Tree Position

R-P312/S116 > Z290 > L21/S145 > S552 > DF63/S522 > BY592 > CTS5454 > Z16245 > Z16246 > BY3070 > FT72783 > BY56496

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STR
B161416
13675019-C-CATGGA 11519343-C-CATGGA L513/S215/DF1 7×ATGGA+
17859117-T-C 15747237-T-C Y+
14112891-T-C 11992185-T-C Y+
10756773-C-T +
14404784-G-A 12284081-G-A FT61428 YY+
14404998-A-G 12284295-A-G FT61429 YY+
14464085-G-C 12343358-G-C FT61437 YY+
7210998-T-A 7342957-T-A FT36430 Y+
7211003-T-A 7342962-T-A FT36431 Y+
17192997-A-T 15081117-A-T FT61743 YY+
14797183-G-C 12685254-G-C FT61464 Y+
7336961-G-A 7468920-G-A FT61111 YY+
14964633-A-G 12852708-A-G Y+
15395051-C-G 13283171-C-G FT61529 Y+
15645301-C-T 13533421-C-T Y+
13943816-C-G 11823110-C-G FT61352 Y+
15732803-C-T 13620923-C-T FT61565 YY+
15946917-T-C 13835037-T-C FT61599 YY+
16657036-A-G 14545156-A-G Y+
22345756-TG-T 20183870-TG-T DYZ19 +
22219947-G-T 20058061-G-T DYZ19 +
17727674-T-C 15615794-T-C Y+
17747369-T-C 15635489-T-C FT61809 YY+
18575342-T-G 16463462-T-G FT61885 YY+
18813559-C-A 16701679-C-A FT61915 YY+
19025642-A-T 16913762-A-T Y+
19061300-C-T 16949420-C-T FT61952 YY+
20349941-T-C 18188055-T-C P5_Dst +
14053173-T-G 11932467-T-G FT61375 Y+
4548895-T-A 4680854-T-A 8×A+
22134284-T-A 19972398-T-A FT62150 YY+
10047133-T-C 10209524-T-C +
14385503-C-A 12264799-C-A FT61424 Y+
7122164-G-A 7254123-G-A Y+
8282476-G-A 8414435-G-A FT61199 YY+
18442938-CTCTT-C 16331058-CTCTT-C P6_Dst +
7122139-T-C 7254098-T-C Y+
9111838-C-T 9274229-C-T FT61278 Y+
21349475-CT-C 19187589-CT-C 10×T+
9537672-C-T 9700063-C-T IR3_Prx +
5758554-C-T 5890513-C-T FT60916 +
5490310-G-A 5622269-G-A +
10047121-A-G 10209512-A-G +
10047130-C-A 10209521-C-A +
4412318-G-A 4544277-G-A +
22237319-A-T 20075433-A-T DYZ19 +
23066613-G-A 20904727-G-A FT62203 Y+
22236202-G-A 20074316-G-A DYZ19 +
14695992-CAAAAAAAAA-C 12584058-CAAAAAAAAA-C 30×A+
10789311-G-A FT431267 +
10923798-G-C FT87740 +
10954328-CTCCATTCCAT-C +
4134272-G-A 4266231-G-A FT60684 +
3914891-A-G 4046850-A-G FT60660 +
3394387-C-T 3526346-C-T FTB65242 +
3201021-G-T 3332980-G-T FT60547 +
16427460-G-A 14315580-G-A Y+
13473140-A-T 11317464-A-T +
20772032-TCTCAG-T 18610146-TCTCAG-T P4_Prx +
7289671-G-T 7421630-G-T FT61106 YY+
23586289-T-C 21424403-T-C FT62253 YY+
23978951-G-A 21832804-G-A FT62277 Y+
23418000-T-C 21256114-T-C FT62238 YY+
25200792-AGAAG-A 23054645-AGAAG-A g1 9×GAAG+
27435502-G-A 25289355-G-A P1_g3 +
22635500-A-G 20473614-A-G Y+
22578762-T-TA 20416876-T-TA +
22839000-A-T 20677114-A-T Y+
22543300-A-G 20381414-A-G Y+
24889830-G-A 22743683-G-A g1 +
13142948-GCATTCCATTC-G 10632434-GCATTCCATTC-G 11×CATTC+
27692068-G-GAAA 25545921-G-GAAA P1_Y2 15×A+
22530329-G-T 20368443-G-T Y+
13336491-G-T 11180815-G-T *
13748486-T-C 11592810-T-C *
56831485-C-CTAAACTCCACTCCACTCCATTCCATTCCA *
56724850-G-GT *
3194203-AT-A 3326162-AT-A *
24080169-T-TA 21934022-T-TA P3_b1 11×A*
13336488-T-C 11180812-T-C *
2957339-G-T 3089298-G-T *
10760350-T-TACTCCATTCCACTCCACTCCACTTCATTCCATTACACTGCATTCCGAATGATTCCACTACTTTCCATTCCATTTCACTCCATTCCACTCCATTCCATTCCACTGC,TACTCCATTCCACTCCACTCCACTTCATTCCATTACACTGCATTCCGAATGATTCCACTACTTTCCATTCCATTTCACTCCATTCCACTCCATTCCATTCCACTGC *
2750871-G-GA 2882830-G-GA *
2758842-CAAA-C,CAA 2890801-CAAA-C,CAA 19×A*
2897562-C-T 3029521-C-T Y*
22288261-G-A 20126375-G-A DYZ19 *
2864336-T-C 2996295-T-C YY*
8888375-C-CT,CT 9020334-C-CT,CT 25×T*
2773687-C-A 2905646-C-A Y*
2670869-C-A 2802828-C-A Y*
2946642-T-C 3078601-T-C *
11578507-AAT- *
22255471-G-GGGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTTTTCCTTCAGATGTGTCAAGAGTTTCTTCCTTCTGGAAGGTTCATGGTCTTGCTCACTTCAAGAATGAAGCTGCAGACCTTAGTGGTGAC 20093585-G-GGGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTTTTCCTTCAGATGTGTCAAGAGTTTCTTCCTTCTGGAAGGTTCATGGTCTTGCTCACTTCAAGAATGAAGCTGCAGACCTTAGTGGTGAC DYZ19 *
7270276-C-A 7402235-C-A YY25×T*
10757170-C-CT,CT *
10846974-A-ATTCTT *
7104455-CCT-C 7236414-CCT-C *
13461265-C-A 11305589-C-A *
21050838-T-TTATC,TTATCTATC 18888952-T-TTATC,TTATCTATC 10×TATC*
10908294-C-CTA *
13470568-C-T 11314892-C-T *
22366441-C-A 20204555-C-A DYZ19 *
22366442-A-T 20204556-A-T DYZ19 *
22477403-A-T 20315517-A-T DYZ19 *
6401916-A-G 6533875-A-G *
13463728-G-T 11308052-G-T *
13478479-CAG-C 11322803-CAG-C *
13451163-T-C,TCCTCTGCACTCC 11295487-T-C,TCCTCTGCACTCC *
11532706-C- *
13469101-T-C 11313425-T-C *
13474289-C-A 11318613-C-A *
9962555-A-T 10124946-A-T Y*
10776056-A-ATGCCT *
13478515-G-A 11322839-G-A *
13479170-A-G 11323494-A-G *
28819186-G-C 26673039-G-C *
13484199-G-A 11328523-G-A *
10942751-CATTCCAATCCAA-C *
10942765-C-G *
3537095-T-C 3669054-T-C *
3266217-T-A 3398176-T-A *
6413870-G-A 6545829-G-A *
5404758-G-A 5536717-G-A *
5452626-CTT-C 5584585-CTT-C 11×T*
5600893-T-A 5732852-T-A *
5744779-A-G 5876738-A-G *
13469544-C-T 11313868-C-T *
5821864-G-A 5953823-G-A *
5973792-C-G 6105751-C-G *
6158117-T-C 6290076-T-C IR3_Dst *
13450745-C-CCG 11295069-C-CCG *
6534268-TTCTTCCGTGTCGTAAAATACCGACGTATTTGTTATAA- *
6444836-CTA-C,CTATATA 6576795-CTA-C,CTATATA 12×TA*
5305754-GTT-G 5437713-GTT-G *
6460596-TA-T 6592555-TA-T *
13275153-CT-C 11119477-CT-C 11×T*
22430299-T-TA 20268413-T-TA DYZ19 *
6642736-T-C 6774695-T-C YY*
6856743-C-CA 6988702-C-CA 8×A*
13480952-A-T 11325276-A-T *
13480951-C-G 11325275-C-G *
10062592-C-CAA 10224983-C-CAA *
22508104-G-A 20346218-G-A DYZ19 *
7197413-C-T 7329372-C-T YY*
9985057-T-C 10147448-T-C Y*
5349101-T-C 5481060-T-C *
13473858-A-C 11318182-A-C *
3428588-T-C 3560547-T-C *
4937662-G-GT,GTT 5069621-G-GT,GTT 12×T*
13506676-T-TTAA 11351000-T-TTAA *
3651714-GA-G 3783673-GA-G 10×A*
3662204-T-C 3794163-T-C *
28791656-G-T 26645509-G-T *
3965538-CTT-C 4097497-CTT-C 9×T*
4023044-TA-T 4155003-TA-T 8×A*
4686434-C-T 4818393-C-T *
28780697-GAC-G 26634550-GAC-G *
4727059-A-G 4859018-A-G *
4934027-G-GTT 5065986-G-GTT 10×T*
4956079-C-CTTT 5088038-C-CTTT 13×T*
13473862-C-T 11318186-C-T *
28780696-T-TAAAG 26634549-T-TAAAG *
5033641-GA-G 5165600-GA-G 8×A*
5049475-T-C 5181434-T-C *
5059178-T-C 5191137-T-C *
22487082-TC-T 20325196-TC-T DYZ19 *
5082944-AT-A 5214903-AT-A 12×T*
5194776-A-G 5326735-A-G *
5209697-C-T 5341656-C-T *
5273214-CTTTT-C,CTTTTT 5405173-CTTTT-C,CTTTTT 23×T*
13489758-G-T 11334082-G-T *
13489670-G-A 11333994-G-A *
11322804-AGGTT- *
13470554-C-T 11314878-C-T *
13729048-G-A 11573372-G-A *
10945225-CCACTCCAA-C *
16244792-GGTGT-G,G 14132912-GGTGT-G,G 16×GT*
13474392-A-C 11318716-A-C *
13481010-C-G 11325334-C-G *
13481018-T-G 11325342-T-G *
13245161-C-T 11089485-C-T *
13483708-C-T 11328032-C-T *
13484122-C-G 11328446-C-G *
13706976-T-A 11551300-T-A *
10945215-CAACTCCA-C *
10945224-T-G *
13351760-T-G 11196084-T-G *
13478231-G-C 11322555-G-C *
13464983-A-G 11309307-A-G *
13476601-G-A 11320925-G-A *
13476729-C-T 11321053-C-T *
11334089-TACCCGGCC- *
28805548-G-GAAT 26659401-G-GAAT *
28805546-T-TGG 26659399-T-TGG *
22509521-C-G 20347635-C-G DYZ19 *
28798966-AG-A 26652819-AG-A *
28798980-G-GGAAGGAATGGA 26652833-G-GGAAGGAATGGA *
28798983-T-TGAAA 26652836-T-TGAAA *
28805544-A-G 26659397-A-G *
13488844-G-GCT 11333168-G-GCT *
56835867-G-GCCACTCCATTCCACTCCACTCCATTCCATTCCACTCTACTCCACTCCACTCCACGCCACTCCATTCCACTCCACA *
11294473-T- *
13482103-C-T 11326427-C-T *
26659082-G- *
10094477-TTTAAAAA- *
13336471-C-T 11180795-C-T *
13356656-C-A 11200980-C-A *
13356657-T-TGAA 11200981-T-TGAA *
13476525-T-TTG 11320849-T-TTG *
13484910-G-A 11329234-G-A *
11334024-C- *
13737482-T-G 11581806-T-G *
13740252-G-C 11584576-G-C *
13478482-G-GTT 11322806-G-GTT *
13707394-C-CGT 11551718-C-CGT *
13478463-C-G 11322787-C-G *
6401877-G-A 6533836-G-A *
10669540-ATT-A *
10669543-CCGT-C *
10669553-C-T *
13401324-GCT-G 11245648-GCT-G *
10669563-C-G *
10987846-TTCCATTCCATTCCATTCCACTCCAC-T,T *
13470068-C-T 11314392-C-T *
13470076-C-G 11314400-C-G *
13476551-G-A 11320875-G-A *
13470093-A-G 11314417-A-G *
28798990-G-GAGTGGAGAGA 26652843-G-GAGTGGAGAGA *
13479189-C-G 11323513-C-G *
13478904-ACC-A 11323228-ACC-A *
13482328-A-T 11326652-A-T *
13417495-A-G 11261819-A-G *
11026247-T-TAGACTCCAC *
22459160-C-T 20297274-C-T DYZ19 *
10034745-T-C 10197136-T-C Y*
13356663-G-GA 11200987-G-GA *
13478065-C-G 11322389-C-G *
13469880-G-T 11314204-G-T *
56826965-T-TCC *
13552039-C-T 11396363-C-T *
13469335-C-CTGCCG 11313659-C-CTGCCG *
56831484-C-CT *
13478450-T-A 11322774-T-A *
13480241-G-A 11324565-G-A *
13356629-G-T 11200953-G-T 11×A*
11323443-T- *
28805554-AGTGG-A 26659407-AGTGG-A *
28805562-GA-G 26659415-GA-G *
56678191-A-G *
13481051-C-A 11325375-C-A *
13476724-T-G 11321048-T-G *
10661200-TGCACTGCCCTTCACTCCA- *
13479197-T-A 11323521-T-A *
13478901-GA-G 11323225-GA-G *
13478484-T-C 11322808-T-C *
22484044-G-T 20322158-G-T DYZ19 *
28805525-T-A 26659378-T-A *
28805518-C-G 26659371-C-G *
56877854-CAAAAA-C,CA 18×A*
11334026-C- *
13461951-G-T 11306275-G-T *
28805519-T-A 26659372-T-A BY227413 *
22288258-A-G 20126372-A-G DYZ19 *
56834769-G-GTATT *
13478134-T-TGC 11322458-T-TGC *
9944188-G-T 10106579-G-T Y*
14286808-C-G 12166102-C-G YY*
11295320-C- *
13475212-A-T 11319536-A-T *
13478457-A-T 11322781-A-T *
22484053-G-C 20322167-G-C DYZ19 *
13482257-G-A 11326581-G-A *
13482823-T-G 11327147-T-G *
13417496-G-C 11261820-G-C *
13481041-GT-G 11325365-GT-G *
13707146-TA-T 11551470-TA-T *
28805516-T-A 26659369-T-A *
2795559-GTTT-G,GT 2927518-GTTT-G,GT 24×T*
13734821-G-C 11579145-G-C *
7307496-G-T,T 7439455-G-T,T *
10062622-A-T 10225013-A-T *
10062623-GA-G 10225014-GA-G *
13406728-T-C 11251052-T-C *
10034752-G-C 10197143-G-C Y*
7543990-T-C 7675949-T-C YY*
16616858-CAGAG- 10×AG*
17798018-G-A 15686138-G-A Y*
17798019-T-A 15686139-T-A Y*
17798023-T-C 15686143-T-C Y*
17798025-G-T 15686145-G-T Y*
17859914-A-G 15748034-A-G Y*
17864308-TA-T 15752428-TA-T *
18365300-G-A 16253420-G-A P6_Prx *
18391128-T-C 16279248-T-C P6_Gap *
18539140-G-T 16427260-G-T Y*
18643392-G-GACACACAC 16531512-G-GACACACAC 16×AC*
18686222-C-A 16574342-C-A YY*
18744298-C-T 16632418-C-T YY*
17798013-G-A 15686133-G-A Y*
18864942-T-C 16753062-T-C YY*
16758202-G- *
19030639-G-T 16918759-G-T Y*
19438076-A-AAG 17326196-A-AAG *
19449442-A-G 17337562-A-G YY*
20380017-A-G 18218131-A-G P5_Dst *
21042807-C-T 18880921-C-T Y*
21125019-G-T 18963133-G-T Y*
21196958-C-T 19035072-C-T Y*
21282188-G-A 19120302-G-A YY*
21393430-T-C 19231544-T-C Y*
17798017-T-C 15686137-T-C Y*
17361058-CAA-C,CAAA 15249178-CAA-C,CAAA 25×A*
21498287-A-C 19336401-A-C Y*
16441990-T-C 14330110-T-C YY*
14594268-A-G 12482468-A-G YY*
14850535-G-T 12738601-G-T YY*
14959885-T-C 12847960-T-C Y*
15103404-C-T 12991492-C-T Y*
15116900-A-G 13004987-A-G Y*
15281990-C-T 13170089-C-T Y*
15597152-T-C 13485272-T-C Y*
15636459-C-A 13524579-C-A Y*
15636470-A-G 13524590-A-G Y*
15753184-T-C 13641304-T-C YY*
16322668-A-G 14210788-A-G Y*
16503033-C-T 14391153-C-T Y*
17256851-GCT-G 15144971-GCT-G *
16562782-TAAAAA-T 14450902-TAAAAA-T 18×A*
16574863-A-T 14462983-A-T Y*
16598711-G-A 14486831-G-A YY*
16709568-A-T 14597688-A-T Y*
16715034-GGT-G,G 14603154-GGT-G,G 10×GT*
17093184-T-A 14981304-T-A Y*
17167971-C-T 15056091-C-T YY*
17169683-A-G 15057803-A-G YY*
17169687-A-G 15057807-A-G YY*
17169692-A-C 15057812-A-C YY*
17169711-G-A 15057831-G-A BY112775 YY*
17169714-T-A 15057834-T-A YY*
21498277-T-A 19336391-T-A Y*
21498288-G-T 19336402-G-T Y*
12371708-T-G *
27593086-C-A 25446939-C-A P1_Y2 *
23120621-A-G 20958735-A-G YY*
23196402-T-C 21034516-T-C Y*
23234116-T-C 21072230-T-C Y*
23294788-A-C 21132902-A-C YY*
23361530-T-C 21199644-T-C Y*
23413908-T-C 21252022-T-C YY*
23435685-T-C 21273799-T-C YY*
23438855-TA-T 21276969-TA-T *
23838382-A-G 21676496-A-G *
24573423-CTTTTTTT-C 22427276-CTTTTTTT-C P3_t2 21×T*
25086202-TA-T 22940055-TA-T g1 9×A*
27714323-T-C 25568176-T-C P1_Y2 *
22876977-A-C 20715091-A-C Y*
28492696-A-AAAG 26346549-A-AAAG *
28492700-A-G 26346553-A-G *
28747981-C-T 26601834-C-T *
28763587-G-A 26617440-G-A *
56685723-C-A *
56715450-G-T *
56715484-C-G *
56715812-G-T *
56724787-T-C *
56749714-T-G *
56749883-A-G *
56851815-T-C *
22936392-T-C 20774506-T-C YY*
22876921-T-C 20715035-T-C Y*
21504258-T-TC 19342372-T-TC *
22318978-T-C,C 20157092-T-C,C DYZ19 *
21550085-C-G 19388199-C-G YY*
21738430-T-A 19576544-T-A YY*
21748637-G-A 19586751-G-A YY*
21786203-T-C 19624317-T-C YY*
21807078-G-T 19645192-G-T YY*
21934999-A-T 19773113-A-T YY*
21990568-T-G 19828682-T-G YY*
22130331-A-G 19968445-A-G YY*
22266662-G-T 20104776-G-T DYZ19 *
22289026-C-A 20127140-C-A DYZ19 *
22303274-T-C 20141388-T-C DYZ19 *
22318999-T-G,G 20157113-T-G,G DYZ19 *
22854812-T-A 20692926-T-A Y*
22319020-CAAGT-C,C 20157134-CAAGT-C,C DYZ19 *
22319065-T-C,C 20157179-T-C,C DYZ19 *
22427993-GT-G 20266107-GT-G DYZ19 *
22465858-ATGTCCAGAGTTTTTTCATTCAGATG-A 20303972-ATGTCCAGAGTTTTTTCATTCAGATG-A DYZ19 *
22485489-A-T 20323603-A-T DYZ19 *
20325198-TACAGAGTTTGTTCTTTCAGATGTGTCCAGACTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAGAATGAAGCTGCAGACCTTACTATTCAGTGTTAAAGCACTTAAAGGTGTTATA- DYZ19 *
22510660-A-C 20348774-A-C DYZ19 *
22510674-G-C 20348788-G-C DYZ19 *
22547740-T-C 20385854-T-C Y*
22690715-T-A 20528829-T-A Y*
22812629-CTTTT-C,CTTTTT 20650743-CTTTT-C,CTTTTT 28×T*
22814049-A-G 20652163-A-G YY*
14576136-G-GAA 12464336-G-GAA 12×A*
12371706-T-TAC *
7568123-C-A,A 7700082-C-A,A 10×A*
13323528-C-T 11167852-C-T *
10785259-GTTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCA-G *
10846986-TCTAC-T *
10846992-C-CATTT *
10942780-C-G *
10949605-C-T *
13222513-A-T 11066837-A-T *
13223196-GC-G 11067520-GC-G *
13223199-A-G 11067523-A-G *
13236443-C-T 11080767-C-T *
13267754-G-C 11112078-G-C *
13279998-CAAAA-C,CAAA 11124322-CAAAA-C,CAAA 26×A*
13346776-CAA-C 11191100-CAA-C 13×A*
10763135-C-CAA *
13362360-CAAAAA-C 11206684-CAAAAA-C 19×A*
13362514-CAA-C 11206838-CAA-C 11×A*
13364146-CAAAA-C,CA 11208470-CAAAA-C,CA 26×A*
13414797-AT-A,ATT 11259121-AT-A,ATT 20×T*
13445285-T-G 11289609-T-G *
13447555-G-GTTCCATTCCATTTCA 11291879-G-GTTCCATTCCATTTCA *
13461312-CAG-C 11305636-CAG-C *
13464972-AG-A 11309296-AG-A *
13464975-C-A 11309299-C-A *
13464994-A-G 11309318-A-G *
13465004-G-T 11309328-G-T *
13465013-T-A 11309337-T-A *
10763153-T-TTCCACTCCACTCCAC,TTCCATTCCACTCCACTCCAC *
10763106-CATTCCAT-C *
13468150-T-G 11312474-T-G *
9402525-A-T 9564916-A-T YY*
7578484-G-T 7710443-G-T Y*
7643298-GAGAGAGAGAGAGAGAC-G 7775257-GAGAGAGAGAGAGAGAC-G *
7784300-T-A 7916259-T-A YY*
8274063-A-T 8406022-A-T YY*
8544450-C-CA 8676409-C-CA 9×A*
8648172-GATATATATAT-G 8780131-GATATATATAT-G 14×AT*
9125623-T-C *
9092752-C-CAA 9255143-C-CAA 11×A*
9174731-G-T 9337122-G-T Y*
9300240-AACACACACACACAC-A 9462631-AACACACACACACAC-A 20×AC*
9329110-G-A 9491501-G-A Y*
9799159-G-T 9961550-G-T YY*
10763101-CAAT-C *
9828776-C-T 9991167-C-T YY*
9854341-ATCTT-A 10016732-ATCTT-A *
9900460-G-A 10062851-G-A Y*
10002468-G-A 10164859-G-A Y*
10024656-G-GTC 10187047-G-GTC *
10027013-AT-A 10189404-AT-A *
10034727-G-GGGGGGGGCCC 10197118-G-GGGGGGGGCCC *
10034749-A-C 10197140-A-C Y*
22477393-A-T 20315507-A-T FT459972 DYZ19 *
10042674-G-A 10205065-G-A *
10067999-A-G 10230390-A-G *
10624580-TC-T *
13465043-C-T 11309367-C-T *
13468460-G-A 11312784-G-A *
12371703-CAT-C *
13712014-G-T 11556338-G-T *
11333856-G- *
11333857-G- *
13489535-T-TG 11333859-T-TG *
13515531-A-G 11359855-A-G *
13516557-A-G 11360881-A-G *
13585211-C-T 11429535-C-T FT445857 *
13585214-A-T 11429538-A-T *
13608438-G-A 11452762-G-A *
13608457-A-C 11452781-A-C *
13620742-C-G 11465066-C-G *
13709134-T-G 11553458-T-G FT449330 *
13712877-T-C 11557201-T-C *
13489522-G-GTT 11333846-G-GTT *
13721280-TG-T 11565604-TG-T *
13730733-C-A 11575057-C-A *
13730771-T-C 11575095-T-C *
13734103-A-C 11578427-A-C *
13734221-CA-C 11578545-CA-C *
13734246-G-A 11578570-G-A *
13829430-T-TAATGG,TAATGGAATGG 11708724-T-TAATGG,TAATGGAATGG 9×AATGG*
13913313-A-G 11792607-A-G Y*
13919222-A-G 11798516-A-G Y*
14128085-T-C 12007379-T-C YY*
14286815-A-T 12166109-A-T YY*
14331131-CT-C,CTTTT 12210425-CT-C,CTTTT 25×T*
13489526-ACCCGCGGG-A 11333850-ACCCGCGGG-A *
13488948-G-T 11333272-G-T *
13469853-A-C 11314177-A-C *
13476297-G-GGTTTAGAGATATGTCATAATGCCCCCATAGTCC 11320621-G-GGTTTAGAGATATGTCATAATGCCCCCATAGTCC *
13470305-C-A 11314629-C-A BY85835 *
13470329-C-T 11314653-C-T *
13470384-CGT-C 11314708-CGT-C *
13470390-G-GTCT 11314714-G-GTCT *
13470392-G-GC 11314716-G-GC *
13470394-TGG-T 11314718-TGG-T *
13472009-AG-A 11316333-AG-A *
13472011-G-C 11316335-G-C *
13472017-T-G 11316341-T-G *
11318855-GTT- *
11318860-GTCACAATGCCGCCTTTTGGCAGAGCCTAGACAAGGGTTACATCACCTGGGTGATCAGTGCAGAGATA- *
13476516-A-G 11320840-A-G *
13488918-C-G 11333242-C-G *
13476606-C-CAT 11320930-C-CAT *
13476608-C-CGT 11320932-C-CGT *
11323226-A- *
13478909-C-CT 11323233-C-CT *
13479184-T-A 11323508-T-A *
13479252-T-A 11323576-T-A *
13480250-A-T 11324574-A-T *
13480351-T-TGTCACAATACCTTCTGAAGGTGGAGCCTAGACAAGAGTTACATCACCTGGGTGATCAGTGCAGAGATAC 11324675-T-TGTCACAATACCTTCTGAAGGTGGAGCCTAGACAAGAGTTACATCACCTGGGTGATCAGTGCAGAGATAC *
13480609-A-T 11324933-A-T *
13483728-A-T 11328052-A-T *
13483735-A-T 11328059-A-T *
13483831-G-C 11328155-G-C *
56831928-C-CGTTCG *
13483902-T-A 11328226-T-A *
22448756-G-A 20286870-G-A DYZ19 *
11029634-A-C *
26415749-G-GTT 24269602-G-GTT P1_Y1 14×T*
10917900-G-A *
10917985-T-C *
10908390-C-T *
10908391-A-G *
14960331-A-G 12848406-A-G Y*
56756811-A-T *
22920605-CTT-C,CT 20758719-CTT-C,CT 25×T*
13721329-A-T 11565653-A-T *
13474447-G-C 11318771-G-C *
17951299-ATTTTT-A,ATTTT 15839419-ATTTTT-A,ATTTT 25×T*
28567333-ATT-A 26421186-ATT-A 13×T*
11029635-A-C *
56839699-C-A *
11029737-C-G *
11029744-T-G *
11029755-C-G *
11029757-A-G *
11029770-C-T *
13487732-C-T 11332056-C-T *
21221977-T-TA 19060091-T-TA 10×A*
13472205-G-A 11316529-G-A *
13336447-G-T 11180771-G-T *
13336459-G-T 11180783-G-T *
13465985-A-C 11310309-A-C *
13474609-C-A 11318933-C-A *
13465935-G-A 11310259-G-A *
56845393-G-C *
56839689-T-A *
15399419-GAAA-G 13287539-GAAA-G 15×A*
9944139-G-A 10106530-G-A Y*
22447497-C-G 20285611-C-G DYZ19 *
28549748-G-T 26403601-G-T *
22476805-T-G 20314919-T-G BY223657 DYZ19 *
22448764-G-A 20286878-G-A DYZ19 *
13487441-G-A 11331765-G-A *
22317325-C-A 20155439-C-A DYZ19 *
22483947-A-T 20322061-A-T DYZ19 *
58893731-T-C 56697140-A-G *
13529380-A-AG 11373704-A-AG *
58979510-C-CTCCACACCATTCCAT,CTCCATTCCATTCCATTCTACTCCATTCCAT 56833363-C-CTCCACACCATTCCAT,CTCCATTCCATTCCATTCTACTCCATTCCAT *
13482307-A-T 11326631-A-T *
13476193-T-C,G 11320517-T-C,G *
17800319-C-CT 15688439-C-CT 9×T*
56839682-GA-G *
22255980-A-G 20094094-A-G DYZ19 *
9962446-T-G 10124837-T-G Y*
19270710-CAA-C 17158830-CAA-C 12×A*
22508009-G-T 20346123-G-T DYZ19 *
7409901-TAAA-T 7541860-TAAA-T 19×A*
13463995-G-C 11308319-G-C *
10942775-C-T *
17589287-A-AT 15477407-A-AT 10×T*
13500346-GTTTA-G 11344670-GTTTA-G 5×TTTA*
10908406-C-G *
15753179-T-TC 13641299-T-TC *
56839675-C-G *
56839677-T-C *
13223256-AAGGG-A 11067580-AAGGG-A 4×AGGG*
7468573-C-G 7600532-C-G IR1_L *
13708679-G-T 11553003-G-T *
13721022-G-C 11565346-G-C *
26538455-C-A 24392308-C-A P1_g2 *
13218966-CAAA-C,CAA 11063290-CAAA-C,CAA 21×A*
13585175-G-A 11429499-G-A *
22430300-T-A 20268414-T-A DYZ19 *
2702975-G-GTT 2834934-G-GTT 11×T*
13468454-T-C 11312778-T-C *
14937028-A-AT 12825093-A-AT 9×T*
13480625-G-C 11324949-G-C *
4997479-AACAC-A 5129438-AACAC-A 11×AC*
8616020-C-CT 8747979-C-CT 10×T*
10846970-A-T *
22204412-G-A 20042526-G-A Y*
8475629-GT-G 8607588-GT-G 10×T*
22536303-G-GA 20374417-G-GA 8×A*
6052506-C-CT 6184465-C-CT 9×T*
17925209-AT-A 15813329-AT-A 9×T*
14588247-TTC-T 12476447-TTC-T *
10034735-A-C 10197126-A-C Y*
22812659-C-A 20650773-C-A YY*
7117600-A-AT 7249559-A-AT 9×T*
18128207-C-CAA 16016327-C-CAA 16×A*
9440845-G-GA 9603236-G-GA 8×A*
13468060-G-T 11312384-G-T *
11026246-A-AC *
8468065-CA-C,CAA 8600024-CA-C,CAA 24×A*
5599202-AT-A 5731161-AT-A 9×T*
11015866-ACCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATT-A *
13748406-T-C 11592730-T-C *
13977178-A-G 11856472-A-G Y*
10062593-G-A 10224984-G-A *
14604590-CTT-C,CTTT 12492792-CTT-C,CTTT 21×T*
13485754-C-T 11330078-C-T *
18082920-G-GTT 15971040-G-GTT 11×T*
3990683-G-GA 4122642-G-GA 9×A*
22177716-CT-C 20015830-CT-C 9×T*
10660274-TTTCCA-T *
13488908-C-A 11333232-C-A *
13465934-G-C 11310258-G-C *
14297017-C-CA 12176311-C-CA 8×A*
13472046-A-G 11316370-A-G FT444075 *
17169703-A-G 15057823-A-G YY*
10669559-A-T *
13466395-A-G 11310719-A-G *
8568465-GTT-G,GT 8700424-GTT-G,GT 22×T*
13977174-T-C 11856468-T-C Y*
10908405-T-C *
13712013-G-T 11556337-G-T FGC23105BY43226 *
13474687-G-A 11319011-G-A *
13463727-C-A 11308051-C-A *
13480613-G-T 11324937-G-T *
27506515-C-CA 25360368-C-CA P1_Y2 24×A*
13489299-G-T 11333623-G-T *
13489351-G-A 11333675-G-A *
13463131-T-A 11307455-T-A *
9984669-C-G 10147060-C-G Y*
9984674-A-G 10147065-A-G Y*
13466527-T-A 11310851-T-A *
13474388-G-A 11318712-G-A *
17169686-C-T 15057806-C-T BY112774 YY*
3311746-C-T 3443705-C-T FGC50856 *
17490081-C-CAA 15378201-C-CAA 14×A*
22489691-G-A 20327805-G-A DYZ19 *
13449351-C-CCTAAA 11293675-C-CCTAAA *
13486806-C-T 11331130-C-T *
13486863-A-T 11331187-A-T *
13518387-T-C 11362711-T-C *
13518424-G-C 11362748-G-C *
13518490-G-C 11362814-G-C FGC281 Y133723 *
13538350-C-A 11382674-C-A *
16357324-C-CAT 14245444-C-CAT *
16635364-TAC-T 14523484-TAC-T *
21758003-CAG-C 19596117-CAG-C *
22477612-T-A 20315726-T-A BY174798 DYZ19 *
22484004-G-C 20322118-G-C DYZ19 *
23105948-C-A 20944062-C-A FT390749 Y*
13400069-C-T 11244393-C-T *
28586429-T-C 26440282-T-C *
28780709-A-C 26634562-A-C *
13476120-G-A 11320444-G-A *
13472038-G-T 11316362-G-T *
13608469-G-A 11452793-G-A *
27714328-C-T 25568181-C-T P1_Y2 15×T*
13433261-TA-T 11277585-TA-T *
13433282-T-TG 11277606-T-TG *
13734740-C-A 11579064-C-A *
9958028-AT-A 10120419-AT-A *
22288235-G-A 20126349-G-A DYZ19 *
2946522-C-T 3078481-C-T FGC11435 *
9941204-C-A 10103595-C-A Y*
13418349-T-C 11262673-T-C *
13354729-T-C 11199053-T-C *
10034738-A-C 10197129-A-C Y*
13573061-A-G 11417385-A-G *
23158148-GA-G 20996262-GA-G 10×A*
22510476-G-T 20348590-G-T FT90137 DYZ19 *
13704437-C-A 11548761-C-A *
13484231-C-T 11328555-C-T *
13593553-C-T 11437877-C-T *
13593554-A-G 11437878-A-G *
9304601-G-C 9466992-G-C Y*
22510450-T-G 20348564-T-G DYZ19 *
22366433-G-C 20204547-G-C DYZ19 *
22449441-T-A 20287555-T-A DYZ19 *
22449461-C-A 20287575-C-A DYZ19 *
22449462-T-G 20287576-T-G DYZ19 *
24326954-TACAC-T 22180807-TACAC-T P3_t1 19×AC*
13258632-G-A 11102956-G-A *
13470299-C-T 11314623-C-T *
4319180-CTAGGTAAT-C 4451139-CTAGGTAAT-C *
13258631-G-A 11102955-G-A *
22258136-C-A 20096250-C-A BY24917 DYZ19 *
3062015-T-A 3193974-T-A *
3483889-A-G 3615848-A-G *
4303101-G-C 4435060-G-C *
5564088-A-G 5696047-A-G *
5966753-A-C 6098712-A-C *
9381376-AAC-A 9543767-AAC-A *
10062563-G-C 10224954-G-C *
13252781-CA-C 11097105-CA-C *
13258614-TC-T 11102938-TC-T *
10029249-G-T 10191640-G-T Y*
13254537-A-T 11098861-A-T *
13478459-C-T 11322783-C-T *
24504679-CGTGT-C 22358532-CGTGT-C 14×GT*
13470368-C-T 11314692-C-T *
13474613-C-G 11318937-C-G *
15558431-GAGATAGATAGAT-G,GAGAT 13446551-GAGATAGATAGAT-G,GAGAT 17×AGAT*
13480984-C-T 11325308-C-T *
13464966-T-A,C 11309290-T-A,C *
13734754-T-G 11579078-T-G *
13734761-G-C 11579085-G-C *
5248619-ATTT-A 5380578-ATTT-A 19×T*
13712047-T-C 11556371-T-C *
9997063-A-C 10159454-A-C A11740 Y*
13704446-A-G 11548770-A-G *
58905117-A-T 56685754-T-A *
14105729-T-TA 11985023-T-TA 10×A*
22510419-C-A 20348533-C-A DYZ19 *
13466512-C-T 11310836-C-T *
13466537-C-A 11310861-C-A *
13466591-C-A 11310915-C-A *
10029207-A-T 10191598-A-T Y*
13518488-G-T 11362812-G-T *
13518489-A-C 11362813-A-C *
59005360-T-TAA 56859213-T-TAA 8×A*
13711545-A-G 11555869-A-G *
22288255-G-T 20126369-G-T DYZ19 *
13480361-C-T 11324685-C-T *
10062586-G-A 10224977-G-A *
15191680-C-CT 13079766-C-CT 9×T*
13707996-C-G 11552320-C-G BY89372 *
13480973-C-T 11325297-C-T FGC13253 *
13485736-C-G 11330060-C-G *
13266414-C-T 11110738-C-T *
58980708-TCCATTCCATTCCAC-T 56834561-TCCATTCCATTCCAC-T *
13270742-A-G 11115066-A-G *
13303013-G-A 11147337-G-A *
13314946-G-A 11159270-G-A *
13354716-T-C 11199040-T-C *
13423074-A-T 11267398-A-T *
13706568-G-A 11550892-G-A FT268475 *
13706637-G-A 11550961-G-A BY36494BY36499 *
13706853-G-A 11551177-G-A *
15131897-CCT-C 13019984-CCT-C *
19113775-T-C 17001895-T-C YY*
22270391-A-G 20108505-A-G DYZ19 *
22508092-G-T 20346206-G-T BY225433 DYZ19 *
58970507-T-A 56824360-T-A *
58982257-T-TCACTC 56836110-T-TCACTC 4×CACTC*
13489310-G-T 11333634-G-T *
59000821-T-C 56854674-T-C *
59002825-CAAA-C 56856678-CAAA-C *
59013931-C-G 56867784-C-G *
59023437-A-C 56877290-A-C *
59024222-G-T 56878075-G-T *
59032893-A-G 56886746-A-G *
13480091-C-T 11324415-C-T *
25080053-C-CAA 22933906-C-CAA g1 20×A*
22488117-T-A 20326231-T-A F25205 DYZ19 *
15543492-C-CA 13431612-C-CA 10×A*
58893713-G-T 56697158-C-A *
13399871-G-T 11244195-G-T *
13489309-G-A 11333633-G-A *
56860703-G-A *
8535370-CAA-C 8667329-CAA-C 11×A*
22448751-T-A 20286865-T-A DYZ19 *
56826966-A-ATTT *
13718773-C-G,G 11563097-C-G,G *
56825934-T-TAATTCCATTCGATTGCATTCCATTCGATTGCATTCCATTCGATTGCATTCCATTCGATTG *
9958035-T-A 10120426-T-A Y*
9958039-G-A 10120430-G-A Y*
10669556-T-C *
13470913-C-CCGCCGT 11315237-C-CCGCCGT *
13474413-C-T 11318737-C-T *
13474436-T-C 11318760-T-C *
13474444-C-A 11318768-C-A *
13694929-G-A,A 11539253-G-A,A *
22476686-A-T 20314800-A-T DYZ19 *
28818057-T-G,G 26671910-T-G,G *
56844430-T-A,A *
13489705-A-ACATG 11334029-A-ACATG *
56851299-A-AAGACATATCTCTGCACTGATCACCCCAGGGAGAGAATTCTTGTTTAGGCTCTGCCTACAGGGGGCTTTG *
56856658-G-GA *
56860676-A-ACAC *
9946235-TC-T 10108626-TC-T *
11018936-G-GCA *
11018938-T-TCCA *
13474286-C-T 11318610-C-T *
13478665-CAA-C 11322989-CAA-C *
13478669-C-CCA 11322993-C-CCA *
13480280-C-G 11324604-C-G *
13480932-G-T 11325256-G-T *
56832098-C-CA *
56832100-C-CCCAT *
13699106-AGAATG-A 11543430-AGAATG-A 4×GAATG*
13489697-GTGCCC-G 11334021-GTGCCC-G *
13351971-A-G 11196295-A-G *
6648029-C-T 6779988-C-T YY*
10846985-C-T *
13339632-G-T 11183956-G-T *
13339666-T-C 11183990-T-C *
13478929-C-T 11323253-C-T *
22509512-G-C 20347626-G-C DYZ19 *
13531775-AAC-A 11376099-AAC-A *
13476529-TC-T 11320853-TC-T *
13479222-G-C 11323546-G-C *
4315651-A-G 4447610-A-G *
18290815-CA-C,CAA 16178935-CA-C,CAA P6_Prx 20×A*
19513143-CT-C,CTT 17401263-CT-C,CTT 20×T*
5232664-TA-T 5364623-TA-T 9×A*
28526659-T-TAA 26380512-T-TAA 12×A*
13474363-C-T 11318687-C-T *
13339625-C-T 11183949-C-T *
13356647-G-GA 11200971-G-GA 8×A*
17787106-CAAA-C,CAA 15675226-CAAA-C,CAA 19×A*
22477630-T-A 20315744-T-A DYZ19 *
22477642-G-T 20315756-G-T BY223857 DYZ19 *
4493072-G-T 4625031-G-T *
5986601-T-G 6118560-T-G *
5986607-T-G 6118566-T-G *
10908296-C-T *
3712813-T-TGTGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 3844772-T-TGTGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA *
13420058-C-T 11264382-C-T *
13449747-TCC-T 11294071-TCC-T *
13449750-ATTC-A 11294074-ATTC-A *
13340914-C-T 11185238-C-T *
13378665-C-A 11222989-C-A *
10918013-A-T *
13469944-CCAT-C 11314268-CCAT-C *
13469366-A-G 11313690-A-G *
14650802-C-CA 12538867-C-CA 9×A*
10624743-A-G *
8993805-T-TA 9156196-T-TA 9×A*
13480969-C-G 11325293-C-G *
20242393-C-G 18080507-C-G P5_Dst *
22364674-A-T 20202788-A-T DYZ19 *
22364676-G-T 20202790-G-T DYZ19 *
22364684-TC-T 20202798-TC-T DYZ19 *
22505730-G-A 20343844-G-A DYZ19 *
10908299-CCT-C *
13433308-C-G 11277632-C-G *
13469995-C-A 11314319-C-A *
13483869-A-G 11328193-A-G *
13478443-G-T 11322767-G-T *
13479109-G-A 11323433-G-A *
13479113-C-T 11323437-C-T *
13479123-G-GACA 11323447-G-GACA *
13479155-T-A 11323479-T-A *
13480924-A-C 11325248-A-C *
13463749-A-T 11308073-A-T *
13484223-C-A 11328547-C-A *
13484225-C-A 11328549-C-A *
13484908-T-A 11329232-T-A *
13695185-C-A 11539509-C-A *
13698922-G-C 11543246-G-C *
22288073-GTGT-G 20126187-GTGT-G DYZ19 *
13484089-T-G 11328413-T-G *
56835612-T-C,C *
13449064-AC-A 11293388-AC-A *
13711573-A-G 11555897-A-G *
13449772-TC-T 11294096-TC-T *
13463771-C-T 11308095-C-T *
13469400-C-G 11313724-C-G *
13469598-A-G 11313922-A-G *
13469613-G-A 11313937-G-A *
13469616-G-T 11313940-G-T *
13470334-C-CT 11314658-C-CT *
13470348-CACA-C 11314672-CACA-C *
13470360-G-T 11314684-G-T *
13474380-G-A 11318704-G-A *
13478052-G-C 11322376-G-C *
13479096-C-T 11323420-C-T *
13740226-T-A 11584550-T-A *
22288071-T-TTAG 20126185-T-TTAG DYZ19 *
56839634-G-GAC *
56839635-CAT-C *
10057157-A-G 10219548-A-G *
13261497-G-A 11105821-G-A *
13436740-TTA-T 11281064-TTA-T *
13444667-G-T 11288991-G-T *
13466355-A-C 11310679-A-C *
13466409-A-G 11310733-A-G *
13474386-C-G 11318710-C-G *
13478042-G-A 11322366-G-A *
13484219-A-T 11328543-A-T *
13245158-G-C 11089482-G-C *
13464984-G-T 11309308-G-T *
10918018-A-T *
28542416-CAA-C,CA 26396269-CAA-C,CA 17×A*
3301243-TTATA-T 3433202-TTATA-T 8×TA*
28786400-G-T 26640253-G-T *
13436739-G-C 11281063-G-C *
13464986-C-A 11309310-C-A *
13468416-T-C 11312740-T-C *
13474277-C-A 11318601-C-A *
13480963-G-A 11325287-G-A *
13481000-G-T 11325324-G-T *
13481022-T-C 11325346-T-C *
13483629-T-A 11327953-T-A *
13505936-A-G 11350260-A-G *
13712704-G-A 11557028-G-A *
13740232-G-A 11584556-G-A *
22511043-A-G 20349157-A-G DYZ19 *
28817614-C-G 26671467-C-G *
4880706-A-T 5012665-A-T *
10029240-C-T 10191631-C-T Y*
10908302-G-A *
13469962-G-A 11314286-G-A *
13478260-T-G 11322584-T-G *
13483705-C-G 11328029-C-G *
13487328-C-T 11331652-C-T *
13489228-G-T 11333552-G-T *
13518365-C-T 11362689-C-T *
13722971-T-C 11567295-T-C *
22484074-A-T 20322188-A-T DYZ19 *
28582612-G-A 26436465-G-A *
56859243-T-G *
56854789-G-A *
13374406-C-T 11218730-C-T *
4776622-A-AACAC 4908581-A-AACAC 20×AC*
13734236-C-A 11578560-C-A *
21039096-C-CA 18877210-C-CA 10×A*
10776038-T-TG *
10776039-C-CAACG *
10846969-A-G *
13481031-A-T 11325355-A-T *
56873067-G-T *
13463738-C-A 11308062-C-A *
5059208-C-G 5191167-C-G *
13466113-T-C 11310437-T-C *
13461261-C-T 11305585-C-T *
13469975-C-A 11314299-C-A *
13734117-G-T 11578441-G-T *
14818128-TA-T 12706199-TA-T 9×A*
13463774-G-A 11308098-G-A *
3333291-AT-A 3465250-AT-A 8×T*
13465719-C-T 11310043-C-T *
10669548-C-G *
13487386-C-G 11331710-C-G *
4268175-C-T 4400134-C-T *
5325772-C-T 5457731-C-T *
13468384-G-C,T 11312708-G-C,T *
7534646-A-C 7666605-A-C YY*
13246480-GA-G 11090804-GA-G *
58974481-C-CA 56828334-C-CA *
58980706-AC-A 56834559-AC-A *
59006822-A-AC 56860675-A-AC *
5871981-G-A 6003940-G-A BY58927 *
3240355-ATTTT-A 3372314-ATTTT-A 19×T*
13479102-T-G 11323426-T-G *
16773429-T-G 14661549-T-G YY*
22512552-G-T 20350666-G-T DYZ19 *
5059192-C-G 5191151-C-G *
13480347-G-A 11324671-G-A *
4618457-C-T 4750416-C-T FT7552 *
3449187-A-G 3581146-A-G *
13461266-A-C 11305590-A-C *
13405833-G-A 11250157-G-A *
13470005-A-C 11314329-A-C *
13470013-A-G 11314337-A-G *
13470054-G-C 11314378-G-C *
22483988-G-T 20322102-G-T DYZ19 *
13470656-GTCT-G 11314980-GTCT-G *
13478923-C-T 11323247-C-T *
13605019-CA-C 11449343-CA-C 10×A*
22288244-C-A 20126358-C-A DYZ19 *
9964967-G-C 10127358-G-C Y*
4370462-TA-T 4502421-TA-T *
7483638-TAA-T 7615597-TAA-T IR1_L 23×A*
13339626-C-G 11183950-C-G *
13410455-A-G 11254779-A-G *
13436701-T-A 11281025-T-A *
9984690-A-C 10147081-A-C Y*
13417521-G-C 11261845-G-C *
13528494-A-G 11372818-A-G *
9944114-C-T 10106505-C-T Y*
13417529-G-A 11261853-G-A *
5406828-T-C 5538787-T-C *
13339641-G-A 11183965-G-A *
17332750-C-CA,CAAA 15220870-C-CA,CAAA 22×A*
13474279-T-A 11318603-T-A *
13476558-C-T 11320882-C-T *
13549902-GTGTGTC-G 11394226-GTGTGTC-G *
56859714-G-C *
22484060-T-G 20322174-T-G DYZ19 *
22484065-A-G 20322179-A-G DYZ19 *
22484069-C-T 20322183-C-T DYZ19 *
4116812-C-G 4248771-C-G *
3970985-CT-C,CTT 4102944-CT-C,CTT 17×T*
13420047-C-A 11264371-C-A *
9946217-T-C 10108608-T-C Y*
9946220-C-T 10108611-C-T Y*
9946225-G-C 10108616-G-C Y*
9994748-T-G 10157139-T-G Y*
10062628-T-G 10225019-T-G *
13378654-T-A 11222978-T-A *
13378664-G-T 11222988-G-T *
4106178-C-T 4238137-C-T *
13476552-G-T 11320876-G-T *
13246559-T-C 11090883-T-C *
13378265-C-A 11222589-C-A *
13406862-A-G 11251186-A-G *
13479154-C-A 11323478-C-A *
5303229-A-G 5435188-A-G FGC69293 *
15177245-T-TA 13065331-T-TA 9×A*
7124388-C-CAA 7256347-C-CAA 17×A*
9941595-C-T 10103986-C-T Y*
13420038-C-T 11264362-C-T *
13977176-T-C 11856470-T-C Y*
15912055-CTTT-C,CTT 13800175-CTTT-C,CTT 21×T*
21091076-A-G 18929190-A-G YY*
28795191-G-C 26649044-G-C *
56856958-T-A *

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: B1614161561150893637888264475
Used in age calculations1561150893637888264475
Counts of SNPs16969
Variant counts last updated 2022-11-22 03:02:01.



Big Tree Main Page