Tree Position

R-M269 > L23 > L51 > P310 > L151 > A8053 > FGC37082

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRYDW-Kane-BY3
EWN1D4KG
10658601-C-CCCATT +
15756091-C-G 13644211-C-G YY+
17156202-A-T 15044322-A-T YY+
5261698-C-CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 5393657-C-CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 48×A+
5371508-G-C 5503467-G-C +
5510052-G-C 5642011-G-C +
2915006-T-TCTTC 3046965-T-TCTTC 10×CTTC+
58854641-G-T 56736230-C-A +
15865946-C-CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 13754066-C-CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 37×T+
58974165-T-C 56828018-T-C +
20937050-A-AT 18775164-A-AT P4_Dst 14×T+
5180682-C-T 5312641-C-T +
10945292-G-A FT62332 +
6528213-G-GA 6660172-G-GA 9×A+
58974223-T-A 56828076-T-A +
6011910-G-C 6143869-G-C +
14888952-A-T 12777018-A-T YY+
20127904-T-C 18016024-T-C P5_Dst +
6145256-C-T 6277215-C-T IR3_Dst +
6194828-T-C 6326787-T-C IR3_Dst +
17277435-T-A 15165555-T-A YY+
17617353-C-T 15505473-C-T Y+
26730273-G-A 24584126-G-A ZS6424 P1_g2 +
4413941-A-C 4545900-A-C +
21130192-A-C 18968306-A-C YY+
10925082-A-C FT62333 +
20981703-C-T 18819817-C-T P4_Dst +
3560298-CAG-C 3692257-CAG-C +
20132822-AT-A 18020942-AT-A P5_Dst +
19753423-G-T 17641543-G-T P5_Prx +
19827927-A-G 17716047-A-G P5_Prx +
4060510-A-G 4192469-A-G +
19073252-G-C 16961372-G-C YY+
17645991-C-T 15534111-C-T YY+
4683349-A-C 4815308-A-C +
4783068-T-A 4915027-T-A +
18944953-C-G 16833073-C-G YY+
9367735-G-A 9530126-G-A Y+
18767254-A-G 16655374-A-G Y+
18619620-C-G 16507740-C-G YY+
18173529-C-T 16061649-C-T YY+
5037371-C-T 5169330-C-T +
13516786-C-A 11361110-C-A +
6752408-T-C 6884367-T-C YY+
3545169-G-A 3677128-G-A +
22324941-C-G 20163055-C-G DYZ19 +
58870015-T-C 56720856-A-G FGC78751 +
9185239-A-G 9347630-A-G Y+
9125457-C-A 9287848-C-A Y+
17257210-C-A 15145330-C-A FGC37099 YY+
13677199-G-T 11521523-G-T BY57366 SK1925 FGC57669 BY41615Z14583 +
13454384-G-GTCCAT 11298708-G-GTCCAT 5×TCCAT+
9454962-T-C 9617353-T-C YY+
19081517-T-TTTA 16969637-T-TTTA 12×TTA+
9320710-G-C 9483101-G-C Y+
7945943-C-G 8077902-C-G YY+
10659448-A-C +
58974236-C-T 56828089-C-T +
25201091-A-AAAGGAAGG 23054944-A-AAAGGAAGG g1 15×AAGG+
24447123-A-AAAAGAAAG 22300976-A-AAAAGAAAG 6×AAAG+
13347385-C-T 11191709-C-T +
58854637-C-G 56736234-G-C +
10795837-T-TTTCCA +
58998467-T-C 56852320-T-C +
14369146-A-G 12248442-A-G YY+
22324940-A-G 20163054-A-G DYZ19 +
6764156-T-C 6896115-T-C YY+
7035477-A-G 7167436-A-G YY+
13640491-A-AT 11484815-A-AT +
13594247-G-A 11438571-G-A +
6831264-C-T 6963223-C-T YY+
7318490-TTTTA-T 7450449-TTTTA-T 11×TTTA+
10875752-GTTCCATTCCA-G +
26538885-T-A 24392738-T-A P1_g2 +
18588409-A-AT 16476529-A-AT 10×T+
13857542-G-GATGGA 11736836-G-GATGGA 9×ATGGA+
22247805-G-C 20085919-G-C DYZ19 +
9303945-A-AC 9466336-A-AC +
7297635-A-G 7429594-A-G Y+
7431001-G-A 7562960-G-A Y+
4123943-AAAGG-A 4255902-AAAGG-A 8×AAGG+
7488605-G-C 7620564-G-C IR1_L +
26344423-C-A 24198276-C-A P1_Y1 28×T+
22247798-C-T 20085912-C-T DYZ19 +
7727096-A-G 7859055-A-G YY+
22311245-A-T 20149359-A-T DYZ19 +
21190584-T-C 19028698-T-C YY+
4901145-T-C 5033104-T-C +
3544062-G-A 3676021-G-A +
56827998-C-A +
22536533-G-T 20374647-G-T Y+
22553504-C-T 20391618-C-T YY+
23097190-T-C 20935304-T-C YY+
23153799-A-T 20991913-A-T YY+
23491814-T-C 21329928-T-C YY+
8333480-T-TTTCTTCTTC 8465439-T-TTTCTTCTTC 31×TTC+
24070047-T-G 21923900-T-G P3_b1 +
13740828-G-C 11585152-G-C +
13745669-G-C 11589993-G-C +
24514695-C-G 22368548-C-G +
56827981-TTCCTTTCAAG-T +
25576754-A-G 23430607-A-G P1_gr1 +
56828002-TCCA-T +
58995123-A-T 56848976-A-T +
9190853-G-A 9353244-G-A Y+
56828006-TTCCGTTC-T +
28386160-T-C 26240013-T-C P1_gr2 +
19309422-C-CATATAT 17197542-C-CATATAT 19×AT+
11646236-C-CGGAAT +
22634856-TTTTA-T 20472970-TTTTA-T 11×TTTA+
56710900-G-A +
56725153-G-T +
56756335-GAATGGAATCAAATC-G +
17950825-A-AAT 15838945-A-AAT 27×AT+
3822962-G-GATAT 3954921-G-GATAT 26×AT+
58862705-A-G 56728166-T-C +
58854638-G-C 56736233-C-G +
22311274-G-A 20149388-G-A DYZ19 +
13516814-A-G 11361138-A-G +
3368230-G-T 3500189-G-T +
13516825-C-T 11361149-C-T +
22366799-A-C 20204913-A-C DYZ19 +
10967504-TTTCCA-T +
2728785-G-C 2860744-G-C YY+
13516804-A-G 11361128-A-G +
58870142-C-A 56720729-G-T FGC43788 FGC78599 +
58881619-T-C 56709252-A-G +
21798301-C-T 19636415-C-T YY+
22001821-G-A 19839935-G-A YY+
21540529-A-T 19378643-A-T Y+
22185676-A-C 20023790-A-C YY+
13406696-G-A 11251020-G-A *
28582612-G-A 26436465-G-A *
13726529-G-T 11570853-G-T *
15991806-GT-G,GTT 13879926-GT-G,GTT 24×T*
13478923-C-T 11323247-C-T *
56859414-A-G *
28584338-T-A 26438191-T-A *
13825566-T-A 11704860-T-A *
6861230-T-TTTTC,TTTTCTTTC 6993189-T-TTTTC,TTTTCTTTC 17×TTTC*
28584348-T-C 26438201-T-C *
56856588-C-T *
3662166-T-TTA 3794125-T-TTA 9×TA*
13825568-G-A 11704862-G-A *
13605982-A-G 11450306-A-G *
23505495-C-CA,CAA 21343609-C-CA,CAA 23×A*
13432941-G-A 11277265-G-A *
13542062-T-C 11386386-T-C *
9959572-T-G 10121963-T-G Y*
13542079-G-A 11386403-G-A *
9959496-A-G 10121887-A-G Y*
9959490-C-T 10121881-C-T Y*
9939227-G-C 10101618-G-C Y*
13479068-G-T 11323392-G-T *
13555806-C-T 11400130-C-T *
13461935-C-T 11306259-C-T *
13555814-C-T 11400138-C-T *
13512529-C-CTA 11356853-C-CTA *
28017186-TA-T 25871039-TA-T P1_Y2 10×A*
13565725-T-G 11410049-T-G FGC82699 *
13479283-G-A 11323607-G-A *
13415736-A-C 11260060-A-C *
13565877-A-C 11410201-A-C *
13257643-G-A 11101967-G-A *
13249505-A-G 11093829-A-G *
13598511-C-G 11442835-C-G *
9227529-G-GA 9389920-G-GA 13×A*
13705116-G-T 11549440-G-T *
3963833-CAAA-C 4095792-CAAA-C 22×A*
59025339-A-G,T 56879192-A-G,T *
13247379-C-T 11091703-C-T *
9964180-G-C 10126571-G-C Y*
13446271-A-G 11290595-A-G *
13411564-C-G 11255888-C-G 8×A*
10022398-T-C 10184789-T-C Y*
13569835-TA-T 11414159-TA-T 11×A*
13495446-T-C 11339770-T-C *
13590859-C-T 11435183-C-T *
10022407-T-C 10184798-T-C Y*
13523622-C-CA 11367946-C-CA *
4636109-AT-A 4768068-AT-A *
9964912-T-G 10127303-T-G Y*
4367723-C-CT 4499682-C-CT 10×T*
13616427-TAAA-T 11460751-TAAA-T 28×A*
28539586-TAAAA-T 26393439-TAAAA-T 19×A*
5493864-GT-G,GTT 5625823-GT-G,GTT 22×T*
13466448-C-T 11310772-C-T *
13641232-T-G 11485556-T-G *
13550167-G-A 11394491-G-A *
7003134-A-G 7135093-A-G Y*
13446241-G-C 11290565-G-C *
56877978-T-A,C *
13446228-T-A 11290552-T-A *
13490991-A-C 11335315-A-C *
13605958-C-A 11450282-C-A *
3561500-CAA-C 3693459-CAA-C 25×A*
56884831-G-A,C *
9368301-C-CTG 9530692-C-CTG 9×TG*
13497247-T-A 11341571-T-A *
13543634-A-G 11387958-A-G *
13446133-T-A 11290457-T-A *
28587131-T-C 26440984-T-C *
56823040-G-A *
13709807-T-A 11554131-T-A *
13717101-G-T 11561425-G-T *
13462040-G-C 11306364-G-C *
13466392-A-T 11310716-A-T *
13340769-T-G 11185093-T-G *
28017356-CA-C 25871209-CA-C P1_Y2 16×A*
9965352-C-T 10127743-C-T Y*
13488158-G-A 11332482-G-A *
9965351-G-A 10127742-G-A Y*
13500317-GT-G 11344641-GT-G *
13442182-G-C 11286506-G-C PF539 *
9965641-A-G 10128032-A-G Y*
13489729-C-CCAG 11334053-C-CCAG *
22437620-GACCTTAGTGGTGAGCGTTACAGCACTTAAGTTTTTATGTCCAGAGTTTGTTCCTTCACATAAGTCCAGAGTTTCTTCCTTCTGTCCGGTTTATGGTCTTGCTCACTTCAAGAATGAAGCTGCAT-G 20275734-GACCTTAGTGGTGAGCGTTACAGCACTTAAGTTTTTATGTCCAGAGTTTGTTCCTTCACATAAGTCCAGAGTTTCTTCCTTCTGTCCGGTTTATGGTCTTGCTCACTTCAAGAATGAAGCTGCAT-G DYZ19 *
22436503-ACGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGTTTCATGGTCTTGCTCACTTCAAGAATGACGCAGCAGACC-A 20274617-ACGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGTTTCATGGTCTTGCTCACTTCAAGAATGACGCAGCAGACC-A DYZ19 *
22436497-ACCTT-A 20274611-ACCTT-A DYZ19 *
16642876-A-G 14530996-A-G YY*
16642875-T-C 14530995-T-C YY*
16642873-A-G 14530993-A-G YY*
16642866-C-T 14530986-C-T YY*
16642845-TTATG-T 14530965-TTATG-T *
13721459-A-G 11565783-A-G *
13496205-TG-T 11340529-TG-T *
13489779-G-GC 11334103-G-GC *
13489771-G-GCCCAC 11334095-G-GCCCAC *
13489764-GT-G 11334088-GT-G *
13489758-G-A 11334082-G-A *
13489293-G-A 11333617-G-A *
22511231-G-T 20349345-G-T DYZ19 *
13484960-C-T 11329284-C-T *
13449729-CATT-C 11294053-CATT-C *
13449747-TCC-T 11294071-TCC-T *
13449750-ATTC-A 11294074-ATTC-A *
13470159-G-GCT 11314483-G-GCT *
13477151-A-C 11321475-A-C *
13478988-C-A 11323312-C-A *
13487751-C-CAA 11332075-C-CAA *
13488198-G-A 11332522-G-A *
13487859-G-C 11332183-G-C *
13487867-A-G 11332191-A-G *
13487881-C-G 11332205-C-G *
13487914-G-C 11332238-G-C *
13488183-G-A 11332507-G-A *
13488193-G-T 11332517-G-T *
22448635-T-G 20286749-T-G DYZ19 *
28805236-ATGG-A 26659089-ATGG-A *
13448030-CCACTCCA-C 11292354-CCACTCCA-C *
13462177-A-T 11306501-A-T *
13436074-AGT-A 11280398-AGT-A *
13436077-AT-A 11280401-AT-A *
13461802-C-T 11306126-C-T *
13462090-G-T 11306414-G-T *
13462113-C-G 11306437-C-G *
13462152-C-T 11306476-C-T *
13467865-AGTTACATCACCTAGGTGATCAGTGCAGAGATTTGTCAGAATTCCCTGTAGGCAGTGCTTATAAAAGT-A 11312189-AGTTACATCACCTAGGTGATCAGTGCAGAGATTTGTCAGAATTCCCTGTAGGCAGTGCTTATAAAAGT-A *
13278724-A-AT 11123048-A-AT *
13478444-C-A 11322768-C-A *
13480908-C-T 11325232-C-T *
13480949-A-C 11325273-A-C *
13480986-G-C 11325310-G-C *
13480991-T-C 11325315-T-C *
13492326-G-T 11336650-G-T FT99775 *
13420141-G-A 11264465-G-A *
13278718-A-AC 11123042-A-AC *
28805240-AATGGAATGGAATG-A 26659093-AATGGAATGGAATG-A *
13463730-A-T 11308054-A-T *
56829344-TGA-T *
56834609-A-ACTTTACTCCACTCCACTCCCCTCCT *
9957976-T-C 10120367-T-C Y*
9994910-GC-G 10157301-GC-G *
9995028-TG-T 10157419-TG-T *
13287958-T-TA 11132282-T-TA *
13463778-G-T 11308102-G-T *
10860918-T-TTCCACTCCATTACACTCCAC *
13470648-C-T 11314972-C-T *
22476686-A-T 20314800-A-T DYZ19 *
56763715-T-G *
6347736-A-AGG 6479695-A-AGG *
6347737-A-AAG 6479696-A-AAG *
9965673-A-G 10128064-A-G Y*
13449727-T-TAAA 11294051-T-TAAA *
13448026-CAT-C 11292350-CAT-C *
9966634-G-A 10129025-G-A Y*
13339632-G-T 11183956-G-T *
13249482-C-G 11093806-C-G *
13377870-A-G 11222194-A-G *
13487259-C-G 11331583-C-G *
13515252-G-C 11359576-G-C *
13479062-C-A 11323386-C-A *
10025676-T-C 10188067-T-C Y*
13531525-T-C 11375849-T-C *
27484817-T-C 25338670-T-C P1_Y2 *
13489383-CG-C 11333707-CG-C *
13406620-T-A 11250944-T-A *
13406623-A-G 11250947-A-G *
13420231-G-A 11264555-G-A *
4773481-CT-C,CTT 4905440-CT-C,CTT 25×T*
23435682-CTTT-C,CTTTT 21273796-CTTT-C,CTTTT 21×T*
22510656-A-T 20348770-A-T DYZ19 *
27484908-G-A 25338761-G-A P1_Y2 *
13463418-G-A 11307742-G-A *
13500860-G-A 11345184-G-A *
9966642-C-A 10129033-C-A Y*
9980593-A-AT 10142984-A-AT *
10022522-G-C 10184913-G-C Y*
10022550-G-A 10184941-G-A Y*
13400504-C-CT 11244828-C-CT *
13419846-A-G 11264170-A-G *
13515126-G-A 11359450-G-A *
27483061-C-T 25336914-C-T P1_Y2 *
56880727-C-CT,T *
13241786-C-A 11086110-C-A *
13353833-T-G 11198157-T-G *
13429269-AG-A 11273593-AG-A *
13607532-A-G 11451856-A-G *
13339641-G-A 11183965-G-A *
13475551-C-T 11319875-C-T *
4590484-AT-A 4722443-AT-A 9×T*
9964911-T-G 10127302-T-G Y*
13471547-C-G 11315871-C-G *
9994978-T-C 10157369-T-C Y*
9994998-A-G 10157389-A-G Y*
9995005-G-A 10157396-G-A Y*
9995007-G-T 10157398-G-T Y*
9995030-G-A 10157421-G-A Y*
9995038-T-C 10157429-T-C Y*
13257664-G-A 11101988-G-A *
9994966-T-C 10157357-T-C Y*
13400547-C-A 11244871-C-A *
13400548-A-T 11244872-A-T *
13446110-C-A 11290434-C-A *
28584050-C-A 26437903-C-A *
28585419-G-A 26439272-G-A *
28585579-C-T 26439432-C-T *
9994967-A-G 10157358-A-G Y*
9994912-C-T 10157303-C-T Y*
20673813-CTT-C 18511927-CTT-C P4_Prx 12×T*
13461908-A-T 11306232-A-T *
13339625-C-T 11183949-C-T *
13469356-G-T 11313680-G-T *
4389404-CA-C,CAA 4521363-CA-C,CAA 21×A*
13479101-C-A 11323425-C-A *
13489253-G-T 11333577-G-T *
17787106-CAAA-C,CAA 15675226-CAAA-C,CAA 19×A*
13241986-G-A 11086310-G-A *
9994905-T-A 10157296-T-A Y*
13377708-C-A 11222032-C-A *
13445143-C-G 11289467-C-G *
13531518-CA-C 11375842-CA-C *
13564164-A-T 11408488-A-T *
13692931-A-C 11537255-A-C *
9994902-G-A 10157293-G-A Y*
13540703-A-G 11385027-A-G *
13546343-A-G 11390667-A-G *
13531072-T-C 11375396-T-C *
56835633-C-CATTCT *
3574203-TA-T 3706162-TA-T 10×A*
13483436-G-A 11327760-G-A *
13474473-A-T 11318797-A-T *
13450013-C-T 11294337-C-T *
18246301-GAGAAAGAA-G,GAGAA 16134421-GAGAAAGAA-G,GAGAA 14×AGAA*
13461321-G-C 11305645-G-C *
7984040-TA-T,TAA 8115999-TA-T,TAA 21×A*
2729673-TG-T 2861632-TG-T *
13474391-T-A,C 11318715-T-A,C *
5514701-TA-T 5646660-TA-T 10×A*
13393480-C-A 11237804-C-A *
9945822-C-A 10108213-C-A Y*
56706676-A-T *
22509081-G-GT 20347195-G-GT DYZ19 *
13474740-T-C 11319064-T-C *
13468031-A-G 11312355-A-G *
58875145-G-C 56715726-C-G *
13482174-G-A 11326498-G-A *
13482158-A-G 11326482-A-G *
13482146-G-T 11326470-G-T *
13482120-C-A 11326444-C-A *
13281317-T-C 11125641-T-C *
24381391-C-CA 22235244-C-CA 11×A*
13462078-C-T 11306402-C-T *
15155424-T-TA 13043511-T-TA 9×A*
13494028-T-C 11338352-T-C *
56845845-C-T *
4041111-G-GT 4173070-G-GT 11×T*
56853606-G-T *
13550495-C-G 11394819-C-G *
13474689-A-T 11319013-A-T *
13494068-T-G 11338392-T-G *
13494067-G-T 11338391-G-T FT444312 *
13494054-G-C 11338378-G-C *
13494024-T-G 11338348-T-G *
13476156-T-G 11320480-T-G *
13385153-A-G 11229477-A-G *
56835574-G-A *
13521346-G-A 11365670-G-A *
15262458-C-CAAAA 13150542-C-CAAAA 30×A*
17419439-A-ATT 15307559-A-ATT 25×T*
11021402-C-A *
11021401-C-A *
2955378-C-CAT 3087337-C-CAT 9×AT*
9980575-G-T 10142966-G-T Y*
27936764-CAA-C 25790617-CAA-C P1_Y2 15×A*
13696950-C-G 11541274-C-G *
13696949-T-G 11541273-T-G *
13489152-G-T 11333476-G-T *
13489314-G-T 11333638-G-T *
13514118-A-C 11358442-A-C *
13461779-G-T 11306103-G-T *
13470475-C-T 11314799-C-T *
13489064-C-A 11333388-C-A *
2729675-A-T 2861634-A-T YY*
5400870-CTTT-C 5532829-CTTT-C 21×T*
13461808-G-C 11306132-G-C *
13705858-G-A 11550182-G-A FT449117 *
13466415-T-A 11310739-T-A *
17128535-C-CTTT 15016655-C-CTTT 25×T*
56834629-A-ATTCCG *
13478422-C-T 11322746-C-T FGC77978 *
13447635-A-G 11291959-A-G *
14497364-C-CT 12385569-C-CT 10×T*
13469384-G-C 11313708-G-C *
59005498-G-C 56859351-G-C *
13694718-A-G 11539042-A-G *
59020693-C-T 56874546-C-T *
14420787-C-CTT 12300062-C-CTT 18×T*
13474489-G-T 11318813-G-T *
13261540-G-A 11105864-G-A *
13491011-C-A 11335335-C-A *
28805692-G-A 26659545-G-A *
22509555-A-T 20347669-A-T DYZ19 *
13694719-A-G 11539043-A-G *
13496234-A-C 11340558-A-C *
56861292-T-A *
13689325-C-T 11533649-C-T *
17230151-C-A 15118271-C-A Y*
13705675-C-A 11549999-C-A *
13489763-C-A 11334087-C-A *
14727319-ATT-A,AT 12615387-ATT-A,AT 23×T*
58970176-A-T 56824029-A-T *
28812387-T-A 26666240-T-A *
28571566-A-AT 26425419-A-AT 14×T*
23886722-AT-A 21724836-AT-A 13×T*
14613459-C-CT 12501657-C-CT 26×T*
13722711-T-G 11567035-T-G *
13483395-A-T 11327719-A-T *
13342523-A-T 11186847-A-T *
3482590-C-CAA 3614549-C-CAA 22×A*
56860614-A-G,T *
56829854-G-GTT *
13489345-G-T 11333669-G-T *
56707288-C-T *
13489319-C-A 11333643-C-A *
13480884-G-A 11325208-G-A *
17731014-CAA-C 15619134-CAA-C 35×A*
18846011-C-CA 16734131-C-CA 25×A*
13489354-G-A 11333678-G-A *
10661577-T-C *
3542368-C-CT 3674327-C-CT 13×T*
13465069-C-T 11309393-C-T *
15733708-C-CAA 13621828-C-CAA 11×A*
3363318-C-CT 3495277-C-CT 15×T*
13488813-C-A 11333137-C-A *
20568572-G-T 18406686-G-T P5_Dst *
56850314-G-T *
13637424-C-G 11481748-C-G *
13478160-G-T 11322484-G-T *
13445823-C-G 11290147-C-G *
13468548-T-G 11312872-T-G *
13482167-A-G 11326491-A-G *
56884423-T-TAATATAATATA *
7179734-GTTTT-G 7311693-GTTTT-G 25×T*
28814112-C-G 26667965-C-G *
13541756-T-C 11386080-T-C *
13541746-C-A 11386070-C-A *
13541739-T-C 11386063-T-C *
13541725-G-A 11386049-G-A FGC55052 *
13349399-T-A 11193723-T-A *
13349387-T-C 11193711-T-C *
13478162-G-T 11322486-G-T *
13478406-G-T 11322730-G-T *
28813322-G-T 26667175-G-T *
13531044-C-A 11375368-C-A *
13552257-G-A 11396581-G-A *
13709938-C-T 11554262-C-T *
13611671-C-T 11455995-C-T *
13591312-T-C 11435636-T-C *
13573846-T-A 11418170-T-A *
13570107-T-C 11414431-T-C *
13564754-C-T 11409078-C-T *
13564751-T-C 11409075-T-C *
13562168-T-G 11406492-T-G *
13562159-A-T 11406483-A-T *
13562155-A-G 11406479-A-G *
13562145-A-C 11406469-A-C *
13555833-G-A 11400157-G-A *
13502529-A-G 11346853-A-G FT444455 *
28585184-A-T 26439037-A-T *
13540422-T-C 11384746-T-C *
13540389-G-A 11384713-G-A FGC82307 *
13533827-A-T 11378151-A-T *
13518160-A-G 11362484-A-G *
13514121-A-C 11358445-A-C *
13512551-A-G 11356875-A-G *
13503160-A-G 11347484-A-G *
13495343-T-C 11339667-T-C *
13495339-A-G 11339663-A-G *
13495140-C-T 11339464-C-T *
13495134-A-T 11339458-A-T *
13490986-T-C 11335310-T-C *
13489299-G-C 11333623-G-C *
28585182-A-T 26439035-A-T *
28585213-T-C 26439066-T-C *
13474277-C-A 11318601-C-A *
13491032-C-G 11335356-C-G *
13531041-A-G 11375365-A-G *
13528269-T-C 11372593-T-C *
13523973-C-T 11368297-C-T *
13512434-T-C 11356758-T-C *
13497600-C-G 11341924-C-G *
13495992-C-G 11340316-C-G *
13495006-A-G 11339330-A-G *
13495003-A-C 11339327-A-C *
13495000-G-C 11339324-G-C *
13493109-A-G 11337433-A-G *
13491095-T-C 11335419-T-C *
13491053-C-T 11335377-C-T *
13491034-A-C 11335358-A-C *
13491009-C-A 11335333-C-A *
28585305-C-A 26439158-C-A *
13489203-C-T 11333527-C-T *
13488880-G-A 11333204-G-A *
13435774-G-A 11280098-G-A *
13267068-G-T 11111392-G-T *
13253002-T-A 11097326-T-A *
13241943-G-A 11086267-G-A *
9980655-A-G 10143046-A-G Y*
9980641-T-C 10143032-T-C Y*
9944654-G-T 10107045-G-T Y*
9935903-A-G 10098294-A-G Y*
56856517-A-G *
56856512-A-C *
28814077-A-G 26667930-A-G *
13480963-G-A 11325287-G-A *
13464784-G-T 11309108-G-T *
13489731-GGCC-G 11334055-GGCC-G *
13489079-A-T 11333403-A-T *
4403543-GA-G 4535502-GA-G 8×A*
13578048-A-AGG 11422372-A-AGG *
13488957-G-GTT 11333281-G-GTT *
13488714-C-CA 11333038-C-CA *
13555817-T-A 11400141-T-A *
13493105-T-C 11337429-T-C *
9980244-C-G 10142635-C-G Y*
13474528-A-C 11318852-A-C *
4511190-G-T 4643149-G-T *
15410662-G-A 13298782-G-A YY*
13500346-G-GTTTATTTATTTA 11344670-G-GTTTATTTATTTA 5×TTTA*
13488857-G-A 11333181-G-A *
59003044-C-T 56856897-C-T *
5598178-G-GT 5730137-G-GT 10×T*
13338261-A-C 11182585-A-C *
13469987-G-A 11314311-G-A *
13598640-A-G 11442964-A-G *
9149727-T-G 9312118-T-G Y*
13469136-G-A 11313460-G-A *
13566453-C-A 11410777-C-A *
13566439-G-C 11410763-G-C *
13223339-C-A 11067663-C-A *
13461909-C-A 11306233-C-A *
11031310-C-G *
13489186-C-G 11333510-C-G *
28472101-T-TA 26325954-T-TA 10×A*
13509543-A-G 11353867-A-G BY21088 *
9965224-G-A 10127615-G-A Y*
27618019-G-T 25471872-G-T P1_Y2 *
3900194-CT-C 4032153-CT-C 12×T*
13464723-T-C 11309047-T-C *
9936695-T-C 10099086-T-C Y*
13464707-C-A 11309031-C-A *
13461366-C-G 11305690-C-G *
13461280-A-G 11305604-A-G *
13446264-C-T 11290588-C-T *
13445142-A-G 11289466-A-G *
13436108-C-G 11280432-C-G *
13385142-C-A 11229466-C-A *
13385128-T-G 11229452-T-G *
13385101-G-A 11229425-G-A *
10022375-G-A 10184766-G-A Y*
10022267-C-T 10184658-C-T Y*
9945339-G-C 10107730-G-C Y*
9945022-T-C 10107413-T-C Y*
3270914-G-T 3402873-G-T *
4537586-CTTT-C 4669545-CTTT-C 21×T*
13726739-C-T 11571063-C-T *
14134925-C-CT 12014219-C-CT 10×T*
13466863-T-A 11311187-T-A *
13466812-C-A 11311136-C-A *
13242263-G-T 11086587-G-T *
56884151-C-T *
13255809-TG-T,TGG 11100133-TG-T,TGG 12×G*
5400490-C-CT 5532449-C-CT 9×T*
4130101-A-AT 4262060-A-AT 13×T*
3949406-CAAAA-C 4081365-CAAAA-C 20×A*
3587292-CT-C,CTT 3719251-CT-C,CTT 22×T*
4182879-G-GA 4314838-G-GA 10×A*
5139267-A-AT 5271226-A-AT 11×T*
13499230-C-T 11343554-C-T *
13488839-C-A 11333163-C-A *
13512540-T-TCTAC 11356864-T-TCTAC *
10924711-G-GCCATT,GCCATT *
13269573-C-CAAAAA 11113897-C-CAAAAA 8×A*
13253344-G-C 11097668-G-C *
13253341-G-C 11097665-G-C *
13252394-A-ATTT 11096718-A-ATTT 11×T*
13249529-TATC-T 11093853-TATC-T *
13249527-A-G 11093851-A-G *
13242238-A-ATTATTTTTTTT 11086562-A-ATTATTTTTTTT *
13223341-A-G 11067665-A-G *
11000223-T-C *
11000214-T-C *
10969258-C-CTCCATTCCATTCCATTCCAT *
10961120-GCATTCCACTCCACTCCACTGCAGGACACTCCAGTCCACTCCTCTCCATTC-G *
10820482-C-T *
13324319-C-T 11168643-C-T *
10783181-C-T *
10677330-C-A *
9957997-T-C 10120388-T-C Y*
9945825-C-CT 10108216-C-CT *
9945780-G-GAAA 10108171-G-GAAA *
9640889-T-TTG,TTGTG 9803280-T-TTG,TTGTG IR3_Prx 22×TG*
9518594-TACAC-T,T 9680985-TACAC-T,T 14×AC*
9430084-CA-C 9592475-CA-C *
9345761-A-C 9508152-A-C Y*
9321175-G-A 9483566-G-A Y*
8741679-C-T 8873638-C-T YY*
8834770-T- *
8622896-TA-T 8754855-TA-T 9×A*
13320005-G-T 11164329-G-T *
13324320-T-G 11168644-T-G *
7717737-C-CTTCCTTCTTTCT,CTTCTTTCT 7849696-C-CTTCCTTCTTTCT,CTTCTTTCT 13×TTCT*
13464785-G-T 11309109-G-T *
13475541-G-T 11319865-G-T *
13474474-A-C 11318798-A-C *
13474465-T-G 11318789-T-G *
13474438-A-C 11318762-A-C *
13474306-T-C 11318630-T-C *
13474276-C-T 11318600-C-T *
13472574-C-G 11316898-C-G *
13469930-CTG-C 11314254-CTG-C *
11312705-C- *
13466388-T-A 11310712-T-A *
13466385-AT-A 11310709-AT-A *
13465144-G-A,GCTGA 11309468-G-A,GCTGA *
13464790-A-T 11309114-A-T *
13464746-G-A 11309070-G-A *
13324323-G-A 11168647-G-A *
11305385-TGTAGGCAGATCCTAGAAAAGAGTTACATCACCTGGGTGATCAGTGCAGAGATATGTCACAATGCCACTATAGGTAGAGCCTAGAAAAGATTTACATGACCTAGGTGATCAGTGCAGAGATACATCGCAATGCCCCTGTAGGCAGGGCCTTGACAAGTGGTATATCACCTGGGTGATCATTGCAGGGATATGTCACAAAGCACCCA- *
13461001-AGCCTTGACAAGTGGTACATCACCTGGGTGATCATTGCAGGGATATGTCACAAAGCACCCTGTAGGCAGATCCTAGAAAAGAGTTACATCACCTGGGTGATCAGTGCAGAGATATGTCACAATGCCACTATAGGTAGAGCCTAGAAAAGATTTACATGACCTAGGTGATCAGTGCAGAGATACATCGCAATGCCCCTGTAGGCAGG-A 11305325-AGCCTTGACAAGTGGTACATCACCTGGGTGATCATTGCAGGGATATGTCACAAAGCACCCTGTAGGCAGATCCTAGAAAAGAGTTACATCACCTGGGTGATCAGTGCAGAGATATGTCACAATGCCACTATAGGTAGAGCCTAGAAAAGATTTACATGACCTAGGTGATCAGTGCAGAGATACATCGCAATGCCCCTGTAGGCAGG-A *
13454812-CATTCCATTCCATTCCATTCTATTCCATTCT-C 11299136-CATTCCATTCCATTCCATTCTATTCCATTCT-C *
13448695-ATTCCT-A 11293019-ATTCCT-A *
13448683-CCAT-C 11293007-CCAT-C *
13448679-CAT-C 11293003-CAT-C *
11292967-CCATT- *
13428986-A-T 11273310-A-T *
13377501-C-A 11221825-C-A *
13351056-G-A 11195380-G-A *
13351048-T-G 11195372-T-G *
13336370-C-G 11180694-C-G *
13331935-G-A 11176259-G-A *
8020221-CA-C,CAAA 8152180-CA-C,CAAA 22×A*
7534392-G-GTTTTTTTTTTT 7666351-G-GTTTTTTTTTTT 13×T*
11322457-A- *
56822102-T-TAA *
22359417-T-C 20197531-T-C DYZ19 *
13566569-G-A 11410893-G-A *
13470598-TG-T 11314922-TG-T *
13462097-C-T 11306421-C-T *
13474289-C-A 11318613-C-A *
13474278-T-A 11318602-T-A *
11306662-CT- *
56831676-A-AACTCCACTCC *
13516795-G-A 11361119-G-A *
9300240-AACACACACACAC-A,AACACACACACACAC 9462631-AACACACACACAC-A,AACACACACACACAC 20×AC*
56830256-TCCAC-T *
56830253-CA-C *
17426011-CCTTTT-C,C 15314131-CCTTTT-C,C 11×CTTTT*
13474442-C-A 11318766-C-A *
27484887-T-C 25338740-T-C P1_Y2 *
28787598-G-GGAAAA 26641451-G-GGAAAA *
13479141-G-T 11323465-G-T *
56876150-A-G *
56876123-GCAAAAAAAAAAAAAAAAAAAAAAAAA-G *
56865262-TA-T *
11333959-AC- *
13460805-T-G 11305129-T-G *
13241925-G-A 11086249-G-A *
13572331-C-T 11416655-C-T *
21085779-CA-C,CAAA 18923893-CA-C,CAAA 24×A*
8724780-AT-A 8856739-AT-A 9×T*
56829099-T-G,G *
11334089-TAC- *
13489326-T-C 11333650-T-C *
9957865-T-C 10120256-T-C Y*
7053426-GAAAA-G 7185385-GAAAA-G *
5035558-TTGTGTGTG-T,TTG 5167517-TTGTGTGTG-T,TTG 22×TG*
7006485-G-A 7138444-G-A Y*
6929160-A-ATTTTTTTTTTT 7061119-A-ATTTTTTTTTTT *
7050526-G- *
6918564-A-T 7050523-A-T YY*
6525768-C-CAAA 6657727-C-CAAA 24×A*
6402282-C-CTGTAAAATACCGACGTATATGTTATATTCTTCCATGTCGTAAAATACCGACGTATCTGTTATATTCGTCGGTGT 6534241-C-CTGTAAAATACCGACGTATATGTTATATTCTTCCATGTCGTAAAATACCGACGTATCTGTTATATTCGTCGGTGT *
5945467-C-CT,CTT 6077426-C-CT,CTT 25×T*
5936144-GTAGATATATATA-G 6068103-GTAGATATATATA-G *
5905918-G-T 6037877-G-T *
5574077-CTT-C,CTTT 5706036-CTT-C,CTTT 19×T*
5550322-G-T 5682281-G-T *
5373746-AC- *
5066184-CTTT-C 5198143-CTTT-C 22×T*
4983174-A-ATTTTT 5115133-A-ATTTTT 28×T*
10884843-A- *
4055267-T-A 4187226-T-A *
3682125-C-T 3814084-C-T *
3446607-C-CAAAA 3578566-C-CAAAA 25×A*
2812777-ATT-A,AT 2944736-ATT-A,AT 30×T*
2786580-C-T 2918539-C-T Y*
18576435-AACAC-A,AAC 16464555-AACAC-A,AAC 15×AC*
2759989-C-CGACAGAGCAAGACTCCATTTCAAAAAAAAAAAAAGTTATGTTGTATTCTCTTTTTTTTTTTTTTTGGA 2891948-C-CGACAGAGCAAGACTCCATTTCAAAAAAAAAAAAAGTTATGTTGTATTCTCTTTTTTTTTTTTTTTGGA *
11294083-CATTCT- *
56829155-T-A,A *
10893652-C-CCATTCCATTCCATTCCA *
13479153-C-T 11323477-C-T *
11329993-G- *
13474416-T-C 11318740-T-C *
13478131-GCA-G 11322455-GCA-G *
13478184-G-A 11322508-G-A *
7788735-C-CA 7920694-C-CA 10×A*
22509293-AC-A 20347407-AC-A DYZ19 *
26526565-T-TA 24380418-T-TA P1_Y1 *
24771297-AT-A 22625150-AT-A P3_b2 12×T*
24726171-A-AT 22580024-A-AT P3_b2 9×T*
24490815-C-T 22344668-C-T *
24422478-C-CAA,CAAAA 22276331-C-CAA,CAAAA 43×A*
24358446-GA-G 22212299-GA-G 8×A*
23843594-TTATC-T,T 21681708-TTATC-T,T 10×TATC*
21253456-AT- 21×T*
23025229-CAAAAAAAA-C,CA 20863343-CAAAAAAAA-C,CA 29×A*
22802868-A-ATTTTTTTTTTTTTTTTTTTTTTTTTTTT,ATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 20640982-A-ATTTTTTTTTTTTTTTTTTTTTTTTTTTT,ATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 32×T*
22520788-CAAAA-C,CAAAAA 20358902-CAAAA-C,CAAAAA 23×A*
22509297-TAGTG-T 20347411-TAGTG-T DYZ19 *
22473165-G-C 20311279-G-C DYZ19 *
27383081-A-T 25236934-A-T P1_g3 *
22448939-GTTCGTGTTCTTGCTCACTTCTTTAATGAAGCTGCAGACCTTACTGGTGAGTATTACAGCACTTAAATGTGTTATGTCCAGAGATTGTTTCTCCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGT-G 20287053-GTTCGTGTTCTTGCTCACTTCTTTAATGAAGCTGCAGACCTTACTGGTGAGTATTACAGCACTTAAATGTGTTATGTCCAGAGATTGTTTCTCCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGT-G DYZ19 *
22448396-G-C 20286510-G-C DYZ19 *
22448134-G-A 20286248-G-A DYZ19 *
22444973-G-T 20283087-G-T DYZ19 *
22367758-GTTTGTTCCTCCAGATGTGTCCAGTGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAGAATGAAGCTGCAGACTTTTGTGGTGAGTGTTACAGCAGTTAAAGTTGTTATGTCCACAA-G 20205872-GTTTGTTCCTCCAGATGTGTCCAGTGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAGAATGAAGCTGCAGACTTTTGTGGTGAGTGTTACAGCAGTTAAAGTTGTTATGTCCACAA-G DYZ19 *
22367558-G-T 20205672-G-T DYZ19 *
22319362-A-T,T 20157476-A-T,T DYZ19 *
22295440-G-A 20133554-G-A DYZ19 *
22289065-T-C 20127179-T-C DYZ19 *
22276819-G-T 20114933-G-T DYZ19 *
22271598-CTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAGAATTAAGCTGCAGACCTAGGTGGTGAGTGTTACAGCAATTATAGGTATTATGTCCAGAGTTTGTTCCGTCAGATGTGTCTAGAGTTTCTTTCTTCTGGCAGGTTCATGGTGTTGCTCTCTTCAAGAATGAAGCTGCAGACCTTAGTGGTGAGTGTTACAGCACTTAAAGTTGTTATGTCCAGAGGTTGTTCG-C 20109712-CTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAGAATTAAGCTGCAGACCTAGGTGGTGAGTGTTACAGCAATTATAGGTATTATGTCCAGAGTTTGTTCCGTCAGATGTGTCTAGAGTTTCTTTCTTCTGGCAGGTTCATGGTGTTGCTCTCTTCAAGAATGAAGCTGCAGACCTTAGTGGTGAGTGTTACAGCACTTAAAGTTGTTATGTCCAGAGGTTGTTCG-C DYZ19 *
22235305-CA-C,C 20073419-CA-C,C DYZ19 *
22230231-CATTCTTGAAGTGAGCAAGACCACGAACCTGCCCGAAGGAAGAAACTCTGGACACATGTGAAGGAACGAACACAGGATATAACACCATTAAGTGCTGTAAAACTCACCGTAAAGGTCTGCAGCATG-C 20068345-CATTCTTGAAGTGAGCAAGACCACGAACCTGCCCGAAGGAAGAAACTCTGGACACATGTGAAGGAACGAACACAGGATATAACACCATTAAGTGCTGTAAAACTCACCGTAAAGGTCTGCAGCATG-C DYZ19 *
27249290-AT-A 25103143-AT-A P1_g3 10×T*
28032086-G-GTT 25885939-G-GTT P1_Y2 10×T*
22218898-TTTGTTCCTTCAGATGTGTCCAGATA-T 20057012-TTTGTTCCTTCAGATGTGTCCAGATA-T DYZ19 *
56725074-G-A *
56884651-A-G *
56880715-C-G,G *
56870474-T-C,C *
56851299-A-AAGACATATCTCTGCACTGATCACCCCAGGGAGAGAATTCTTGTTTAGGCTCTGCCTACAGGGGGCTTTG,ATGACATATCTCTGCACTGATCACCCCAGGGAGAGAATTCTTGTTTAGGCTCTGCCTACAGGGGGCTTTG *
56848631-G-GA *
56839637-T-C,C *
56835896-T-C,TTACACTCTACTCCACTCCACTCCACGCCACTCCATTCCAC *
56835874-C-CACTCA *
56835867-G- *
56829168-C-G *
56829141-TTCCAGGCCATTTCTTTCGAG-T *
56825211-C-T *
56763421-T-G *
56718259-T-A *
28372162-AT-A 26226015-AT-A P1_gr2 9×T*
56718217-A-T *
56715916-G-C *
56715914-A-C *
56714999-A-T *
56707274-G-A *
56685915-G-T *
56685654-AG-A *
56678520-G-T *
26667871-ATTGGAGTGG- *
26667868-TG- *
28802585-A-T 26656438-A-T *
28802574-GAATTGAA-G 26656427-GAATTGAA-G *
28529256-G-T 26383109-G-T *
22224656-AC-A 20062770-AC-A DYZ19 *
21991117-A-G 19829231-A-G YY*
13478913-C-A 11323237-C-A *
13487246-C-A 11331570-C-A *
12666523-CT-C,C *
14575149-A-G 12463349-A-G Y*
14031696-C-CTCTTTCTTTCTT,CTCTTTCTTTCTTTCTT 11910990-C-CTCTTTCTTTCTT,CTCTTTCTTTCTTTCTT 13×TCTT*
14025988-GAGAA-G,G 11905282-GAGAA-G,G 13×AGAA*
13737424-G-T 11581748-G-T *
13730065-G-A 11574389-G-A *
11553522-ATGGAATGGAATGGAATGGAATGGAATGGAAT- *
13564453-G-GA 11408777-G-GA *
13515908-A-G 11360232-A-G *
13489286-TG-T 11333610-TG-T *
13487296-G-A 11331620-G-A *
13487277-G-GAATT 11331601-G-GAATT *
13487271-GCTAA-G 11331595-GCTAA-G *
13487224-T-G 11331548-T-G *
15290981-T-TA 13179080-T-TA *
13487220-G-A 11331544-G-A *
13484129-A-T 11328453-A-T *
13480965-C-A 11325289-C-A *
13480275-C-G 11324599-C-G *
13479316-C-A 11323640-C-A *
13479154-C-G 11323478-C-G *
13479123-G-A 11323447-G-A *
13479117-GCT-G 11323441-GCT-G *
13479088-G-T 11323412-G-T *
13478981-T-C 11323305-T-C *
13478943-G-A 11323267-G-A *
13478936-G-T 11323260-G-T *
13478921-C-T 11323245-C-T *
15049908-A-T 12937999-A-T YY*
13197843-C-CAAAAAAAAAAAAAAA 42×A*
21914028-T-G 19752142-T-G Y*
18804474-AAG-A,AAGAG 16692594-AAG-A,AAGAG 26×AG*
21632798-T-A 19470912-T-A Y*
21613137-T-A,A 19451251-T-A,A *
21528541-T-TA,TA 19366655-T-TA,TA 10×A*
21402181-C-CTTTTTTTTTTTTTTT 19240295-C-CTTTTTTTTTTTTTTT 34×T*
21328805-CAAAAA-C,CAAA 19166919-CAAAAA-C,CAAA 30×A*
21078745-TA-T 18916859-TA-T 8×A*
20842517-G-GGAAAGAAAGAAA,GGAAAGAAAGAAAGAAA 18680631-G-GGAAAGAAAGAAA,GGAAAGAAAGAAAGAAA P4_Dst 14×GAAA*
19437809-A-AG 17325929-A-AG *
19437806-G-T 17325926-G-T Y*
19405055-AT-A,A 17293175-AT-A,A 10×T*
19206741-TAAAA-T,TAAA 17094861-TAAAA-T,TAAA 29×A*
19059747-C-CTTTTT 16947867-C-CTTTTT 25×T*
19052414-CA-C,CAAA 16940534-CA-C,CAAA 24×A*
18647581-CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-C,CT 16535701-CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-C,CT 56×T*
15410663-T-A 13298783-T-A YY*
18539819-T-C 16427939-T-C Y*
18017156-C-T 15905276-C-T Y*
15849087-T- *
15480466-T- *
17446767-CTT-C,CTTTTTT 15334887-CTT-C,CTTTTTT 33×T*
16904664-C-CAAAAAAAAAAAA,CAAAAAAAAAAAA 14792784-C-CAAAAAAAAAAAA,CAAAAAAAAAAAA 40×A*
16834746-CAA-C,CAAAAAA 14722866-CAA-C,CAAAAAA 45×A*
16648115-GTTT-G,GTTTTTTT 14536235-GTTT-G,GTTTTTTT 29×T*
16642970-G-GAAATAATATATAGTAAAATCCATATACATCTATA 14531090-G-GAAATAATATATAGTAAAATCCATATACATCTATA *
16598984-CA-C,CAAAA 14487104-CA-C,CAAAA 25×A*
16535053-C-CTTTT 14423173-C-CTTTT 35×T*
15411308-C-CAAAAAAAAAA 13299428-C-CAAAAAAAAAA 30×A*
15410664-G-A 13298784-G-A YY*
13464774-C-A 11309098-C-A *
28787594-AG-A 26641447-AG-A *
13512543-C-CTATATT 11356867-C-CTATATT *
13479271-C-A 11323595-C-A *
13481463-A-AGAAG 11325787-A-AGAAG *
13469153-A-G 11313477-A-G *
10673070-TGA-T *
10673069-A-ACTCCTTCCACTCCATT *
10038879-C-T 10201270-C-T FT376758 *
4834245-T-TA,TAAA 4966204-T-TA,TAAA 23×A*
56856716-GATAC-G *
13557839-A-G 11402163-A-G *
13532282-A-G 11376606-A-G *
13532249-C-T 11376573-C-T *
13488247-G-C 11332571-G-C *
13484140-G-T 11328464-G-T *
13463427-G-T 11307751-G-T *
56833283-C-CTCCATTCCACTCTACTCCCCTCCACTCCACTCCAT *
13463411-G-A 11307735-G-A *
13462034-G-C 11306358-G-C *
13462029-C-A 11306353-C-A *
13445461-GGCA-G 11289785-GGCA-G *
28797895-G-A 26651748-G-A *
13607564-A-C 11451888-A-C *
13607561-T-C 11451885-T-C *
13607558-G-C 11451882-G-C *
13535446-A-ACAATGCCATACCAT 11379770-A-ACAATGCCATACCAT *
13479044-C-A 11323368-C-A *
13479031-C-G 11323355-C-G *
13478996-C-A 11323320-C-A *
13478993-T-A 11323317-T-A *
13508326-A-AGCTC 11352650-A-AGCTC *
13489767-C-CG 11334091-C-CG *
13478378-T-A 11322702-T-A *
56826854-T-C *
13364146-CAA-C,CA 11208470-CAA-C,CA 26×A*
10022429-A-G 10184820-A-G Y*
10022422-G-C 10184813-G-C Y*
13488851-CGGT-C 11333175-CGGT-C *
13477329-G-T 11321653-G-T *
13477320-C-T 11321644-C-T *
13477310-G-C 11321634-G-C *
13477306-G-C 11321630-G-C *
13477298-G-T 11321622-G-T *
13477291-C-A 11321615-C-A *
13477286-G-C 11321610-G-C *
13468384-G-GTAAT 11312708-G-GTAAT *
7451043-T-TA 7583002-T-TA IR1_L 13×A*
18255888-TAAAA-T,TAAAAA 16144008-TAAAA-T,TAAAAA 22×A*
56826011-C-A,CATTCGATTGCA *
13461960-G-C 11306284-G-C *
10678044-C-CCATTCCATTCCATTCCAT *
13514097-C-T 11358421-C-T *
13481003-A-T 11325327-A-T *
13481001-T-A 11325325-T-A *
13468527-A-C 11312851-A-C *
13463862-C-T 11308186-C-T *
13463837-GTTTTC-G 11308161-GTTTTC-G *
56834087-C-CACTCT *
13480952-A-T 11325276-A-T *
13480951-C-G 11325275-C-G *
13448141-T-TAA 11292465-T-TAA *
56881416-C-CG,G *
13478976-G-A 11323300-G-A *
13477301-G-T 11321625-G-T *
13735077-G-T 11579401-G-T *
13463230-G-C 11307554-G-C *
13339675-GAGTCTGAAT-G 11183999-GAGTCTGAAT-G *
13223277-GAAGGAGGAGAGGGAGAGA-G 11067601-GAAGGAGGAGAGGGAGAGA-G *
9957979-A-C 10120370-A-C Y*
28807437-A-T 26661290-A-T *
13689019-A-T 11533343-A-T *
13488229-C-T 11332553-C-T *
13488219-G-A 11332543-G-A *
13479085-C-T 11323409-C-T *
13471556-GTC-G 11315880-GTC-G *
13468392-G-C 11312716-G-C *
13463870-T-A 11308194-T-A *
13463836-C-CAGCCT 11308160-C-CAGCCT *
13463246-C-T 11307570-C-T *
13428971-C-T 11273295-C-T *
13699090-T-A 11543414-T-A *
13428942-C-G 11273266-C-G *
13428931-G-A 11273255-G-A *
13353803-T-C 11198127-T-C *
10678996-CCACTCCAG-C *
10678993-ATT-A *
10678942-C-CATTCCACTCCATTTCATTCCATTCCATACT *
9980252-C-T 10142643-C-T BY82375 Y*
9980251-G-A 10142642-G-A FT462866 Y*
56884023-A-AG *
56829850-CCA-C *
22509626-G-A 20347740-G-A DYZ19 *
22509607-T-G 20347721-T-G DYZ19 *
13521321-A-T 11365645-A-T *
13474398-A-T 11318722-A-T *
56867498-T-A,A *
13474776-A-C 11319100-A-C *
13465137-CCAGG-C 11309461-CCAGG-C *
13448871-CTTCATTCCATTCCACTCCACTCCAG-C 11293195-CTTCATTCCATTCCACTCCACTCCAG-C *
22238317-T-G,G 20076431-T-G,G DYZ19 *
13711747-TGGAAC-T 11556071-TGGAAC-T *
13705499-TGGAATGGAA-T 11549823-TGGAATGGAA-T *
13545394-AGAAAGAAG-A 11389718-AGAAAGAAG-A *
56885136-A-T *
14609847-G-T 12498049-G-T YY*
13707391-TAC-T 11551715-TAC-T *
13449362-T-TCCACTCCAC 11293686-T-TCCACTCCAC *
22487051-C-G 20325165-C-G BY224883 DYZ19 *
3456712-A-G 3588671-A-G *
13479308-T-G 11323632-T-G *
13476578-C-A 11320902-C-A *
13463815-C-G 11308139-C-G *
13377753-C-G 11222077-C-G *
13463239-C-T 11307563-C-T *
13269593-A-C 11113917-A-C *
56880822-T-A,TTA *
56860815-TA-T,TAA 8×A*
13451468-GCATTC-G 11295792-GCATTC-G *
13449960-T-TTCCATTCCATACCATTCCATTCCATTGCATTCCACTCCATTCCACTCCACTCCAATCAACTCCGCTCCACTCCACTCCACTTCACTCCAATCCACTCCAC 11294284-T-TTCCATTCCATACCATTCCATTCCATTGCATTCCACTCCATTCCACTCCACTCCAATCAACTCCGCTCCACTCCACTCCACTTCACTCCAATCCACTCCAC *
13264337-C-A 11108661-C-A *
9966625-C-T 10129016-C-T Y*
9960520-C-A 10122911-C-A Y*
9960519-G-A 10122910-G-A Y*
9187277-G-GA 9349668-G-GA 10×A*
56849793-GGGCATTTTGACATATCTCTGCACTGATCAACGAGATGATGTAACTCTTGTCTGGGCTTTGCCTACAGGA-G *
13483369-C-A 11327693-C-A *
13688235-T-TG 11532559-T-TG *
13735080-A-C 11579404-A-C *
28787587-GGAGT-G 26641440-GGAGT-G *
13465076-A-T 11309400-A-T *
56836310-T-TTCCCTTCCATTCCAG *
56836290-T-TTGTATTCCAA *
15566817-GA-G,GAA 13454937-GA-G,GAA 22×A*
13351055-T-C 11195379-T-C *
56707629-G-C *
13469937-C-CAT 11314261-C-CAT *
13270406-C-A 11114730-C-A *
56843830-T-TTGCCTACAGGGGACATTTTGACATAGCTCTGCACTGATCACCCGGGTGATGCAACTCTTCTCTATGTTC,TTGCCTACAGGGGACTTTTTGACATAGCTCTGCACTGATCACCCGGGTGATGCAACTCTTCTCTATGTTC *
13469110-C-A 11313434-C-A *
13466419-C-T 11310743-C-T *
13466401-C-T 11310725-C-T *
11557481-TGGCATCGAGTGGAA- *
13461996-G-C 11306320-G-C *
13470002-C-T 11314326-C-T *
28802570-AATT-A 26656423-AATT-A *
19500150-GTAGA-G,G 17388270-GTAGA-G,G 14×TAGA*
11333951-CACCA- *
13489311-G-A 11333635-G-A *
13465072-G-T 11309396-G-T *
13448836-CTCCATTCCATTCCACTACAGTCCAT-C 11293160-CTCCATTCCATTCCACTACAGTCCAT-C *
56856117-A-AG,G *
13474695-A-T 11319019-A-T *
56724494-G-T *
26672861-GAA- *
13734924-CT-C 11579248-CT-C *
13734908-T-A 11579232-T-A *
11578462-AATTGAATGTC- *
13249484-C-A 11093808-C-A *
19126436-C-CAAAAAAAAAAAA,CAAAAAAAAAAAAA 17014556-C-CAAAAAAAAAAAA,CAAAAAAAAAAAAA 25×A*
13692959-G-A 11537283-G-A *
56859641-G-A *
21751871-TCCCA-T *
10860948-C-T *
5869983-T-C 6001942-T-C *
56877581-T-G,G *
7275186-C-A 7407145-C-A YY*
13489217-C-A 11333541-C-A *
10673071-G- *
19048394-G-T,T 16936514-G-T,T *
13476222-G-T 11320546-G-T *
13481508-T-C 11325832-T-C *
13687053-G-T,T 11531377-G-T,T *
13469168-G-T 11313492-G-T *
5905921-T-A 6037880-T-A *
56833848-T- *
11308163-T- *
56833847-C- *
56830739-T-C,TC *
56830738-T-TCCAC *
13491117-T-G 11335441-T-G *
4251034-T-A 4382993-T-A *
28814109-C-G 26667962-C-G *
28814108-A-G 26667961-A-G *
11550435-ATGGT- *
11550433-GC- *
22508965-T-A 20347079-T-A DYZ19 *
13487245-G-T 11331569-G-T *
13478134-T-TGC 11322458-T-TGC *
13477271-C-A 11321595-C-A *
11556073-GAACGGAATGGAATTAAATGGAACGGAATGGAATGGCATGGAATGGAATGGCATGGCATGGAATGGAATGGAATGGAATGGAATGA- *
11294087-CTATT- *
13735083-A-C 11579407-A-C *
56878253-G-GCA,GCACACACACA 9×CA*
13707394-C-CGT 11551718-C-CGT *
13466403-G-C 11310727-G-C *
11308849-T- *
11314434-A- *
11314433-CAA- *
11294078-AACCCCATTCT- *
13445466-A-AGG 11289790-A-AGG *
9469799-G- *
23488834-T-TAAAA 21326948-T-TAAAA 30×A*
22438600-C-T 20276714-C-T DYZ19 *
13737378-C-G 11581702-C-G *
13470516-A-G 11314840-A-G *
17592341-G-T 15480461-G-T YY*
13705871-C-T 11550195-C-T *
22486683-G-C 20324797-G-C DYZ19 *
13638914-A-G 11483238-A-G *
13565519-A-G 11409843-A-G *
13484174-A-T 11328498-A-T *
9941558-G-A 10103949-G-A Y*
56860676-A-ACACAC *
13464745-G-A 11309069-G-A *
9980624-AG-A 10143015-AG-A *
9980623-T-C 10143014-T-C Y*
9980606-CAAGTTATAGTACTT-C 10142997-CAAGTTATAGTACTT-C *
28805519-T-A 26659372-T-A BY227413 *
28805516-T-A 26659369-T-A *
13735135-TGAA-T 11579459-TGAA-T *
13735131-GGA-G 11579455-GGA-G *
17274963-C-CAGAT,CAGAT 15163083-C-CAGAT,CAGAT 11×AGAT*
9959876-TAATAATA-T 10122267-TAATAATA-T *
56685916-G-C *
13489270-C-T 11333594-C-T *
16242632-T-TTCTATCTA,TTCTATCTA 14130752-T-TTCTATCTA,TTCTATCTA 10×TCTA*
11333956-CCCA- *
11322586-G- *
9965062-T-A 10127453-T-A Y*
5960696-A-ATTT 6092655-A-ATTT 30×T*
4964729-A-AT,AT 5096688-A-AT,AT 34×T*
10042948-A-T 10205339-A-T *
28549803-G-T 26403656-G-T *
22510713-G-C 20348827-G-C DYZ19 *
13611827-AACCTTTTTTTT-A 11456151-AACCTTTTTTTT-A *
13533275-T-G 11377599-T-G *
13533236-C-T 11377560-C-T *
11334058-C- *
11314479-CAG- *
13448050-C-G 11292374-C-G *
13419864-C-T 11264188-C-T *
10022452-C-T 10184843-C-T Y*
10022444-G-GCC 10184835-G-GCC *
10022441-CCT-C 10184832-CCT-C *
13636496-G-C 11480820-G-C *
13586628-C-T 11430952-C-T *
13586599-G-A 11430923-G-A *
13586592-A-G 11430916-A-G *
13529383-G-GA 11373707-G-GA *
13518170-G-GAAAA 11362494-G-GAAAA *
13490340-T-TGAACTCATCATTTTTTATGGC 11334664-T-TGAACTCATCATTTTTTATGGC *
13478979-C-T 11323303-C-T *
13464739-T-C 11309063-T-C *
3456714-C-A 3588673-C-A *
13461793-T-C 11306117-T-C *
13512418-C-T 11356742-C-T *
13252624-A-C 11096948-A-C *
13354407-G-A 11198731-G-A *
13345777-A-G 11190101-A-G *
13345697-G-A 11190021-G-A *
13297889-G-C 11142213-G-C *
13294211-C-T 11138535-C-T *
13290692-G-C 11135016-G-C *
13287971-C-CTA 11132295-C-CTA *
13273371-CT-C 11117695-CT-C 10×T*
13269070-G-A 11113394-G-A *
13265768-C-T 11110092-C-T *
13265694-A-C 11110018-A-C *
13262052-T-G 11106376-T-G *
13261921-G-T 11106245-G-T *
13242241-C-T 11086565-C-T 21×T*
13368271-C-T 11212595-C-T *
10023952-G-GTC 10186343-G-GTC *
10022560-T-C 10184951-T-C Y*
9984808-G-T 10147199-G-T Y*
9980539-T-C 10142930-T-C Y*
9966617-G-A 10129008-G-A Y*
9964922-T-C 10127313-T-C Y*
9945815-A-G 10108206-A-G Y*
9935898-G-C 10098289-G-C Y*
7613833-G-GAA 7745792-G-GAA 31×A*
6403259-A-G 6535218-A-G *
6093307-G-A 6225266-G-A *
5842532-A-C 5974491-A-C *
5832276-C-T 5964235-C-T *
5756916-GTA-G 5888875-GTA-G 8×TA*
13354558-G-T 11198882-G-T *
13392071-A-T 11236395-A-T *
5470942-C-CAT 5602901-C-CAT 8×AT*
13524998-C-T 11369322-C-T *
13570120-A-AG 11414444-A-AG *
13570109-C-T 11414433-C-T *
13568831-G-T 11413155-G-T *
13568814-C-T 11413138-C-T *
13568803-C-T 11413127-C-T *
13562208-C-G 11406532-C-G *
13561548-G-A 11405872-G-A *
13555877-G-C 11400201-G-C *
13555848-G-T 11400172-G-T *
13542486-T-C 11386810-T-C *
13541791-T-G 11386115-T-G *
13541762-GA-G 11386086-GA-G *
13530029-T-C 11374353-T-C *
13524938-A-G 11369262-A-G *
13392768-CA-C 11237092-CA-C 11×A*
13516886-A-G 11361210-A-G *
13510711-T-C 11355035-T-C *
13507536-A-C 11351860-A-C *
13502510-T-C 11346834-T-C *
13502468-A-G 11346792-A-G *
13495116-T-G 11339440-T-G *
13495092-A-G 11339416-A-G *
13495077-T-C 11339401-T-C *
13445111-T-A 11289435-T-A *
13445083-A-G 11289407-A-G *
13439635-C-A 11283959-C-A *
13435690-C-A 11280014-C-A *
13415704-C-G 11260028-C-G *
13400470-G-A 11244794-G-A *
5535149-C-CTA 5667108-C-CTA 10×TA*
5434003-AAT-A 5565962-AAT-A 8×AT*
13571106-C-T 11415430-C-T *
13729555-AAATGG-A 11573879-AAATGG-A 4×AATGG*
3522968-TAA-T 3654927-TAA-T 24×A*
28812236-A-G 26666089-A-G *
22278704-A-G 20116818-A-G DYZ19 *
13446281-A-T 11290605-A-T *
14320651-C-CT 12199945-C-CT 12×T*
10022421-T-G 10184812-T-G Y*
13530026-A-G 11374350-A-G *
13258700-A-G 11103024-A-G *
27248568-GT-G 25102421-GT-G P1_g3 18×T*
9957867-G-T 10120258-G-T Y*
5275986-T-A 5407945-T-A *
5653225-TA-T 5785184-TA-T 10×A*
13471842-T-A 11316166-T-A *
13445160-G-T 11289484-G-T *
13496180-C-T 11340504-C-T *
28680956-C-CA 26534809-C-CA 14×A*
7481350-GT-G 7613309-GT-G IR1_L 12×T*
17622756-A-C 15510876-A-C YY*
7053430-A-G 7185389-A-G DF81Y7514 YY*
13512468-T-A 11356792-T-A *
18612759-GTATATA-G 16500879-GTATATA-G 15×TA*
4015479-T-TA 4147438-T-TA 12×A*
28586490-G-T 26440343-G-T *
13495012-A-G 11339336-A-G F18188 *
13493046-C-A 11337370-C-A *
13708060-C-G 11552384-C-G *
22298554-A-C 20136668-A-C DYZ19 *
22298549-G-C 20136663-G-C DYZ19 *
18556556-C-CTG 16444676-C-CTG 15×TG*
5308799-TAG-T 5440758-TAG-T 19×AG*
13729558-T-A 11573882-T-A *
5393984-CTG-C 5525943-CTG-C 12×TG*
3580080-A-G 3712039-A-G *
5262903-T-C 5394862-T-C *
4870623-CGT-C 5002582-CGT-C 8×GT*
4611093-T-A 4743052-T-A *
4489035-A-G 4620994-A-G FGC76628 *
4419900-C-T 4551859-C-T *
4417098-G-C 4549057-G-C *
4416011-T-C 4547970-T-C *
4409982-C-T 4541941-C-T FGC78461 *
4251032-TC-T 4382991-TC-T *
3607971-T-C 3739930-T-C *
3607966-A-G 3739925-A-G *
3607929-C-A 3739888-C-A *
3582771-C-G 3714730-C-G *
3580161-A-G 3712120-A-G *
3509668-TTA-T 3641627-TTA-T 9×TA*
28818842-G-T 26672695-G-T *
2945498-T-G 3077457-T-G FT315510 *
13568858-T-C 11413182-T-C *
13568873-T-C 11413197-T-C *
13641262-C-T 11485586-C-T *
4794855-C-CTT 4926814-C-CTT 21×T*
13275929-A-AT 11120253-A-AT *
13265722-C-G 11110046-C-G *
13637141-C-T 11481465-C-T *
13507935-C-A 11352259-C-A *
13503131-A-C 11347455-A-C *
13276363-T-C 11120687-T-C *
21412299-C-A 19250413-C-A YY*
20570096-A-C 18408210-A-C P5_Dst *
28818843-G-T 26672696-G-T *
13570848-C-T 11415172-C-T *
13571109-A-C 11415433-A-C *
17527354-GTA-G 15415474-GTA-G 10×TA*
9980117-A-T 10142508-A-T Y*
13436088-T-C 11280412-T-C *
13432989-G-T 11277313-G-T *
13432987-A-G 11277311-A-G *
13404362-C-T 11248686-C-T *
13393194-G-A 11237518-G-A *
13385108-T-C 11229432-T-C *
13363155-AC-A 11207479-AC-A *
13317207-A-G 11161531-A-G *
13270307-G-A 11114631-G-A BY3638 A12511 *
13265535-G-T 11109859-G-T *
13263305-C-T 11107629-C-T *
10022206-G-T 10184597-G-T Y*
9980246-G-GTA 10142637-G-GTA *
9980103-T-C 10142494-T-C Y*
13442215-C-A 11286539-C-A *
9966703-T-A 10129094-T-A Y*
9966699-A-T 10129090-A-T Y*
9966655-C-G 10129046-C-G Y*
9957962-C-T 10120353-C-T Y*
9945722-C-A 10108113-C-A Y*
9825016-C-T 9987407-C-T M6908 Y*
9824984-TAC-T 9987375-TAC-T 9×AC*
9533796-ATG-A 9696187-ATG-A IR3_Prx 8×TG*
8597725-GAC-G 8729684-GAC-G *
8435653-AGT-A 8567612-AGT-A *
8321465-GTTTA-G 8453424-GTTTA-G 5×TTTA*
7942792-C-CA 8074751-C-CA 9×A*
6929158-TGA-T 7061117-TGA-T *
6080638-TTC-T 6212597-TTC-T 9×TC*
13436126-T-C 11280450-T-C *
13445157-C-G 11289481-C-G *
9954759-C-T 10117150-C-T Y*
13691324-G-A 11535648-G-A *
28792783-C-G 26646636-C-G *
23596923-TTG-T 21435037-TTG-T *
22893365-CTTTCT-C 20731479-CTTTCT-C *
22361859-G-A 20199973-G-A FGC57796 DYZ19 *
17604931-G-GTT 15493051-G-GTT 24×T*
17192946-AAT-A 15081066-AAT-A *
16640210-TTA-T 14528330-TTA-T *
16612125-GTC-G 14500245-GTC-G 8×TC*
15430038-AAAT-A 13318158-AAAT-A 8×AAT*
13706886-T-A 11551210-T-A *
13705848-G-T 11550172-G-T *
13694652-G-A 11538976-G-A *
13691935-T-C 11536259-T-C *
13636683-G-T 11481007-G-T *
13461286-G-C 11305610-G-C *
13634792-C-T 11479116-C-T *
13591801-G-A 11436125-G-A Z20496 *
13569797-T-A 11414121-T-A *
13565182-A-G 11409506-A-G *
13561562-A-G 11405886-A-G *
13533357-C-G 11377681-C-G *
13523381-A-G 11367705-A-G *
13513622-A-G 11357946-A-G *
13507703-T-C 11352027-T-C *
13495327-T-C 11339651-T-C *
13494512-T-A 11338836-T-A *
13493016-G-T 11337340-G-T *
13469819-C-T 11314143-C-T BY210309 *
13461877-C-A 11306201-C-A *
9954766-G-C 10117157-G-C Y*
9954751-G-A 10117142-G-A BY82145 Y*
13578291-C-G 11422615-C-G *
23969674-AACAC-A 21823527-AACAC-A 20×AC*
59030836-AT-A 56884689-AT-A *
59030260-C-G 56884113-C-G *
59027107-C-A 56880960-C-A *
59000453-T-G 56854306-T-G *
58999284-G-A 56853137-G-A *
58998752-A-G 56852605-A-G *
58983155-CTGCACTCCACTCAAT-C 56837008-CTGCACTCCACTCAAT-C *
58969804-A-G 56823657-A-G *
28814062-G-T 26667915-G-T *
28814061-G-T 26667914-G-T *
28586503-C-T 26440356-C-T *
27484483-C-G 25338336-C-G P1_Y2 *
26099803-TTC-T 23953656-TTC-T P1_Y1 9×TC*
23293598-GTATATATA-G 21131712-GTATATATA-G 20×TA*
59030877-T-G 56884730-T-G *
22509031-A-T 20347145-A-T DYZ19 *
22442221-G-C 20280335-G-C BY219071 DYZ19 *
22339608-G-A 20177722-G-A DYZ19 *
17994851-CAA-C 15882971-CAA-C P7_Prx 17×A*
15717136-A-AT 13605256-A-AT 10×T*
15491909-ATG-A 13380029-ATG-A 16×TG*
14230241-GTAA-G 12109535-GTAA-G 6×TAA*
13939102-C-CT 11818396-C-CT *
13690735-A-C 11535059-A-C *
13637461-A-G 11481785-A-G *
13637085-C-G 11481409-C-G *
13611716-T-G 11456040-T-G *
13611684-C-A 11456008-C-A *
13611675-T-G 11455999-T-G *
59030876-C-T 56884729-C-T *
59030915-T-A 56884768-T-A *
9954750-T-G 10117141-T-G FGC25949 FT125378 Y*
4767593-A-AT 4899552-A-AT 12×T*
2807024-T-TTA 2938983-T-TTA 20×TA*
9980114-A-AT 10142505-A-AT *
13462255-G-A 11306579-G-A *
13489207-G-T 11333531-G-T *
13474522-C-A 11318846-C-A *
5344487-A-C 5476446-A-C *
13711230-A-T 11555554-A-T *
22030040-T-TA 19868154-T-TA 10×A*
13480927-C-A 11325251-C-A *
9960466-T-A 10122857-T-A Y*
5872243-CA-C 6004202-CA-C 15×A*
7758491-GT-G 7890450-GT-G 17×T*
13691089-T-C 11535413-T-C *
17919855-G-GAAAAAAAAA 15807975-G-GAAAAAAAAA 25×A*
58875797-T-C 56715074-A-G *
22312614-T-G 20150728-T-G DYZ19 *
58875791-T-A 56715080-A-T *
13294311-T-A 11138635-T-A *
13362360-CA-C 11206684-CA-C 19×A*
5275985-C-A 5407944-C-A *
9994866-A-ATTATTAAT 10157257-A-ATTATTAAT *
9994873-G-A 10157264-G-A Y*
3912233-CT-C 4044192-CT-C 14×T*
28529232-C-CA 26383085-C-CA 23×A*
23702223-GT-G 21540337-GT-G 14×T*
28802562-T-A 26656415-T-A *
28802561-A-G 26656414-A-G *
13740309-T-G 11584633-T-G *
28802556-A-G 26656409-A-G *
13705110-T-A 11549434-T-A *
13487795-G-A 11332119-G-A *
13436080-AT-A 11280404-AT-A 8×T*
28796138-G-C 26649991-G-C *
22278618-T-A 20116732-T-A DYZ19 *
13735161-C-G 11579485-C-G *
13463400-T-C 11307724-T-C *
13477148-C-T 11321472-C-T *
7567753-C-CT 7699712-C-CT 25×T*
13465627-T-G 11309951-T-G *
9961275-C-T 10123666-C-T Y*
7514181-GA-G 7646140-GA-G 12×A*
13704457-TG-T 11548781-TG-T *
13465054-C-A 11309378-C-A *
13282490-G-C 11126814-G-C ZS218 *
58982008-A-C 56835861-A-C *
22278643-A-T 20116757-A-T DYZ19 *
22278623-T-G 20116737-T-G DYZ19 *
28796394-T-G 26650247-T-G *
18019516-GTA-G 15907636-GTA-G 8×TA*
13729630-A-G 11573954-A-G *
13725518-C-T 11569842-C-T *
13725511-T-A 11569835-T-A *
13488215-C-A 11332539-C-A *
13488138-G-A 11332462-G-A *
13474411-G-A 11318735-G-A *
58977805-G-C 56831658-G-C *
27507582-CGT-C 25361435-CGT-C P1_Y2 10×GT*
13480930-G-A 11325254-G-A *
13278784-C-A 11123108-C-A *
58865968-C-T 56724903-G-A *
13470855-T-A 11315179-T-A *
13729039-G-C 11573363-G-C *
13489161-G-A 11333485-G-A *
13735162-A-G 11579486-A-G 4×AATGG*
28157262-AT-A 26011115-AT-A P1_b4 16×T*
8464409-A-AT 8596368-A-AT 11×T*
16547894-C-CA 14436014-C-CA 11×A*
6329684-AT-A 6461643-AT-A IR3_Dst 9×T*
7247686-TA-T 7379645-TA-T 11×A*
13445362-CAAAAAA-C 11289686-CAAAAAA-C 15×A*
3545398-GT-G 3677357-GT-G 13×T*
15557433-TA-T 13445553-TA-T 11×A*
13695654-AGGAAT-A 11539978-AGGAAT-A *
15469430-CA-C 13357550-CA-C 12×A*
28581630-GAT-G 26435483-GAT-G 19×AT*
13728881-A-C 11573205-A-C *
58884397-T-A 56706474-A-T *
13825531-C-T 11704825-C-T *
13480643-C-A 11324967-C-A *
9995103-A-C 10157494-A-C Y*
13748481-T-TGGAAC 11592805-T-TGGAAC *
6130125-T-A 6262084-T-A *
13720502-T-A 11564826-T-A *
13718603-G-C 11562927-G-C *
13718602-T-A 11562926-T-A *
9954778-T-A 10117169-T-A Y*
9954775-A-C 10117166-A-C Y*
13688377-G-A 11532701-G-A *
13704506-A-T 11548830-A-T *
13704502-T-C 11548826-T-C *
13694217-G-A 11538541-G-A *
9935908-G-C 10098299-G-C Y*
22295425-AGAAT-A 20133539-AGAAT-A DYZ19 *
13717115-G-C 11561439-G-C *
13278602-G-A 11122926-G-A *
9980082-G-C 10142473-G-C Y*
8702810-G-GT 8834769-G-GT 21×T*
9961301-G-A 10123692-G-A Y*
13278706-A-T 11123030-A-T *
22509011-TG-T 20347125-TG-T DYZ19 *
13572588-C-T 11416912-C-T *
13493962-C-T 11338286-C-T *
13478369-C-T 11322693-C-T *
13320507-G-C 11164831-G-C *
9958403-G-T 10120794-G-T Y*
28803674-T-C 26657527-T-C BY25683 *
22443234-C-G 20281348-C-G DYZ19 *
20684728-G-GA 18522842-G-GA P4_Prx 11×A*
9181072-CAT-C 9343463-CAT-C 14×AT*
13691558-A-G 11535882-A-G *
8974932-GA-G 9137323-GA-G 12×A*
13320995-T-G 11165319-T-G *
22510229-A-G 20348343-A-G DYZ19 *
13728803-T-C 11573127-T-C *
22441953-A-T 20280067-A-T DYZ19 *
13726560-C-G 11570884-C-G *
13712935-G-A 11557259-G-A BY25678 *
13704849-T-A 11549173-T-A *
13698598-A-G 11542922-A-G BY88976 *
13692492-T-A 11536816-T-A *
13691548-A-G 11535872-A-G BY27234 *
9932557-C-T 10094948-C-T Y*
28805484-A-C 26659337-A-C BY27841 *
25296840-TA-T 23150693-TA-T P2_r1 12×A*
25181200-TA-T 23035053-TA-T g1 12×A*
24929439-TAC-T 22783292-TAC-T g1 14×AC*
13694001-T-C 11538325-T-C *
13693993-A-C 11538317-A-C *
13691614-A-T 11535938-A-T *
18454815-CTTCT-C 16342935-CTTCT-C P6_Dst 10×TTCT*
18802027-CAA-C 16690147-CAA-C 16×A*
9992628-G-A 10155019-G-A BY82602 Y*
13572603-G-A 11416927-G-A *
13720554-C-G 11564878-C-G *
13720553-T-G 11564877-T-G *
13716588-C-A 11560912-C-A Z30759 *
13489277-A-T 11333601-A-T *
13489269-G-A 11333593-G-A *
18914179-TAC-T 16802299-TAC-T 13×AC*
13689148-G-A 11533472-G-A *
13278795-G-T 11123119-G-T *
24904490-CAA-C 22758343-CAA-C g1 17×A*
13729548-G-C 11573872-G-C *
13691560-CACGAATGGAATGGAG-C 11535884-CACGAATGGAATGGAG-C *
13688432-C-G 11532756-C-G *
9932571-A-C 10094962-A-C Y*
24931540-G-GA 22785393-G-GA g1 10×A*
13477154-C-G 11321478-C-G *
13701444-C-G 11545768-C-G *
13477153-T-A 11321477-T-A *
25376536-CT-C 23230389-CT-C P2_r2 24×T*
22508956-G-A 20347070-G-A DYZ19 *
22447160-G-T 20285274-G-T BY10245 DYZ19 *
24930128-CT-C 22783981-CT-C g1 20×T*
22476654-A-T 20314768-A-T BY208550 DYZ19 *
21714748-C-CAA 19552862-C-CAA 53×A*
13728858-T-C 11573182-T-C *
9992606-C-A 10154997-C-A Y*
9992607-A-G 10154998-A-G Y*
58975955-C-T 56829808-C-T *
13701443-T-G 11545767-T-G *
6137784-TA-T 6269743-TA-T IR3_Dst 12×A*
28787600-T-A 26641453-T-A *
21623520-AACAC-A 19461634-AACAC-A 19×AC*
22508768-C-G 20346882-C-G DYZ19 *
13463424-C-A 11307748-C-A *
13247486-C-T 11091810-C-T *
13488182-C-T 11332506-C-T *
9360666-G-C 9523057-G-C Y*
17669700-C-CAT 15557820-C-CAT 15×AT*
28369379-CA-C 26223232-CA-C P1_gr2 18×A*
13385103-C-T 11229427-C-T *
10022507-A-C 10184898-A-C Y*
13513955-A-G 11358279-A-G *
13494555-A-AT 11338879-A-AT 13×T*
10022318-A-AAATAAATG 10184709-A-AAATAAATG *
5689704-C-CATT 5821663-C-CATT 14×ATT*
27824063-G-GT 25677916-G-GT P1_Y2 10×T*
27610009-AAC-A 25463862-AAC-A P1_Y2 21×AC*
13253173-A-C 11097497-A-C *
5393293-A-C 5525252-A-C *
24207530-CT-C 22061383-CT-C P3_b1 14×T*
9341666-G-A 9504057-G-A Y*
9040207-A-AT 9202598-A-AT 16×T*
13340628-A-G 11184952-A-G *
13340609-A-G 11184933-A-G *
58905259-A-C 56685612-T-G *
13723026-T-A 11567350-T-A *
9965063-T-TAGG 10127454-T-TAGG *
23167802-CT-C 21005916-CT-C 10×T*
22922667-CT-C 20760781-CT-C 12×T*
8842943-TAAA-T 8974902-TAAA-T 22×A*
5528961-TA-T 5660920-TA-T 11×A*
13730431-G-C 11574755-G-C *
5308778-C-CTA 5440737-C-CTA 11×TA*
15794218-C-CA 13682338-C-CA 14×A*
8914172-C-CATT 9046131-C-CATT 13×ATT*
13726743-G-A 11571067-G-A *
13253192-C-T 11097516-C-T *
16309251-TA-T 14197371-TA-T 19×A*
22442215-T-C 20280329-T-C S27566 DYZ19 *
13531507-A-G 11375831-A-G F10891 *
13257668-G-T 11101992-G-T *
13253750-C-G 11098074-C-G *
9784749-TA-T 9947140-TA-T 11×A*
28147152-GCA-G 26001005-GCA-G P1_b4 13×CA*
13598705-AAC-A 11443029-AAC-A *
58883097-T-C 56707774-A-G *
58883081-A-T 56707790-T-A *
13523629-T-A 11367953-T-A *
13463318-C-T 11307642-C-T *
17143169-TA-T 15031289-TA-T 10×A*
16345135-CTCTTCT-C,CTCT 14233255-CTCTTCT-C,CTCT 18×TCT*
9361057-AAC-A 9523448-AAC-A 17×AC*
13253753-C-G 11098077-C-G *
58884398-G-T 56706473-C-A *
15290982-C-T 13179081-C-T Y17×T*
22439229-G-A 20277343-G-A BY22963 DYZ19 *
13531051-T-C 11375375-T-C *
13493079-C-G 11337403-C-G *
13265738-G-T 11110062-G-T *
13265743-C-T 11110067-C-T *
58995514-A-C 56849367-A-C *
13545353-AAAG-A 11389677-AAAG-A *
13721441-C-G 11565765-C-G *
17140510-CTTTT-C 15028630-CTTTT-C 19×T*
9654084-G-GA 9816475-G-GA IR3_Prx 14×A*
9961325-A-G 10123716-A-G Y*
13239513-CT-C 11083837-CT-C 17×T*
6147446-AT-A 6279405-AT-A IR3_Dst 19×T*
13445668-GAAA-G 11289992-GAAA-G 9×A*
13253161-G-A 11097485-G-A *
14116679-GATAC-G 11995973-GATAC-G 10×ATAC*
13702353-G-C 11546677-G-C *
13593553-C-T 11437877-C-T *
28787605-G-A 26641458-G-A *
9341086-G-C 9503477-G-C Y*
13720564-T-C 11564888-T-C *
10022256-T-G 10184647-T-G Y*
8202131-GA-G 8334090-GA-G 11×A*
13734927-A-G 11579251-A-G *
22083932-GA-G 19922046-GA-G 11×A*
13701682-T-A 11546006-T-A *
13695597-G-A 11539921-G-A *
13477143-T-C 11321467-T-C *
13463363-T-C 11307687-T-C *
9992627-T-C 10155018-T-C Y*
13462056-C-T 11306380-C-T *
9958069-T-A 10120460-T-A Y*
13545348-GA-G 11389672-GA-G *
13692132-G-A 11536456-G-A *
13472129-G-T 11316453-G-T *
13716368-G-T 11560692-G-T *
10025187-C-G 10187578-C-G Y*
10025176-G-A 10187567-G-A Y*
14413942-C-CT 12293239-C-CT 11×T*
9952233-A-T 10114624-A-T Y*
13494015-G-C 11338339-G-C *
20700644-CCA-C 18538758-CCA-C P4_Prx 8×CA*
8241973-C-CA 8373932-C-CA 11×A*
10022511-G-C 10184902-G-C Y*
8974419-AAC-A 9136810-AAC-A 9×AC*
25356955-TA-T 23210808-TA-T P2_r2 10×A*
13593554-A-G 11437878-A-G *
17009801-AAC-A 14897921-AAC-A 9×AC*
6699020-AT-A 6830979-AT-A 24×T*
13705510-G-C 11549834-G-C *
13474767-C-A 11319091-C-A *
13467849-G-A 11312173-G-A *
27162020-TA-T 25015873-TA-T P1_g3 18×A*
10022298-G-T 10184689-G-T CLD21 Y*
22251591-A-T 20089705-A-T DYZ19 *
10022250-C-A 10184641-C-A Y*
9191038-A-G 9353429-A-G Y*
10022228-A-G 10184619-A-G Y*
13246280-G-T 11090604-G-T *
24096349-CA-C 21950202-CA-C P3_b1 16×A*
20129006-CA-C 18017126-CA-C P5_Dst 11×A*
14986616-TTCTC-T 12874684-TTCTC-T 17×TC*
13351008-A-T 11195332-A-T *
13468452-T-C 11312776-T-C *
13468451-C-T 11312775-C-T *
10025140-C-T 10187531-C-T Y*
58884236-TCCGTTTGATGCCATC-T 56706617-TGGGATGGCATCAAAC-T *
23801733-C-CAAAAAAA 21639847-C-CAAAAAAA 31×A*
3300992-C-CA 3432951-C-CA 12×A*
15842558-T-TTTC 13730678-T-TTTC *
19048376-C-CAT 16936496-C-CAT 8×AT*
19827096-GA-G 17715216-GA-G P5_Prx 10×A*
27918646-G-GT 25772499-G-GT P1_Y2 11×T*
22298572-C-A 20136686-C-A BY22930 DYZ19 *
13689140-A-G 11533464-A-G BY88546 *
25356577-GA-G 23210430-GA-G P2_r2 11×A*
22362074-G-T 20200188-G-T DYZ19 *
22275688-C-A 20113802-C-A FGC74291 DYZ19 *
8097251-AT-A 8229210-AT-A 10×T*
23127414-C-CA 20965528-C-CA 24×A*
28792786-C-A 26646639-C-A *
28805283-C-T 26659136-C-T *
56851920-CT-C *
13461833-C-A 11306157-C-A *
5177121-C-CA 5309080-C-CA 15×A*
10678986-C-G *
10678974-C-A *
28496348-CAAA-C 26350201-CAAA-C 18×A*
22962008-GTT-G 20800122-GTT-G 27×T*
13474549-C-G 11318873-C-G *
13487458-G-A 11331782-G-A *
5022007-GAAA-G 5153966-GAAA-G 16×A*
3063726-T-TA 3195685-T-TA 13×A*
7329817-G-GT 7461776-G-GT 10×T*
28553992-C-CA 26407845-C-CA 28×A*
21919404-CTT-C 19757518-CTT-C 16×T*
14774253-CTT-C 12662322-CTT-C 28×T*
13269513-A-G 11113837-A-G *
11000216-A-C FT393224 *
13269494-AG-A 11113818-AG-A *
4072020-GGAGA-G 4203979-GGAGA-G 13×GA*
23590764-C-CAA 21428878-C-CAA 15×A*
15612199-TAC-T 13500319-TAC-T 8×AC*
5905922-C-A 6037881-C-A *
14609799-CA-C 12498001-CA-C 23×A*
22164376-C-CA 20002490-C-CA 22×A*
14495730-C-CA 12383927-C-CA 11×A*
13466426-C-A 11310750-C-A *
8788721-CT-C 8920680-CT-C 10×T*
13698826-T-A 11543150-T-A *
13698811-T-A 11543135-T-A *
17524166-TA-T 15412286-TA-T 10×A*
13726154-C-G 11570478-C-G *
16990018-C-CA 14878138-C-CA 9×A*
17734051-G-GA 15622171-G-GA 11×A*
56822465-C-T *
13488133-T-C 11332457-T-C *
13478405-C-G 11322729-C-G *
13478400-A-T 11322724-A-T *
10976158-C-G *
10976143-A-C *
10976140-G-T *
10976124-C-A *
10976110-T-C *
10976108-T-C *
10976105-C-T *
13472100-G-C 11316424-G-C *
13531566-C-T 11375890-C-T *
13531538-G-T 11375862-G-T *
13531536-G-A 11375860-G-A FT444826 *
5360467-CT-C 5492426-CT-C 11×T*
19206934-TTATA-T 17095054-TTATA-T 10×TA*
5461725-GT-G 5593684-GT-G 12×T*
9507982-C-CT 9670373-C-CT 34×T*
13547016-CT-C 11391340-CT-C 10×T*
18867339-C-CT 16755459-C-CT 24×T*
20712287-TACAC-T 18550401-TACAC-T P4_Prx 16×AC*
14510449-GAA-G 12398654-GAA-G 21×A*
13488693-C-A 11333017-C-A *
15449892-C-CTT 13338012-C-CTT 21×T*
4654941-TA-T 4786900-TA-T 11×A*
13474701-G-T 11319025-G-T *
22722338-C-CTT 20560452-C-CTT 24×T*
16308486-C-CTT 14196606-C-CTT 25×T*
14062010-CA-C 11941304-CA-C 34×A*
6734680-CTTTTTT-C 6866639-CTTTTTT-C 21×T*
13726149-T-C 11570473-T-C *
19346508-CT-C 17234628-CT-C 9×T*
56763486-C-G *
13498156-G-A 11342480-G-A *
18564316-CTTTTT-C 16452436-CTTTTT-C 19×T*
11001471-G-A *
28691900-T-TA 26545753-T-TA 13×A*
8214860-GTT-G 8346819-GTT-G 21×T*
2758842-CAAA-C 2890801-CAAA-C 19×A*
27423515-GTATA-G 25277368-GTATA-G P1_g3 24×TA*
2939684-C-G 3071643-C-G *
13468579-C-A 11312903-C-A *
13500887-T-G 11345211-T-G *
4848351-A-AATAT 4980310-A-AATAT 16×AT*
58981699-T-C 56835552-T-C *
13511130-T-G 11355454-T-G *
21175749-CA-C 19013863-CA-C 27×A*
9964551-C-A 10126942-C-A Y*
4976787-CAA-C 5108746-CAA-C 21×A*
13301792-T-C 11146116-T-C *
13511131-T-C 11355455-T-C *
59009226-A-AAACC 56863079-A-AAACC *
59006821-AAAAAATAC-A 56860674-AAAAAATAC-A *
13543628-ACAC-A 11387952-ACAC-A *
13491116-T-C 11335440-T-C FGC26046 *
22361925-G-T 20200039-G-T DYZ19 *
22361878-C-G 20199992-C-G DYZ19 *
13468144-G-C,T 11312468-G-C,T *
28549561-G-T 26403414-G-T *
58833997-C-G 56756874-G-C *
58833988-C-G 56756883-G-C *
7464037-CAAA-C 7595996-CAAA-C IR1_L 19×A*
14784701-C-CT 12672771-C-CT 22×T*
15151502-CAA-C 13039589-CAA-C 23×A*
7100954-C-CTT 7232913-C-CTT 32×T*
13489437-C-T 11333761-C-T *
13469949-T-A 11314273-T-A *
13487716-C-A 11332040-C-A *
11021391-C-A *
11021390-T-A *
8295594-G-GA 8427553-G-GA 10×A*
6346021-GTT-G 6477980-GTT-G 12×T*
17876459-G-GT 15764579-G-GT 10×T*
13470439-G-C 11314763-G-C *
56847660-G-T *
13472116-C-A 11316440-C-A *
7225743-C-CA 7357702-C-CA 11×A*
15697089-CAATA-C 13585209-CAATA-C 9×AATA*
14642670-C-CT 12530739-C-CT 10×T*
56834539-A-ACTCCG *
13483292-C-G 11327616-C-G *
2660546-A-AT 2792505-A-AT 14×T*
13445969-G-T 11290293-G-T *
2909234-CAA-C 3041193-CAA-C 16×A*
7001658-CT-C 7133617-CT-C 11×T*
10679019-T-C *
10679014-C-A *
8835383-A-AT 8967342-A-AT 10×T*
14893972-C-CT 12782038-C-CT 11×T*
8016938-CTTTTT-C 8148897-CTTTTT-C 25×T*
7364367-GTTT-G 7496326-GTTT-G 27×T*
6454448-GA-G 6586407-GA-G 12×A*
6013639-AT-A 6145598-AT-A 11×T*
5886175-C-CT 6018134-C-CT 19×T*
10847052-TCACTC-T *
16783412-T-TA 14671532-T-TA 13×A*
21556919-CTTTTTT-C 19395033-CTTTTTT-C 23×T*
56763467-C-G *
10672228-C-A *
13488891-C-T 11333215-C-T *
13462074-C-T 11306398-C-T *
15832216-CTTTT-C 13720336-CTTTT-C 22×T*
10046072-GATAT-G 10208463-GATAT-G 8×AT*
13476208-G-T 11320532-G-T *
13468519-C-T 11312843-C-T *
22996012-CAA-C,CA 20834126-CAA-C,CA 18×A*
13466389-G-T 11310713-G-T *
59021174-A-G 56875027-A-G *
56875026-C-T *
10804930-CTTCCA-C *
13496544-TTAAAA-T 11340868-TTAAAA-T *
13466893-C-G 11311217-C-G *
6418390-GA-G 6550349-GA-G 11×A*
13462127-C-A 11306451-C-A *
56707258-G-T *
9980602-C-A 10142993-C-A Y*
13474736-G-C 11319060-G-C *
13477105-T-G 11321429-T-G *
13451453-G-A 11295777-G-A *
16682626-TC-T 14570746-TC-T *
13705117-G-T 11549441-G-T *
6130166-A-C 6262125-A-C *
7210235-CA-C 7342194-CA-C 10×A*
28549311-C-T 26403164-C-T *
6313885-C-CA 6445844-C-CA IR3_Dst 9×A*
13488834-C-T 11333158-C-T *
5949671-TA-T 6081630-TA-T 10×A*
13488884-C-A 11333208-C-A *
13488778-C-A 11333102-C-A *
6752335-TG-T 6884294-TG-T 8×G*
9742586-C-CT 9904977-C-CT IR3_Prx 13×T*
13488724-G-C 11333048-G-C *
13480295-C-T 11324619-C-T *
13476750-G-A 11321074-G-A *
22237259-A-G 20075373-A-G DYZ19 *
56685695-C-G *
6020617-CA-C 6152576-CA-C 10×A*
13462141-C-A 11306465-C-A *
13351186-C-CA 11195510-C-CA 20×A*
56827225-T-C *
7383851-CAA-C 7515810-CAA-C 24×A*
13488157-C-G 11332481-C-G *
13463767-G-A 11308091-G-A *
6020688-GTT-G 6152647-GTT-G 23×T*
13469374-G-C 11313698-G-C *
4539033-TAAA-T 4670992-TAAA-T 24×A*
3205858-CAA-C 3337817-CAA-C 15×A*
20658693-A-C 18496807-A-C P4_Prx *
13488731-C-T 11333055-C-T *
21177056-TTA-T 19015170-TTA-T 11×TA*
8216388-A-AT 8348347-A-AT 9×T*
56853683-C-T *
27616507-T-A 25470360-T-A P1_Y2 *
13466477-C-A 11310801-C-A *
28478008-A-AT 26331861-A-AT 15×AT*
5008883-AT-A 5140842-AT-A 13×T*
10860945-G-C *
13691581-C-T 11535905-C-T BY1004 *
6048371-TTG-T 6180330-TTG-T 12×TG*
11001489-A-T *
7132850-C-A 7264809-C-A YY*
18518159-G-T 16406279-G-T P6_Dst *
10808621-C-A *
13468315-C-A 11312639-C-A *
16506766-CAAA-C 14394886-CAAA-C 19×A*
13480290-A-G 11324614-A-G *
5550320-G-T 5682279-G-T *
13474426-T-A 11318750-T-A *
56859782-C-T *
4393815-T-TA 4525774-T-TA 11×A*
10976109-T-A *
2665141-CAAA-C,CAA 2797100-CAAA-C,CAA 19×A*
16336897-GTTTT-G 14225017-GTTTT-G 23×T*
58979456-G-A 56833309-G-A *
3079722-T-TA 3211681-T-TA 14×A*
20101690-G-T 17989810-G-T P5_Dst *
9957975-G-A 10120366-G-A Y*
28700764-TAC-T 26554617-TAC-T 13×AC*
28482878-TAA-T 26336731-TAA-T 10×A*
2939150-C-CT 3071109-C-CT 10×T*
10976122-C-A *
13468033-G-A 11312357-G-A *
56884133-G-A *
22715144-T-TA 20553258-T-TA 23×A*
13712260-A-G 11556584-A-G *
7470700-CA-C,CAA 7602659-CA-C,CAA IR1_L 25×A*
7132840-T-A 7264799-T-A YY*
22011557-C-CA 19849671-C-CA 21×A*
5453891-CTTTT-C 5585850-CTTTT-C 19×T*
28583630-G-A 26437483-G-A *
13488692-T-A 11333016-T-A *
20568565-G-T 18406679-G-T P5_Dst *
14427419-CA-C 12306694-CA-C 12×A*
3164308-G-GA 3296267-G-GA 10×A*
16913280-GT-G 14801400-GT-G 10×T*
22335228-A-T 20173342-A-T DYZ19 *
13482147-G-T 11326471-G-T *
10673078-C-A *
17527400-G-GTA 15415520-G-GTA *
14884698-GAA-G 12772764-GAA-G 26×A*
13466406-G-C 11310730-G-C *
14297915-C-CCA 12177209-C-CCA 10×CA*
22263923-T-A 20102037-T-A DYZ19 *
13466369-C-A 11310693-C-A *
21132681-GTTTT-G 18970795-GTTTT-G 18×T*
13488895-G-T 11333219-G-T *
56685661-G-C *
5862539-C-CAT 5994498-C-CAT *
23886557-C-CT 21724671-C-CT 10×T*
56835862-TCCGTG-T *
14754067-C-CTT 12642136-C-CTT 27×T*
17351999-T-TA 15240119-T-TA 13×A*
56830423-C-A *
13474427-A-G 11318751-A-G *
3205874-CA-C 3337833-CA-C 11×A*
19346433-C-CCTTT,CCTTTCTTT 17234553-C-CCTTT,CCTTTCTTT 15×CTTT*
13725801-A-C 11570125-A-C *
13472072-C-A 11316396-C-A *
13487749-C-CAAAA 11332073-C-CAAAA *
8094338-GTA-G 8226297-GTA-G *
13336459-G-T 11180783-G-T *
13336447-G-T 11180771-G-T *
2651865-C-A 2783824-C-A Y*
7387396-AT-A,ATT 7519355-AT-A,ATT 22×T*
19555496-CT-C 17443616-CT-C 11×T*
8172687-CT-C,CTT 8304646-CT-C,CTT 22×T*
3194192-C-CA 3326151-C-CA 11×A*
2649802-CAAA-C,CAA 2781761-CAAA-C,CAA 24×A*
3435302-CT-C 3567261-CT-C 11×T*
3341780-GT-G 3473739-GT-G 11×T*
10022219-A-G 10184610-A-G Y*
13487846-C-A 11332170-C-A *
58970917-G-A 56824770-G-A *
13733917-G-T 11578241-G-T *
13701995-A-T 11546319-A-T *
13740294-C-A 11584618-C-A *
13487725-G-T 11332049-G-T *
13252749-A-G 11097073-A-G *
13252739-A-G 11097063-A-G *
10025135-G-A 10187526-G-A Y*
13252795-A-G 11097119-A-G *
13729613-G-T 11573937-G-T *
20453570-CT-C 18291684-CT-C P5_Dst 12×T*
13470865-G-C 11315189-G-C *
13470849-T-A 11315173-T-A *
9035388-C-CT 9197779-C-CT 10×T*
13470861-C-T 11315185-C-T *
15912459-TA-T 13800579-TA-T 11×A*
9298915-A-C 9461306-A-C Y*
16642893-G-A 14531013-G-A YY*
16642890-T-G 14531010-T-G YY*
16642886-G-A 14531006-G-A YY*
16642884-A-C 14531004-A-C YY*
16642880-A-G 14531000-A-G YY*
16642879-T-A 14530999-T-A YY*
13218966-C-CA 11063290-C-CA 21×A*
9994930-G-A 10157321-G-A Y*
9316196-C-A 9478587-C-A Y*
15070614-CAAAAA-C 12958705-CAAAAA-C 20×A*
23181453-CA-C 21019567-CA-C 34×A*
13488928-C-A 11333252-C-A *
24096556-A-C 21950409-A-C P3_b1 *
13474514-T-A 11318838-T-A *
27583038-G-T 25436891-G-T P1_Y2 *
28802565-G-A 26656418-G-A *
13545330-AAGAAGGAAG-A 11389654-AAGAAGGAAG-A *
28542416-C-CA 26396269-C-CA 17×A*
13489361-G-A 11333685-G-A *
58980009-CTCCAATCCAT-C 56833862-CTCCAATCCAT-C *
14764914-ATT-A 12652983-ATT-A 23×T*
13349425-T-A 11193749-T-A *
5434160-G-A 5566119-G-A FGC82306 *
13488461-A-C 11332785-A-C *
6863818-C-CT 6995777-C-CT 21×T*
13385079-CT-C 11229403-CT-C 14×T*
27483079-T-C 25336932-T-C P1_Y2 *
23293596-GTGTATATA-G 21131710-GTGTATATA-G *
3957616-TA-T 4089575-TA-T 12×A*
17474945-C-CT 15363065-C-CT 15×T*
13726649-A-G 11570973-A-G *
22511140-C-G 20349254-C-G DYZ19 *
28802569-T-C 26656422-T-C *
4976099-C-CA 5108058-C-CA 16×A*
58978973-C-A 56832826-C-A *
13468458-C-T 11312782-C-T *
8296263-G-GA 8428222-G-GA 17×A*
13489801-G-A 11334125-G-A *
13471917-G-A 11316241-G-A *
9038304-A-AT 9200695-A-AT 12×T*
22237264-T-G 20075378-T-G DYZ19 *
9303192-A-C 9465583-A-C A10362 Y*
58854697-C-G 56736174-G-C *
6515573-A-AT 6647532-A-AT 10×T*
27290770-C-CT 25144623-C-CT P1_g3 11×T*
27761295-GA-G 25615148-GA-G P1_Y2 15×A*
28802586-G-T 26656439-G-T *
13476584-C-T 11320908-C-T *
18017108-G-GAT 15905228-G-GAT 22×AT*
7414277-CA-C 7546236-CA-C 27×A*
59001610-A-T 56855463-A-T *
59008525-G-A 56862378-G-A *
59008502-G-A 56862355-G-A *
59007929-C-G 56861782-C-G *
59007163-C-T 56861016-C-T *
59007140-A-G 56860993-A-G *
59006618-A-G 56860471-A-G *
59005534-G-A 56859387-G-A *
59005514-T-C 56859367-T-C *
59005424-G-A 56859277-G-A *
59005368-A-AG 56859221-A-AG *
59005005-C-T 56858858-C-T *
59003613-A-T 56857466-A-T *
59003020-C-T 56856873-C-T *
59000611-C-A 56854464-C-A *
59009486-T-G 56863339-T-G *
58999813-A-G 56853666-A-G *
58999578-C-A 56853431-C-A *
58999396-G-A 56853249-G-A *
58999301-G-T 56853154-G-T *
58999300-T-C 56853153-T-C *
58999137-G-A 56852990-G-A *
58998931-A-G 56852784-A-G *
58998189-T-C 56852042-T-C *
58997530-G-A 56851383-G-A *
58996578-T-C 56850431-T-C *
58994007-C-G 56847860-C-G *
58993081-C-T 56846934-C-T *
58981500-TTCTATTCCACTCCACTCCACTCCAGTACATTCCAC-T 56835353-TTCTATTCCACTCCACTCCACTCCAGTACATTCCAC-T *
58975950-C-A 56829803-C-A *
59008980-T-C 56862833-T-C *
59009823-G-C 56863676-G-C *
9980236-C-T 10142627-C-T Y*
59026824-A-T 56880677-A-T *
28797894-G-A 26651747-G-A *
13488987-C-T 11333311-C-T *
13319344-ATG-A 11163668-ATG-A 10×TG*
58833933-C-T 56756938-G-A *
13496541-C-G 11340865-C-G *
28245714-A-ATT 26099567-A-ATT P1_b4 15×T*
25430759-CT-C 23284612-CT-C P2_r2 8×T*
59031595-C-T 56885448-C-T *
59031297-A-G 56885150-A-G *
59030697-T-A 56884550-T-A *
59029428-G-A 56883281-G-A *
59029184-C-T 56883037-C-T *
59028889-AATT-A 56882742-AATT-A *
59028802-CT-C 56882655-CT-C *
59024259-G-A 56878112-G-A *
59011040-T-C 56864893-T-C *
59024255-T-C 56878108-T-C *
59023580-T-C 56877433-T-C *
59020835-T-C 56874688-T-C *
59018832-G-T 56872685-G-T *
59017874-G-A 56871727-G-A *
59016571-G-C 56870424-G-C *
59015192-G-T 56869045-G-T *
59014913-A-G 56868766-A-G *
59014005-T-TCC 56867858-T-TCC *
59014004-C-T 56867857-C-T *
59013465-C-T 56867318-C-T *
59011499-A-T 56865352-A-T *
59011484-C-T 56865337-C-T *
59011358-A-G 56865211-A-G *
17802194-AAAG-A 15690314-AAAG-A 8×AAG*
13480973-C-T 11325297-C-T FGC13253 *
13480691-A-G 11325015-A-G *
13611806-T-C 11456130-T-C *
6597340-TA-T 6729299-TA-T 28×A*
23619781-TA-T 21457895-TA-T 10×A*
13468434-G-A 11312758-G-A *
13253156-C-T 11097480-C-T *
58883656-T-A 56707215-A-T *
13466433-C-A 11310757-C-A *
15140903-C-CT 13028990-C-CT 11×T*
13447643-G-A 11291967-G-A *
16710763-GTATATA-G 14598883-GTATATA-G 14×TA*
22509080-T-A 20347194-T-A DYZ19 *
58980059-C-A 56833912-C-A *
3908945-CA-C 4040904-CA-C 15×A*
15450073-C-CT 13338193-C-CT 15×T*
13611755-C-G 11456079-C-G *
13737068-G-A 11581392-G-A *
59000362-G-A 56854215-G-A *
13479036-T-C 11323360-T-C *
13365945-G-A 11210269-G-A FGC61955 *
24600670-CAA-C 22454523-CAA-C P3_t2 16×A*
21824255-C-CAAAAAAA 19662369-C-CAAAAAAA 30×A*
4164327-TA-T 4296286-TA-T 11×A*
14794351-C-CT 12682422-C-CT 14×T*
4619210-T-A 4751169-T-A A4907 *
28545016-C-CA 26398869-C-CA 22×A*
13446099-A-T 11290423-A-T *
13474547-G-T 11318871-G-T *
14359923-GAA-G 12239218-GAA-G 14×A*
28517963-CA-C 26371816-CA-C 11×A*
9236000-G-C 9398391-G-C Y*
13474293-G-C 11318617-G-C *
13469141-A-C 11313465-A-C *
17676029-CTT-C 15564149-CTT-C 15×T*
6191304-CAAAA-C 6323263-CAAAA-C IR3_Dst 15×A*
4270959-A-AAGAT,AAGATAGAT 4402918-A-AAGAT,AAGATAGAT 15×AGAT*
28735626-C-CT 26589479-C-CT 12×T*
21885321-T-TA 19723435-T-TA 10×A*
13698844-A-G 11543168-A-G *
20778781-T-TTG 18616895-T-TTG P4_Prx 18×TG*
27618010-G-T 25471863-G-T P1_Y2 8×A*
22288976-G-T 20127090-G-T DYZ19 *
24355455-C-CT 22209308-C-CT 11×T*
2682008-TA-T 2813967-TA-T 10×A*
22510079-A-G 20348193-A-G DYZ19 *
59010654-T-A 56864507-T-A *
22509135-A-T 20347249-A-T DYZ19 *
22361896-G-T 20200010-G-T DYZ19 *
5776576-GA-G 5908535-GA-G 13×A*
9031416-A-AT 9193807-A-AT 11×T*
13463771-C-CT 11308095-C-CT *
26433572-CT-C 24287425-CT-C P1_Y1 19×T*
7456234-TA-T 7588193-TA-T IR1_L 10×A*
8417314-C-CG 8549273-C-CG 10×G*
13948604-C-CA 11827898-C-CA 10×A*
13468858-C-T 11313182-C-T *
13488912-C-G 11333236-C-G *
13484890-T-C 11329214-T-C *
13468425-C-T 11312749-C-T *
13932140-CAT-C 11811434-CAT-C 13×AT*
10022394-T-C 10184785-T-C Y*
13487876-G-A 11332200-G-A *
13346776-CA-C 11191100-CA-C 13×A*
13529912-T-A 11374236-T-A *
13345801-A-G 11190125-A-G *
28813303-T-C 26667156-T-C FT462639 *
4221231-TAA-T 4353190-TAA-T 19×A*
22510765-C-G 20348879-C-G DYZ19 *
13489297-C-T 11333621-C-T *
22510717-T-G 20348831-T-G DYZ19 *
3483637-GACAC-G 3615596-GACAC-G 15×AC*
9299615-T-C 9462006-T-C Y*
14297038-C-CTA 12176332-C-CTA 10×TA*
9295886-C-A 9458277-C-A Y*
5393297-A-G 5525256-A-G FT159154 *
14858666-ATT-A 12746732-ATT-A 19×T*
13466460-A-T 11310784-A-T *
58865836-T-C 56725035-A-G *
3889019-CT-C 4020978-CT-C 15×T*
13488827-G-T 11333151-G-T *
27483042-G-A 25336895-G-A P1_Y2 *
13489273-T-C 11333597-T-C *
13488952-T-A,C 11333276-T-A,C *
13739933-G-A 11584257-G-A *
9959527-C-G 10121918-C-G Y*
58905026-G-C 56685845-C-G *
13468463-C-A 11312787-C-A *
9328907-T-C 9491298-T-C Y*
13531556-G-A 11375880-G-A *
24905127-A-AAT 22758980-A-AAT g1 9×AT*
4376142-C-CA 4508101-C-CA 26×A*
13463799-C-T 11308123-C-T *
17030757-AT-A 14918877-AT-A 24×T*
13471853-G-A 11316177-G-A *
13489724-C-T 11334048-C-T *
13466493-G-T 11310817-G-T *
22467206-T-G 20305320-T-G DYZ19 *
8105080-T-TA 8237039-T-TA 11×A*
28815489-A-G 26669342-A-G *
13514126-A-C 11358450-A-C *
59024010-A-C 56877863-A-C *
27523621-G-GT 25377474-G-GT P1_Y2 10×T*
28610442-C-CT 26464295-C-CT 21×T*
5430808-CA-C 5562767-CA-C 25×A*
3970906-C-CT 4102865-C-CT 11×T*
13257285-ATATATTT-A 11101609-ATATATTT-A *
22509112-C-T 20347226-C-T DYZ19 *
22509286-G-T 20347400-G-T DYZ19 *
9199452-G-T 9361843-G-T Y*
13488774-T-A 11333098-T-A *
13729013-T-A 11573337-T-A *
13728845-G-C 11573169-G-C *
14319448-G-GAT 12198742-G-GAT 8×AT*
7105351-GA-G 7237310-GA-G 11×A*
13712246-T-C 11556570-T-C *
23011081-TC-T 20849195-TC-T A6904 *
21922080-C-CA 19760194-C-CA 23×A*
15430073-GTAA-G 13318193-GTAA-G 10×TAA*
4408904-GA-G 4540863-GA-G 13×A*
59016948-G-T 56870801-G-T *
13711679-G-A 11556003-G-A BY211266 *
15733879-CA-C 13621999-CA-C 25×A*
13496562-A-G 11340886-A-G *
22476669-T-A 20314783-T-A FT459896 DYZ19 *
13698777-G-T 11543101-G-T *
7154797-C-CA 7286756-C-CA 18×A*
15491939-GTGTA-G 13380059-GTGTA-G *
13726727-T-C 11571051-T-C *
58975321-T-A 56829174-T-A 4×ATTCC*
13942606-TAC-T 11821900-TAC-T 9×AC*
13468038-A-G 11312362-A-G *
13611988-G-GTTTTTT 11456312-G-GTTTTTT 19×T*
56886800-G-GT,GT *

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: EWN1D4KG1654668698237578442880
Used in age calculations1654668698237578442880
Counts of SNPs20656
Variant counts last updated 2022-07-24 03:12:27.



Big Tree Main Page