Henderson

Kane-BY3: B336664
MDKA Birth: United States > West Virginia 1777

Tree Position

R-P312/S116 > Z46521 > Z46516 > ZZ11 > U152/S28 > L2/S139 > Z41150 > Z49 > Z142/S211 > Z150 > CTS9490 > S7404 > A8452 > BY42705

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

Position Blocks Names Region McDonald BED combBED STRKane-BY3
B336664
hg19:Y:13458637-G-GTTCCA hg38:Y:11302961-G-GTTCCA 9×TTCCA+
hg19:Y:5468173-C-CTT hg38:Y:5600132-C-CTT 26×T+
hg19:Y:5962109-C-CATAT hg38:Y:6094068-C-CATAT 20×AT+
hg19:Y:13531498-G-GA hg38:Y:11375822-G-GA 10×A+
hg38:Y:10754948-A-G +
hg19:Y:13857024-A-G hg38:Y:11736318-A-G FTB50971 DYZ17 +
hg19:Y:5700516-G-T hg38:Y:5832475-G-T FTB50934 +
hg19:Y:7717666-CTCTT-C hg38:Y:7849625-CTCTT-C 5×TCTT+
hg38:Y:10647167-T-TCATTC +
hg19:Y:6827027-T-C hg38:Y:6958986-T-C Y+
hg38:Y:10969986-T-TTCACTCCACTCCAC +
hg19:Y:26060168-C-CAAAAA hg38:Y:23914021-C-CAAAAA P1_Y1 39×A+
hg19:Y:24422478-C-CAAAAA hg38:Y:22276331-C-CAAAAA 43×A+
hg38:Y:56868570-G-A +
hg38:Y:10908517-G-GTGACACATCTCTGAACTGATCAACCAATTGA +
hg38:Y:10649041-TATTCC-T +
hg19:Y:19844512-T-G hg38:Y:17732632-T-G P5_Prx +
hg19:Y:6225989-C-CTTCTTTCTTTCT hg38:Y:6357948-C-CTTCTTTCTTTCT IR3_Dst 13×TTCT+
hg19:Y:3110007-C-G hg38:Y:3241966-C-G +
hg19:Y:3838675-G-GCGACCT hg38:Y:3970634-G-GCGACCT +
hg19:Y:4450392-C-T hg38:Y:4582351-C-T +
hg19:Y:4501977-A-G hg38:Y:4633936-A-G +
hg19:Y:5680675-T-A hg38:Y:5812634-T-A +
hg19:Y:6464892-A-G hg38:Y:6596851-A-G +
hg19:Y:6827020-T-C hg38:Y:6958979-T-C Y+
hg19:Y:6953093-G-T hg38:Y:7085052-G-T YY+
hg19:Y:9914769-A-T hg38:Y:10077160-A-T Y+
hg19:Y:15595434-C-T hg38:Y:13483554-C-T Y+
hg19:Y:15865946-C-CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT hg38:Y:13754066-C-CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 37×T+
hg19:Y:16034399-C-T hg38:Y:13922519-C-T Y+
hg19:Y:16621031-C-G hg38:Y:14509151-C-G Y+
hg19:Y:18383972-T-G hg38:Y:16272092-T-G P6_Gap +
hg19:Y:21719381-A-G hg38:Y:19557495-A-G YY+
hg19:Y:21831317-A-C hg38:Y:19669431-A-C Y+
hg19:Y:21833027-G-T hg38:Y:19671141-G-T Y+
hg19:Y:22802868-A-ATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT hg38:Y:20640982-A-ATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 32×T+
hg19:Y:26100509-G-GTTTT hg38:Y:23954362-G-GTTTT P1_Y1 35×T+
hg19:Y:26024548-CTTT-C hg38:Y:23878401-CTTT-C P1_Y1 17×T*
hg19:Y:58979252-C-A hg38:Y:56833105-C-A *
hg19:Y:27641766-C-CT hg38:Y:25495619-C-CT P1_Y2 14×T*
hg19:Y:13463406-C-T hg38:Y:11307730-C-T *
hg19:Y:58985853-C-A hg38:Y:56839706-C-A *
hg19:Y:25511351-AT-A hg38:Y:23365204-AT-A P1_gr1 14×T*
hg19:Y:2965271-A-G hg38:Y:3097230-A-G *
hg19:Y:14031139-TGGA-T hg38:Y:11910433-TGGA-T 6×GGA*
hg19:Y:5666004-T-C hg38:Y:5797963-T-C *
hg19:Y:13471845-G-GT hg38:Y:11316169-G-GT *
hg19:Y:3535987-C-CAT hg38:Y:3667946-C-CAT *
hg19:Y:3547140-T-A hg38:Y:3679099-T-A 8×A*
hg19:Y:3920475-T-C hg38:Y:4052434-T-C *
hg19:Y:3924392-C-T hg38:Y:4056351-C-T *
hg19:Y:3924394-C-A hg38:Y:4056353-C-A *
hg19:Y:3989883-T-A hg38:Y:4121842-T-A *
hg19:Y:4029778-T-G hg38:Y:4161737-T-G FGC82297 *
hg19:Y:4030172-G-C hg38:Y:4162131-G-C *
hg19:Y:4030299-G-A hg38:Y:4162258-G-A *
hg19:Y:4035411-T-A hg38:Y:4167370-T-A *
hg19:Y:4765721-AT-A hg38:Y:4897680-AT-A 10×T*
hg19:Y:5554957-G-A hg38:Y:5686916-G-A *
hg19:Y:5832455-T-TTATA hg38:Y:5964414-T-TTATA *
hg19:Y:6445370-A-C hg38:Y:6577329-A-C *
hg19:Y:24413246-TTTG-T hg38:Y:22267099-TTTG-T 8×TTG*
hg19:Y:3918060-G-T hg38:Y:4050019-G-T *
hg19:Y:4024633-C-T hg38:Y:4156592-C-T *
hg19:Y:4026239-AG-A hg38:Y:4158198-AG-A *
hg19:Y:5502369-G-T hg38:Y:5634328-G-T *
hg19:Y:8513634-TTG-T hg38:Y:8645593-TTG-T *
hg19:Y:17632613-AGT-A hg38:Y:15520733-AGT-A *
hg19:Y:4035854-G-GAT hg38:Y:4167813-G-GAT *
hg19:Y:17459485-CAAAAA-C hg38:Y:15347605-CAAAAA-C 25×A*
hg19:Y:13535681-A-ATG hg38:Y:11380005-A-ATG 9×TG*
hg19:Y:8751098-G-A hg38:Y:8883057-G-A YY*
hg19:Y:21904710-C-CA hg38:Y:19742824-C-CA 11×A*
hg19:Y:21718078-G-GA hg38:Y:19556192-G-GA 10×A*
hg19:Y:59013608-GTATA-G hg38:Y:56867461-GTATA-G 15×TA*
hg19:Y:14886399-CAAA-C hg38:Y:12774465-CAAA-C 21×A*
hg19:Y:27971726-C-CAAAAA hg38:Y:25825579-C-CAAAAA P1_Y2 27×A*
hg19:Y:13463414-C-T hg38:Y:11307738-C-T *
hg19:Y:17274955-TAGATAGAC-T hg38:Y:15163075-TAGATAGAC-T *
hg19:Y:10017070-TCACA-T hg38:Y:10179461-TCACA-T 16×CA*
hg19:Y:3349229-C-CAA hg38:Y:3481188-C-CAA 22×A*
hg19:Y:13354858-TAA-T hg38:Y:11199182-TAA-T 14×A*
hg19:Y:21569958-T-A hg38:Y:19408072-T-A FTB44170 YY46×A*
hg19:Y:16340147-G-GA,GAA hg38:Y:14228267-G-GA,GAA 22×A*
hg38:Y:56837419-G-T *
hg19:Y:18382641-C-CA hg38:Y:16270761-C-CA P6_Gap 10×A*
hg19:Y:16860749-CAA-C hg38:Y:14748869-CAA-C 24×A*
hg19:Y:17209887-C-CT hg38:Y:15098007-C-CT 10×T*
hg19:Y:17680077-CTTT-C hg38:Y:15568197-CTTT-C 17×T*
hg19:Y:13545823-T-TA hg38:Y:11390147-T-TA 12×A*
hg19:Y:6074774-TTA-T hg38:Y:6206733-TTA-T *
hg19:Y:14025988-GAGAAAGAA-G,GAGAA hg38:Y:11905282-GAGAAAGAA-G,GAGAA 13×AGAA*
hg19:Y:8650022-G-GAGAA,GAGAAAGAA hg38:Y:8781981-G-GAGAA,GAGAAAGAA 19×AGAA*
hg38:Y:56830680-CATTCCACTCT-C *
hg38:Y:10780974-C-T *
hg38:Y:10780975-T-G *
hg38:Y:10780985-T-C *
hg38:Y:10780988-C-G *
hg19:Y:15557124-AATATATAT-A,AAT hg38:Y:13445244-AATATATAT-A,AAT 19×AT*
hg19:Y:19412618-AAAAT-A hg38:Y:17300738-AAAAT-A 8×AAAT*
hg19:Y:14200742-TTAGATAGATAGA-T,TTAGA hg38:Y:12080036-TTAGATAGATAGA-T,TTAGA 15×TAGA*
hg19:Y:23416511-CTT-C,CT hg38:Y:21254625-CTT-C,CT 16×T*
hg19:Y:18965642-CTTTTT-C hg38:Y:16853762-CTTTTT-C 19×T*
hg19:Y:6767774-CA-C hg38:Y:6899733-CA-C 8×A*
hg19:Y:22128509-CTTA-C hg38:Y:19966623-CTTA-C 5×TTA*
hg38:Y:10958553-CTCCAT-C *
hg19:Y:27964790-A-AT hg38:Y:25818643-A-AT P1_Y2 10×T*
hg19:Y:7886330-TG-T hg38:Y:8018289-TG-T *
hg38:Y:10985483-T-C FT439248 *
hg19:Y:17802166-TAAAAAA-T hg38:Y:15690286-TAAAAAA-T 30×A*
hg38:Y:10985475-C-A *
hg19:Y:14009385-C-G hg38:Y:11888679-C-G YY*
hg19:Y:5923503-G-GT hg38:Y:6055462-G-GT 9×T*
hg19:Y:5255069-ATT-A hg38:Y:5387028-ATT-A 15×T*
hg19:Y:27937836-GAAA-G hg38:Y:25791689-GAAA-G P1_Y2 17×A*
hg19:Y:9942043-ATTTTT-A hg38:Y:10104434-ATTTTT-A 28×T*
hg19:Y:3917650-C-A hg38:Y:4049609-C-A *
hg19:Y:3917689-A-G hg38:Y:4049648-A-G F8850 *
hg19:Y:4026241-A-T hg38:Y:4158200-A-T *
hg19:Y:6486831-T-C hg38:Y:6618790-T-C FGC69285 *
hg19:Y:6213774-ATATTAT-A hg38:Y:6345733-ATATTAT-A IR3_Dst 9×TAT*
hg19:Y:58980525-T-G hg38:Y:56834378-T-G *
hg38:Y:11022414-TCTCCA-T *
hg19:Y:7128621-CGTGT-C,CGT hg38:Y:7260580-CGTGT-C,CGT 23×GT*
hg38:Y:13203566-C-CAAA 19×A*
hg38:Y:10955066-C-A *
hg19:Y:28644854-CA-C hg38:Y:26498707-CA-C 10×A*
hg19:Y:8498109-TTGTG-T hg38:Y:8630068-TTGTG-T 12×TG*
hg38:Y:10954322-A-T *
hg19:Y:23505158-CA-C,CAA hg38:Y:21343272-CA-C,CAA 20×A*
hg19:Y:9524289-C-CTA hg38:Y:9686680-C-CTA 8×TA*
hg19:Y:19125433-C-T hg38:Y:17013553-C-T YY*
hg19:Y:4035474-T-TACA hg38:Y:4167433-T-TACA *
hg19:Y:21438785-T-TAA hg38:Y:19276899-T-TAA 31×A*
hg19:Y:17274951-TAGATAGATAGAC-T hg38:Y:15163071-TAGATAGATAGAC-T *
hg19:Y:22255821-G-A hg38:Y:20093935-G-A DYZ19 *
hg38:Y:10955075-G-C *
hg19:Y:13272139-T-A hg38:Y:11116463-T-A *
hg19:Y:4545124-GACAC-G hg38:Y:4677083-GACAC-G 12×AC*
hg19:Y:6020688-GTTT-G hg38:Y:6152647-GTTT-G 23×T*
hg19:Y:13414797-ATTT-A hg38:Y:11259121-ATTT-A 20×T*
hg19:Y:8751100-A-G hg38:Y:8883059-A-G YY*
hg19:Y:21717473-TA-T hg38:Y:19555587-TA-T 10×A*
hg19:Y:14495831-GGTGT-G,GGT hg38:Y:12384028-GGTGT-G,GGT 17×GT*
hg19:Y:3922183-GAAA-G hg38:Y:4054142-GAAA-G 16×A*
hg19:Y:8030066-T-A hg38:Y:8162025-T-A YY*
hg19:Y:13204261-C-CATGATGGTAGTGATAATGGTGATGGTGATGGGGATGGTATTGGTGATGATAGTGGTGATTATGAGGATGGTGGTGATGATGGTGATGGTGACAATAATGGTGATAATGATGGTATTATGATAGTGATGATGGTGGTGATGGTGATGATAATGGTGATAATGACGGT hg38:Y:11048585-C-CATGATGGTAGTGATAATGGTGATGGTGATGGGGATGGTATTGGTGATGATAGTGGTGATTATGAGGATGGTGGTGATGATGGTGATGGTGACAATAATGGTGATAATGATGGTATTATGATAGTGATGATGGTGGTGATGGTGATGATAATGGTGATAATGACGGT *
hg19:Y:13449945-C-CA hg38:Y:11294269-C-CA *
hg38:Y:56825934-T-TAATTCCATTCGATTGCATTCCATTCGATTGCATTCCATTCGATTGCATTCCATTCGATTG *
hg38:Y:56825856-A-T *
hg38:Y:56871627-A-AT *
hg19:Y:13463404-A-T hg38:Y:11307728-A-T *
hg19:Y:13463419-G-C hg38:Y:11307743-G-C *
hg19:Y:13463424-C-T hg38:Y:11307748-C-T *
hg19:Y:13463425-T-G hg38:Y:11307749-T-G *
hg38:Y:10985421-TTCCACTCCACTCAAA-T *
hg38:Y:10985444-CA-C *
hg38:Y:10985446-CTCCCCTCAACTCCA-C *
hg38:Y:10985466-C-A *
hg19:Y:13449946-C-CTCCA hg38:Y:11294270-C-CTCCA *
hg19:Y:13448018-C-CTCCACTCCATTCCAATACATTCGATTCCATTCCACTCCATTCCACTCCTATTCACTCTACTGCGT hg38:Y:11292342-C-CTCCACTCCATTCCAATACATTCGATTCCATTCCACTCCATTCCACTCCTATTCACTCTACTGCGT *
hg38:Y:10632736-TCATTCCATCCATATCATTCCATTCCCCTCAACTG-T *
hg38:Y:56832357-C-CCACTCCTTTCCACTCCACTTCCCTCCAA *
hg19:Y:28529232-CAAAAA-C,CAAAA hg38:Y:26383085-CAAAAA-C,CAAAA 23×A*
hg19:Y:23832826-T-TCCCCC hg38:Y:21670940-T-TCCCCC *
hg19:Y:2827953-G-C hg38:Y:2959912-G-C YY*
hg19:Y:15752638-C-CCTT,CCTTCTT hg38:Y:13640758-C-CCTT,CCTTCTT 25×CTT*
hg19:Y:26024566-C-A hg38:Y:23878419-C-A P1_Y1 *
hg19:Y:8634381-T-TAC,TACAC hg38:Y:8766340-T-TAC,TACAC 22×AC*
hg19:Y:23763999-CT-C hg38:Y:21602113-CT-C 9×T*
hg19:Y:15779536-AT-A hg38:Y:13667656-AT-A 9×T*
hg19:Y:4270959-AAGATAGAT-A,AAGAT hg38:Y:4402918-AAGATAGAT-A,AAGAT 15×AGAT*
hg19:Y:13478389-C-T hg38:Y:11322713-C-T *
hg38:Y:10632778-CTCCTGTCCTCTTCTCTCCACTCCATTCCATTCCACTCCATATCCATTCCATTCCTTTTCTTCGACAGGATCTCGCTCTGTCACTCAGGCTGGAGTGCAGTGGCACAATCTCAGCTCACATTTCATTTCACCATTCCATTTTATTCCAT-C *
hg19:Y:9921964-A-T hg38:Y:10084355-A-T Y*
hg19:Y:9921969-G-C hg38:Y:10084360-G-C Y*
hg19:Y:8666723-GT-G,GTT hg38:Y:8798682-GT-G,GTT 25×T*
hg19:Y:16074766-C-CTTTTT hg38:Y:13962886-C-CTTTTT 39×T*
hg19:Y:3550598-A-AAAAAAC hg38:Y:3682557-A-AAAAAAC *
hg19:Y:5770338-CTTT-C,CTTTTTTT hg38:Y:5902297-CTTT-C,CTTTTTTT 25×T*
hg19:Y:5815594-C-CAAA hg38:Y:5947553-C-CAAA 22×A*
hg19:Y:5858471-G-A hg38:Y:5990430-G-A *
hg19:Y:6001028-C-A hg38:Y:6132987-C-A *
hg19:Y:8030059-ACTAC-A hg38:Y:8162018-ACTAC-A *
hg19:Y:9534027-C-A hg38:Y:9696418-C-A IR3_Prx *
hg19:Y:9839568-A-AACCC hg38:Y:10001959-A-AACCC *
hg38:Y:10658466-T-A *
hg38:Y:10689039-A-ACTCAC *
hg38:Y:10689056-T-A *
hg38:Y:10780991-T-A *
hg38:Y:10820812-T-G *
hg38:Y:10955060-C-A *
hg38:Y:10955068-T-C *
hg19:Y:13451693-C-CCCTTCCATTCCATTCCATTCCCTTCCATTCCATTCCTCTTTATTCCATTCTATTCCTTTTTTT hg38:Y:11296017-C-CCCTTCCATTCCATTCCATTCCCTTCCATTCCATTCCTCTTTATTCCATTCTATTCCTTTTTTT *
hg19:Y:15163300-A-ATTT hg38:Y:13051386-A-ATTT 15×T*
hg19:Y:15468678-CAAA-C,CAAAA hg38:Y:13356798-CAAA-C,CAAAA 23×A*
hg19:Y:15810962-G-GGT,GGTGT hg38:Y:13699082-G-GGT,GGTGT 19×GT*
hg19:Y:16809086-CAGATAGAT-C,CAGAT hg38:Y:14697206-CAGATAGAT-C,CAGAT 11×AGAT*
hg19:Y:17048866-A-T hg38:Y:14936986-A-T YY*
hg19:Y:17798286-A-AATTGAAAAAAAAAAAAACCCC hg38:Y:15686406-A-AATTGAAAAAAAAAAAAACCCC *
hg19:Y:19125421-C-T hg38:Y:17013541-C-T YY*
hg19:Y:19125424-G-T hg38:Y:17013544-G-T YY*
hg19:Y:19129068-TTC-T hg38:Y:17017188-TTC-T *
hg19:Y:19130738-C-CTTTTTT hg38:Y:17018858-C-CTTTTTT 33×T*
hg19:Y:19382327-CTATTAT-C,CTAT hg38:Y:17270447-CTATTAT-C,CTAT 11×TAT*
hg19:Y:20501040-C-G hg38:Y:18339154-C-G P5_Dst *
hg19:Y:22936009-C-A hg38:Y:20774123-C-A YY*
hg19:Y:23041198-G-GAAAAAA hg38:Y:20879312-G-GAAAAAA 34×A*
hg38:Y:56842783-C-T *
hg38:Y:56847837-C-T *

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: B3366641558859296937488431869
Used in age calculations1558859296937488431869
Counts of SNPs2313
Variant counts last updated 2025-01-27 03:19:05.


Big Tree Main Page