Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF13 > DF21/S192 > Z30233 > FGC3903/S5201 > S5199 > Z246 > DF25

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRBigY3
N196568
19704389-G-T 17592509-G-T P5_Prx A*
20669272-T-TTTG 18507386-T-TTTG P4_Prx 11×TTGA*
13922423-T-A 11801717-T-A FTB48192 YYA*
28817698-G-A 26671551-G-A A*
13922390-C-T 11801684-C-T FT342982 YYA*
20760136-G-A 18598250-G-A P4_Prx A*
26011981-A-C 23865834-A-C P1_Y1 A*
21483455-G-A 19321569-G-A Y106630 YY+
22473922-T-C 20312036-T-C A17453A17453 DYZ19 +
14036030-C-T 11915324-C-T FT116445 YY+
15624554-G-A 13512674-G-A BY102979 YY+
22630372-T-TA 20468486-T-TA 8×A+
10766752-C-T +
14405644-G-A 12284941-G-A BY95507 YY+
17756543-A-G 15644663-A-G BY158078 YY+
16516445-G-A 14404565-G-A FT1940 YY+
14223922-C-T 12103216-C-T BY94056 YY+
19705498-C-CTTAT 17593618-C-CTTAT P5_Prx 4×TTAT+
21455845-G-A 19293959-G-A FT77161 Y+
2827865-C-T 2959824-C-T YY+
3221573-A-G 3353532-A-G +
3447731-T-C 3579690-T-C +
3628298-AC-A 3760257-AC-A +
3960532-G-T 4092491-G-T +
4267684-T-A 4399643-T-A +
4448317-C-T 4580276-C-T +
4834206-G-A 4966165-G-A +
5222618-ACACACG-A 5354577-ACACACG-A +
5900744-T-C 6032703-T-C +
5962041-G-A 6094000-G-A +
6055800-T-A 6187759-T-A +
6395736-G-A 6527695-G-A +
6471795-A-C 6603754-A-C +
6917900-GT-G 7049859-GT-G +
7207687-C-G 7339646-C-G YY+
8121581-G-A 8253540-G-A YY+
8369075-G-A 8501034-G-A YY+
8465934-TTGTGTGTGTGTGTG-T 8597893-TTGTGTGTGTGTGTG-T 20×TG+
8541208-G-A 8673167-G-A YY+
8836332-G-T 8968291-G-T YY+
9039846-C-G 9202237-C-G Y+
13540596-C-G 11384920-C-G +
14193944-C-T 12073238-C-T YY+
15945683-T-G 13833803-T-G YY+
17003865-A-C 14891985-A-C YY+
17362217-T-C 15250337-T-C YY+
17478924-C-T 15367044-C-T YY+
17494979-T-C 15383099-T-C YY+
18122543-C-T 16010663-C-T YY+
18790226-T-C 16678346-T-C Y+
18987095-G-A 16875215-G-A YY+
20827540-G-C 18665654-G-C P4_Gap +
21327559-G-A 19165673-G-A YY+
22080537-C-T 19918651-C-T YY+
22468894-G-T 20307008-G-T DYZ19 +
23058434-G-ACAT 20896548-G-ACAT +
23163679-T-C 21001793-T-C Y+
23189399-C-T 21027513-C-T Y+
23415005-C-T 21253119-C-T YY+
23490347-TG-T 21328461-TG-T +
23581452-T-C 21419566-T-C YY+
23758721-G-A 21596835-G-A Y+
9906513-A-ACCACCTCCACCT 10068904-A-ACCACCTCCACCT 5×CCACCT*
19000519-CT-C 16888639-CT-C 10×T**
16102036-TTG-T 13990156-TTG-T P8_Prx **
26225017-T-A 24078870-T-A P1_Y1 **
18290775-G-T 16178895-G-T P6_Prx **
19647596-C-A 17535716-C-A P5_Prx **
13847189-GAATGGAATGGAATGGACTCA-G 11726483-GAATGGAATGGAATGGACTCA-G DYZ17 **
26102868-A-AT 23956721-A-AT P1_Y1 9×T**
19868108-G-T 17756228-G-T P5_Prx **
3967928-A-C 4099887-A-C **
7150500-T-C 7282459-T-C **
10750851-C-T **
10756845-C-T **
16356525-C-T 14244645-C-T **
17521007-C-T 15409127-C-T **
17804340-A-G 15692460-A-G **
18054237-T-G 15942357-T-G **
20495922-T-TA 18334036-T-TA P5_Dst **
22194134-C-A 20032248-C-A **
25571202-G-T 23425055-G-T P1_gr1 **
7730430-T-TGATAGATAGATA 7862389-T-TGATAGATAGATA 11×GATA***
7311379-CTTAT-C 7443338-CTTAT-C ***
18017108-GATATAT-G 15905228-GATATAT-G 22×AT***
13256858-GTTT-G 11101182-GTTT-G 18×T***
10664763-T-TCCATC ***
10987851-TTCCATTCCATTCCACTCCAC-T,TTCCATTCCATTCCATTCCAT ***
10889246-TCCATG-T ***
12377235-T-TA ***
22633910-TA-T 20472024-TA-T ***
14307953-CA-C,CAA 12187247-CA-C,CAA 15×A***
20778781-TTGTG-T,TTG 18616895-TTGTG-T,TTG P4_Prx 18×TG***
19293770-CAAAAAAAAAAAA-C 17181890-CAAAAAAAAAAAA-C 29×A***
3141445-G-A 3273404-G-A ***
14673383-C-T 12561449-C-T ***
22123492-G-GA 19961606-G-GA 8×A***
26494311-G-A 24348164-G-A P1_Y1 ***
56843088-T-C ***
7419-G-T ***
7426-A-G ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.