z17556 P5_Prx 8×TA*
hg19:Y:6326664-A-C hg38:Y:6458623-A-C S6189 IR3_Dst A*
hg19:Y:6212883-G-A hg38:Y:6344842-G-A IR3_Dst A*
hg19:Y:6260743-G-A hg38:Y:6392702-G-A IR3_Dst A*
hg19:Y:18317104-A-G hg38:Y:16205224-A-G P6_Prx A*
hg19:Y:19694264-G-A hg38:Y:17582384-G-A P5_Prx A*
hg19:Y:20725834-T-C hg38:Y:18563948-T-C P4_Prx A*
hg19:Y:24293157-C-T hg38:Y:22147010-C-T P3_t1 A*
hg19:Y:26107817-C-T hg38:Y:23961670-C-T P1_Y1 A*
hg19:Y:3523854-G-A hg38:Y:3655813-G-A A*
hg19:Y:26505375-C-CA hg38:Y:24359228-C-CA P1_Y1 A*
hg19:Y:25511591-G-A hg38:Y:23365444-G-A P1_gr1 A*
hg19:Y:19932968-C-T hg38:Y:17821088-C-T P5_Prx A*
hg19:Y:19944896-T-C hg38:Y:17833016-T-C P5_Prx A*
hg19:Y:25600919-C-T hg38:Y:23454772-C-T P1_gr1 A*
hg19:Y:2826066-C-G hg38:Y:2958025-C-G DF25DF25 S253 YY+
hg19:Y:8381834-C-G hg38:Y:8513793-C-G FGC3903/S5201S5201 FGC3903 Y2890 YY+
hg19:Y:9129841-T-G hg38:Y:9292232-T-G S5199S5199 Y2891 FGC3900 Y+
hg19:Y:9878915-C-T hg38:Y:10041306-C-T DF21/S192DF21 S192 YY+
hg19:Y:18157337-C-T hg38:Y:16045457-C-T S5199CTS8704 S6375 Y+
hg19:Y:7278952-C-T hg38:Y:7410911-C-T S6189S6189 ZS608 YY+
hg19:Y:6007325-G-A hg38:Y:6139284-G-A BY23441FT32218 +
hg19:Y:6636478-G-T hg38:Y:6768437-G-T BY23441BY23441 YY+
hg19:Y:6872337-G-C hg38:Y:7004296-G-C BY23441BY23452 YY+
hg19:Y:7355393-A-G hg38:Y:7487352-A-G BY23441BY23483 YY+
hg19:Y:14144916-C-T hg38:Y:12024210-C-T BY23441BY23804 YY+
hg19:Y:15407925-A-G hg38:Y:13296045-A-G BY23441BY23897 YY+
hg19:Y:15494228-T-C hg38:Y:13382348-T-C BY23441BY23902 YY+
hg19:Y:15515256-C-T hg38:Y:13403376-C-T S6189Y23187 YY+
hg19:Y:15924215-C-T hg38:Y:13812335-C-T BY104913 YY+
hg19:Y:16413936-A-T hg38:Y:14302056-A-T BY23441BY23963 YY+
hg19:Y:16494143-A-G hg38:Y:14382263-A-G BY23441BY23970 YY+
hg19:Y:16816878-G-A hg38:Y:14704998-G-A BY23441BY23990 YY+
hg19:Y:17983215-G-GT hg38:Y:15871335-G-GT BY23441 +
hg19:Y:18028728-C-T hg38:Y:15916848-C-T BY23441BY24103 Y+
hg19:Y:19088870-C-T hg38:Y:16976990-C-T BY23441BY24188 YY+
hg19:Y:21250363-G-A hg38:Y:19088477-G-A BY23441BY24274 YY+
hg19:Y:21408138-A-G hg38:Y:19246252-A-G BY41282BY41282 Y+
hg19:Y:21445708-T-G hg38:Y:19283822-T-G BY23441BY24300 YY+
hg19:Y:21896628-T-C hg38:Y:19734742-T-C BY23441BY24341 YY+
hg19:Y:22603158-C-G hg38:Y:20441272-C-G BY23441BY24676 YY+
hg19:Y:23999216-G-C hg38:Y:21853069-G-C BY23441BY24826 Y+
hg19:Y:24449279-A-G hg38:Y:22303132-A-G BY24841BY24841 Y+
hg19:Y:28778140-G-A hg38:Y:26631993-G-A BY23441BY24890 +
hg19:Y:28813515-G-C hg38:Y:26667368-G-C BY41283 +
hg19:Y:5172952-G-A hg38:Y:5304911-G-A S6189FT7771 +
hg19:Y:3361135-G-C hg38:Y:3493094-G-C BY23441FT227993 +
hg19:Y:3586969-T-C hg38:Y:3718928-T-C BY23441FT228020 +
hg19:Y:3820181-C-A hg38:Y:3952140-C-A BY23441FT228057 +
hg19:Y:3980716-G-A hg38:Y:4112675-G-A BY23441FT349577 +
hg19:Y:4983495-G-C hg38:Y:5115454-G-C BY23441FT228243 +
hg19:Y:5013127-C-T hg38:Y:5145086-C-T BY23441FT228249 +
hg19:Y:6057761-A-T hg38:Y:6189720-A-T BY23441FT228400 +
hg19:Y:13324982-G-T hg38:Y:11169306-G-T BY23441FT353723 +
hg19:Y:17002122-T-A hg38:Y:14890242-T-A BY23441FT229194 Y+
hg19:Y:18343645-C-T hg38:Y:16231765-C-T BY23441BY154624 P6_Prx +
hg19:Y:3569700-A-C hg38:Y:3701659-A-C +
hg19:Y:4523940-T-C hg38:Y:4655899-T-C +
hg19:Y:5761387-G-T hg38:Y:5893346-G-T +
hg19:Y:6810624-G-A hg38:Y:6942583-G-A YY+
hg19:Y:8800964-C-T hg38:Y:8932923-C-T YY+
hg19:Y:8877315-G-C hg38:Y:9009274-G-C Y+
hg19:Y:13808126-G-A hg38:Y:11687420-G-A DYZ17 +
hg19:Y:16050999-T-C hg38:Y:13939119-T-C YY+
hg19:Y:16551409-C-A hg38:Y:14439529-C-A YY+
hg19:Y:16567408-T-A hg38:Y:14455528-T-A YY+
hg19:Y:17514509-C-T hg38:Y:15402629-C-T YY+
hg19:Y:17969293-C-T hg38:Y:15857413-C-T YY+
hg19:Y:18874155-G-C hg38:Y:16762275-G-C Y+
hg19:Y:22598496-T-G hg38:Y:20436610-T-G YY+
hg19:Y:23730008-C-T hg38:Y:21568122-C-T +
hg19:Y:14379598-G-GATAC hg38:Y:12258894-G-GATAC *
hg19:Y:9519810-CTTTTTCTT-C,CTCTTTCTT hg38:Y:9682201-CTTTTTCTT-C,CTCTTTCTT *
hg19:Y:22093166-T-TTGTG hg38:Y:19931280-T-TTGTG 22×TG*
hg38:Y:10764552-CTCCATTCCAT-C *
hg19:Y:4776622-A-AACAC hg38:Y:4908581-A-AACAC 20×AC*
hg19:Y:28592004-A-ATGTG hg38:Y:26445857-A-ATGTG 18×TG*
hg19:Y:13370806-G-A hg38:Y:11215130-G-A Z30233Z30233 **
hg19:Y:15406358-C-CA hg38:Y:13294478-C-CA S6189 **
hg19:Y:19227469-ACTAT-A hg38:Y:17115589-ACTAT-A 4×CTAT**
hg19:Y:13714841-A-AGAATG hg38:Y:11559165-A-AGAATG DYZ17 7×GAATG**
hg38:Y:10781251-CTCCAT-C **
hg19:Y:13481383-T-C hg38:Y:11325707-T-C **
hg19:Y:13481366-G-A hg38:Y:11325690-G-A **
hg19:Y:13481407-A-G hg38:Y:11325731-A-G **
hg38:Y:11014722-C-T **
hg19:Y:25858371-G-T hg38:Y:23712224-G-T P1_Y1 **
hg19:Y:26461473-A-T hg38:Y:24315326-A-T P1_Y1 **
hg19:Y:26480505-CA-C hg38:Y:24334358-CA-C P1_Y1 9×A**
hg19:Y:20006010-T-C hg38:Y:17894130-T-C P5_Prx **
hg19:Y:16227897-AGAAGGAAG-A hg38:Y:14116017-AGAAGGAAG-A 8×GAAG**
hg19:Y:17902334-T-C hg38:Y:15790454-T-C **
hg19:Y:24387728-C-CTA hg38:Y:22241581-C-CTA **
hg19:Y:23293596-GTGTATA-G hg38:Y:21131710-GTGTATA-G ***
hg19:Y:17198461-AAGAGAG-A,AAG hg38:Y:15086581-AAGAGAG-A,AAG 18×AG***
hg19:Y:27862535-TGAGAGA-T,TGA hg38:Y:25716388-TGAGAGA-T,TGA P1_Y2 22×GA***
hg19:Y:22254934-C-G hg38:Y:20093048-C-G DYZ19 ***
hg19:Y:22288417-C-T hg38:Y:20126531-C-T DYZ19 ***
hg19:Y:14656154-CAAAAA-C hg38:Y:12544219-CAAAAA-C 24×A***
hg19:Y:13481345-T-G hg38:Y:11325669-T-G ***
hg19:Y:13481352-C-T hg38:Y:11325676-C-T ***
hg19:Y:13481360-A-G hg38:Y:11325684-A-G ***
hg19:Y:22317380-G-T hg38:Y:20155494-G-T DYZ19 ***
hg19:Y:21830190-TAA-T hg38:Y:19668304-TAA-T 12×A***
hg19:Y:22147811-TTTCTTTTCTT-T,TTTCTTTTCTC hg38:Y:19985925-TTTCTTTTCTT-T,TTTCTTTTCTC ***
hg19:Y:16868746-CATATATATATAT-C,CATATATAT hg38:Y:14756866-CATATATATATAT-C,CATATATAT 22×AT***
hg19:Y:10081241-C-G hg38:Y:10243632-C-G ***
hg19:Y:10081243-G-T hg38:Y:10243634-G-T ***
hg19:Y:10081255-G-C hg38:Y:10243646-G-C ***
hg38:Y:10824134-CTCCATTCCATTCCAT-C,CTCCAT ***
hg19:Y:14123853-A-G hg38:Y:12003147-A-G ***
hg19:Y:16063203-CTTTCTTTCTTTC-C,CTTTCTTTCTTTCT hg38:Y:13951323-CTTTCTTTCTTTC-C,CTTTCTTTCTTTCT ***
hg19:Y:16364058-CTATATATATATATATATATATATATATATATA-C,CTATATATATATATATATATATA hg38:Y:14252178-CTATATATATATATATATATATATATATATATA-C,CTATATATATATATATATATATA 27×TA***
hg19:Y:18465452-G-A hg38:Y:16353572-G-A P6_Dst ***
hg19:Y:22335081-T-A hg38:Y:20173195-T-A DYZ19 ***
hg19:Y:23002853-GTATATATA-G,GTA hg38:Y:20840967-GTATATATA-G,GTA 17×TA***
hg19:Y:25530223-C-T hg38:Y:23384076-C-T P1_gr1 ***
hg38:Y2:13528-T-C ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: B9089021507201694781198382909
Used in age calculations1507201694781198382909
Counts of SNPs3431
Variant counts last updated 2026-05-23 02:52:06.



Big Tree Main Page