Tree Position

R-M269 > L23 > L51 > P310 > L151 > S1194 > S1200 > S14328 > 13184964-C-G > BY46915

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRKane-BY3
B30882
13451345-C-T 11295669-C-T *
10953128-A-AG +
10909778-A-G +
10953121-T-C +
10953125-AT-A +
10953132-C-G +
10953137-C-G +
10953139-C-G +
10960289-C-A +
10846844-C-T +
13302719-A-G 11147043-A-G +
10688239-T-A +
10953098-C-A +
10958311-CTCCATTCCAT-C +
10994462-T-C +
10989909-T-C +
13474536-G-T 11318860-G-T +
10880381-G-C +
21482762-CTTTT-C 19320876-CTTTT-C 19×T+
13474777-G-A 11319101-G-A +
10953108-C-T +
10953092-G-C +
17932-G-C +
10661330-C-CCCATTCCATTCCATT +
10002488-C-A 10164879-C-A Y+
10053853-G-T 10216244-G-T +
10053854-G-A 10216245-G-A +
10079991-G-T 10242382-G-T +
10973451-C-T +
10082065-ATG-A 10244456-ATG-A +
10082069-A-ACT 10244460-A-ACT +
10082080-AG-A 10244471-AG-A +
10688177-T-TTCCACTCCAC +
10953091-T-A +
10760799-G-T +
10844904-ACTCCT-A +
11025536-T-C +
10911569-T-A +
10927413-A-C +
10934880-T-C +
10927462-C-G +
58976120-C-T 56829973-C-T +
58893731-T-C 56697140-A-G +
13833584-A-ATGGAATAGAATGGAATGGAC 11712878-A-ATGGAATAGAATGGAATGGAC +
10753590-A-C +
22343182-T-A 20181296-T-A DYZ19 +
58985148-G-A 56839001-G-A +
22354934-G-T 20193048-G-T DYZ19 +
58985123-C-G 56838976-C-G +
58997015-G-T 56850868-G-T +
58987931-C-T 56841784-C-T +
18050651-G-T 15938771-G-T YY+
18185574-ATACC-A 16073694-ATACC-A +
22282012-T-A 20120126-T-A DYZ19 +
13362307-C-A 11206631-C-A +
58874797-T-A 56716074-A-T +
58985117-A-T 56838970-A-T +
18793667-T-A 16681787-T-A YY+
18975472-C-A 16863592-C-A Y+
22354928-A-C 20193042-A-C DYZ19 +
19427272-C-A 17315392-C-A Y+
22354946-C-A 20193060-C-A BY217614 DYZ19 +
22358682-G-C 20196796-G-C DYZ19 +
15092756-CAA-C 12980845-CA-C 10×A+
13362318-C-T 11206642-C-T +
13474549-CT-C 11318873-CT-C +
22811094-A-G 20649208-A-G Y+
9983122-C-A 10145513-C-A Y+
13930695-C-A 11809989-C-A Y+
58874785-T-A 56716086-A-T +
22354945-C-A 20193059-C-A DYZ19 +
22354938-G-A 20193052-G-A DYZ19 +
22354933-A-C 20193047-A-C DYZ19 +
58882444-T-G 56708427-A-C +
14861988-G-A 12750054-G-A BY98070 YY+
10063414-C-G 10225805-C-G +
13433607-A-T 11277931-A-T +
58893713-G-T 56697158-C-A +
22329654-G-A 20167768-G-A FGC42689 DYZ19 +
16300359-C-G 14188479-C-G BY106774 YY+
16622099-C-A 14510219-C-A Y+
16634908-C-T 14523028-C-T BY109127 YY+
16652382-G-T 14540502-G-T Y+
13592968-C-T 11437292-C-T +
17070186-C-A 14958306-C-A Y+
10795317-C-A +
10927421-T-C +
22354955-C-T 20193069-C-T DYZ19 +
10838997-C-T FT272358 +
10829722-G-C +
10829730-T-A +
4673335-G-T 4805294-G-T +
10829731-C-G +
14785424-C-A 12673494-C-A YY+
4665424-C-A 4797383-C-A +
10909758-A-C +
10909753-A-G +
10994451-CCATTA-C +
22811107-C-T 20649221-C-T Y+
28804478-AAAAT-A 26658331-AAAAT-A +
10880384-T-C +
10668329-C-CCA +
10846809-G-T +
10082062-G-C 10244453-G-C +
10082045-T-A 10244436-T-A +
10082036-C-T 10244427-C-T +
10082024-A-T 10244415-A-T +
22293473-A-T 20131587-A-T FGC18827Y21783 DYZ19 +
22229384-CCTCCCAGAAGGAAGAAACTCTAGACACATTTGATGGAACAAACTCTGGACATAAAACCTTTAAGTGCTGTAACGCTCACCACTAAGGTCTGCGGCTTCATTCTTGAAGAGAACAAGACCATGAA-C 20067498-CCTCCCAGAAGGAAGAAACTCTAGACACATTTGATGGAACAAACTCTGGACATAAAACCTTTAAGTGCTGTAACGCTCACCACTAAGGTCTGCGGCTTCATTCTTGAAGAGAACAAGACCATGAA-C DYZ19 +
21816467-C-A 19654581-C-A YY+
56728228-G-C +
58906634-A-C 56684237-T-G +
10927429-T-C +
10953133-C-A +
7707-G-T +
10927424-T-C +
10829721-C-T +
15773666-C-A 13661786-C-A Y+
10953095-T-A +
16409-G-C +
22229381-GA-G 20067495-GA-G DYZ19 +
16395-C-G +
16387-G-T +
12739-C-T +
10082082-T-A 10244473-T-A +
7567753-CTTTTTT-C 7699712-CTTTTTT-C 25×T+
58997080-C-A 56850933-C-A +
22123079-G-T 19961193-G-T YY+
10668330-T-TTCCACTCC +
10889535-A-G +
56847178-C-A +
9640925-G-A 9803316-G-A IR3_Prx +
8169335-G-T 8301294-G-T YY+
11025522-T-C +
11657655-C-A +
56842279-T-A +
10909762-T-G +
10768113-C-T +
10768105-C-A +
11025541-T-A +
10790316-G-C +
8306306-A-C 8438265-A-C BY71555 YY+
19511947-C-A 17400067-C-A YY+
13461204-A-G 11305528-A-G +
10768103-T-A +
10687845-C-A +
10927441-C-T +
10767728-A-C +
9398900-A-G 9561291-A-G BY79220 YY+
10992946-C-G +
10927454-C-T +
10657365-C-A +
5761202-A-G 5893161-A-G +
56831004-A-C +
10846885-T-C +
22361004-GAGTTTGTTCCTTCAGATGTGTCCAGGGTTTCTGTCTTCTGGCAGGTTCATGGTCTTGCTCACTTCACTAAACGAAGCTGCAGACCTTACTGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAC-G 20199118-GAGTTTGTTCCTTCAGATGTGTCCAGGGTTTCTGTCTTCTGGCAGGTTCATGGTCTTGCTCACTTCACTAAACGAAGCTGCAGACCTTACTGGTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAC-G DYZ19 +
13473520-C-CT 11317844-C-CT +
13473521-C-CTGGGTGA 11317845-C-CTGGGTGA +
15201303-C-A 13089389-C-A YY+
7042948-C-A 7174907-C-A Y+
4017018-C-A 4148977-C-A +
11023034-C-A +
14316186-C-CTT 12195480-C-CTT 14×T+
2832544-A-G 2964503-A-G BY56731 YY+
10754046-G-T +
2962187-A-C 3094146-A-C +
3110207-A-C 3242166-A-C +
10909759-G-A +
3605869-G-T 3737828-G-T +
4149939-C-A 4281898-C-A +
4274347-C-A 4406306-C-A +
56848869-G-T +
7534406-GTTTT-G 7666365-GTTTT-G 19×T+
9962341-A-T 10124732-A-T Y+
9830284-C-A 9992675-C-A YY+
23352479-C-A 21190593-C-A YY+
22282032-C-T 20120146-C-T DYZ19 +
13805169-ATGTAT-A 11684463-ATGTAT-A +
22811080-C-G 20649194-C-G CTS10866 Y+
22811086-G-C 20649200-G-C CTS10867 Y+
56865999-C-G +
56710921-T-G +
13480659-C-T 11324983-C-T +
22281895-T-TGTCCAGAG 20120009-T-TGTCCAGAG DYZ19 +
58827223-G-T 56763648-C-A +
15755-T-C +
22282024-C-T 20120138-C-T DYZ19 +
23465703-C-A 21303817-C-A Y+
23448465-G-T 21286579-G-T Y+
56860126-C-A +
22528510-A-G 20366624-A-G BY138785 Y+
22749302-G-T 20587416-G-T BY196305 YY+
24991725-T-G 22845578-T-G g1 +
58997079-A-T 56850932-A-T +
23786303-T-C 21624417-T-C Y+
15732-T-A +
13480608-A-T 11324932-A-T +
17928-C-CA +
13480598-T-G 11324922-T-G +
28734809-G-T 26588662-G-T Y+
17930-AG-A +
28603027-G-T 26456880-G-T +
13480609-A-G 11324933-A-G +
22343178-G-C 20181292-G-C DYZ19 +
56831006-C-G +
3436239-A-T 3568198-A-T FGC37003L272 +
22352500-T-C 20190614-T-C DYZ19 +
13465111-C-T 11309435-C-T *
13474420-C-G 11318744-C-G *
2862863-T-A 2994822-T-A YY*
27316039-C-A 25169892-C-A P1_g3 *
2884333-T-C 3016292-T-C YY*
13481859-CT-C 11326183-CT-C *
7531416-G-A 7663375-G-A YY*
13465109-G-A 11309433-G-A *
23196315-C-A 21034429-C-A Y*
22682413-C-CAA 20520527-C-CAA 11×A*
13464513-C-G 11308837-C-G *
11322582-AGTG- *
13471754-A-C 11316078-A-C *
4093834-C-A 4225793-C-A *
13693738-GGAATGGCATA-G 11538062-GGAATGGCATA-G *
2668088-C-A 2800047-C-A YY*
25496569-C-A 23350422-C-A P2_r2 *
26042303-C-A 23896156-C-A P1_Y1 *
13488946-A-T,T 11333270-A-T,T *
26325344-C-A 24179197-C-A P1_Y1 *
3161255-C-A 3293214-C-A *
25175598-C-A 23029451-C-A g1 *
2798794-C-A 2930753-C-A YY*
2796118-T-C 2928077-T-C YY*
3467388-C-A 3599347-C-A *
3967002-C-T 4098961-C-T *
2794866-C-A 2926825-C-A YY*
25496577-C-A 23350430-C-A P2_r2 *
25008683-G-T 22862536-G-T g1 *
2880826-C-A 3012785-C-A YY*
2844199-G-T 2976158-G-T YY*
3817779-G-T 3949738-G-T *
2704973-C-A 2836932-C-A YY*
21281806-G-A 19119920-G-A FT385755 Y*
13451191-T-TCCATTCCATTCCACTGCATTCCACTCCACTC 11295515-T-TCCATTCCATTCCACTGCATTCCACTCCACTC *
56839453-A-G *
13473514-CAATG-C 11317838-CAATG-C *
13462246-C-T 11306570-C-T *
13463296-C-A 11307620-C-A *
22479687-CAG-C 20317801-CAG-C DYZ19 *
22479684-C-CAT 20317798-C-CAT DYZ19 *
13450172-CACTCCATT-C 11294496-CACTCCATT-C *
28601116-C-T 26454969-C-T Y*
56832940-C-CCTCCACTGCATTACATTCTACTCCACTCCA *
22475052-G-A 20313166-G-A BY48004 DYZ19 *
28243704-GGA-G 26097557-GGA-G P1_b4 *
22475020-C-T 20313134-C-T DYZ19 *
18679925-CAAA-C,CAAAA 16568045-CAAA-C,CAAAA 25×A*
13721288-A-G 11565612-A-G *
14063145-C-CAGATAGAT,CAGATAGATAGAT 11942439-C-CAGATAGAT,CAGATAGATAGAT 13×AGAT*
28601166-T-G 26455019-T-G Y*
13485720-ACCTGGGTGATCAGTGCAGAGATATGTGACAAGGCCCCTTTAAGCAGAACCTAGACAATTGTTACATCACCTGAGTGATCAGTGCGGAGAACTGTCAAAATGCCCCTTTAGGCAGAGCTTAGATCAGAGTTACACCG-A 11330044-ACCTGGGTGATCAGTGCAGAGATATGTGACAAGGCCCCTTTAAGCAGAACCTAGACAATTGTTACATCACCTGAGTGATCAGTGCGGAGAACTGTCAAAATGCCCCTTTAGGCAGAGCTTAGATCAGAGTTACACCG-A *
28698403-C-A 26552256-C-A *
13476668-G-T 11320992-G-T *
13477673-T-C 11321997-T-C *
27861591-A-G 25715444-A-G P1_Y2 *
13483734-T-A 11328058-T-A *
13695761-G-A 11540085-G-A *
17441783-GTATC-G,G 15329903-GTATC-G,G 12×TATC*
22486130-C-T 20324244-C-T BY47372 DYZ19 *
56834779-G-A,GCGTTC 4×CATTC*
13483747-T-A 11328071-T-A *
13473811-T-C 11318135-T-C *
27336275-TATTA-T 25190128-TATTA-T P1_g3 *
13473806-G-T 11318130-G-T *
13467958-A-T 11312282-A-T *
10822734-T-A *
13477674-G-C 11321998-G-C *
10822732-A-G *
10822687-ATTCCATTGCATTGTG-A *
10662132-AT-A,A *
13472207-C-CTT 11316531-C-CTT *
28813832-T-TGGAAC 26667685-T-TGGAAC *
13477690-C-G 11322014-C-G *
13477678-T-C 11322002-T-C *
27338187-GA-G 25192040-GA-G P1_g3 8×A*
4129391-C-A 4261350-C-A *
5675314-G-T 5807273-G-T *
24991493-C-A 22845346-C-A g1 *
7651349-C-A 7783308-C-A YY*
23834632-G-A 21672746-G-A Y*
8012565-GA-G 8144524-GA-G *
7897451-G-T 8029410-G-T Y*
7868981-A-G 8000940-A-G YY*
23855774-T-C 21693888-T-C Y*
7854450-C-A 7986409-C-A YY*
7780409-C-A 7912368-C-A YY*
7656041-C-A 7788000-C-A YY*
23856926-T-C 21695040-T-C Y*
23825589-C-A 21663703-C-A Y*
7648972-C-A 7780931-C-A YY*
7645748-C-A 7777707-C-A YY*
7567796-C-A 7699755-C-A YY*
23885359-G-T 21723473-G-T Y*
7516600-A-G 7648559-A-G Y*
7497013-G-T 7628972-G-T IR1_L *
7470812-A-G 7602771-A-G IR1_L *
7321772-C-A 7453731-C-A YY*
23831139-A-G 21669253-A-G Y*
23823392-G-GA 21661506-G-GA *
7281600-C-A 7413559-C-A YY*
8660177-C-A 8792136-C-A FT195692 YY*
8806558-C-A 8938517-C-A YY*
23759138-G-T 21597252-G-T Y*
8793426-C-A 8925385-C-A YY*
8778160-T-A 8910119-T-A YY*
8766601-C-A 8898560-C-A YY*
8765859-C-A 8897818-C-A YY*
8744777-C-A 8876736-C-A YY*
8735153-AGTGTT-A 8867112-AGTGTT-A *
8627474-GCCT-G 8759433-GCCT-G *
8043020-C-A 8174979-C-A YY*
8597468-C-A 8729427-C-A YY*
8536230-ACCTGGT-A 8668189-ACCTGGT-A *
8390575-T-C 8522534-T-C YY*
8383888-C-A 8515847-C-A YY*
8379058-C-A 8511017-C-A YY*
8234352-T-C 8366311-T-C YY*
8169070-C-A 8301029-C-A YY*
8158269-C-CT 8290228-C-CT *
8133184-C-A 8265143-C-A YY*
7307244-G-GTT 7439203-G-GTT 11×T*
7221225-C-A 7353184-C-A YY*
4626441-G-T 4758400-G-T *
24399997-C-A 22253850-C-A Y*
6402311-CTTCCGTGTCGTAAAATACCGACGTATTT-C 6534270-CTTCCGTGTCGTAAAATACCGACGTATTT-C *
6360631-G-T 6492590-G-T *
6252197-C-A 6384156-C-A IR3_Dst *
6152343-C-A 6284302-C-A IR3_Dst *
24217086-C-A 22070939-C-A P3_b1 *
6149272-G-T 6281231-G-T IR3_Dst *
6146936-C-A 6278895-C-A IR3_Dst *
5968004-C-G 6099963-C-G *
24483889-G-A 22337742-G-A *
6492333-C-A 6624292-C-A *
4293247-A-AT 4425206-A-AT 9×T*
24500770-C-A 22354623-C-A FT419100 *
5449112-C-A 5581071-C-A *
5193951-C-A 5325910-C-A *
5185980-T-C 5317939-T-C *
4925504-C-T 5057463-C-T *
24907156-C-A 22761009-C-A g1 *
4740734-T-C 4872693-T-C *
6434753-C-A 6566712-C-A *
6644376-G-T 6776335-G-T YY*
7205559-C-A 7337518-C-A YY*
23963931-C-A 21817784-C-A Y*
7200235-C-A 7332194-C-A Y*
7157921-C-A 7289880-C-A YY*
7090125-C-A 7222084-C-A YY*
7073055-C-A 7205014-C-A YY*
7052838-C-A 7184797-C-A YY*
7014381-G-T 7146340-G-T YY*
7009399-C-A 7141358-C-A YY*
6990723-C-A 7122682-C-A YY*
6957122-C-A 7089081-C-A YY*
6662161-C-A 6794120-C-A YY*
6890358-A-AT 7022317-A-AT *
6880327-GA-G 7012286-GA-G *
24148193-C-A 22002046-C-A P3_b1 *
6858579-G-A 6990538-G-A YY*
6856815-C-A 6988774-C-A YY*
6741264-C-A 6873223-C-A YY*
6741263-G-A 6873222-G-A YY*
6672237-CT-C 6804196-CT-C *
6666830-C-A 6798789-C-A YY*
13476644-G-A 11320968-G-A *
13811250-A-G 11690544-A-G *
28770342-C-A 26624195-C-A Y*
18085754-G-T 15973874-G-T Y*
13476575-T-A 11320899-T-A *
13465561-T-A 11309885-T-A *
56834197-T-TTG *
56834769-G-GTATTCCATTCCAGTCTATTCCATTACATTCCACTCCACT *
10841993-C-T *
22701655-AT-A 20539769-AT-A 9×T*
23759113-TAAA-T,TA 21597227-TAAA-T,TA 24×A*
56836228-G-A *
13481867-C-T 11326191-C-T BY86084 *
13461756-G-T 11306080-G-T *
22298381-G-C 20136495-G-C FT455407 DYZ19 *
22508730-T-A 20346844-T-A DYZ19 *
13476664-A-G 11320988-A-G *
13466800-G-A 11311124-G-A *
22490655-C-G 20328769-C-G DYZ19 *
13480347-G-A 11324671-G-A *
9368554-G-A 9530945-G-A Y*
8161235-C-A 8293194-C-A YY*
13476676-A-T 11321000-A-T *
13451211-C-CCATTCCATTCCATTCCATTCCACGT 11295535-C-CCATTCCATTCCATTCCATTCCACGT *
13489886-C-G 11334210-C-G *
22475305-G-T 20313419-G-T DYZ19 *
56826968-T-TCCA *
13470689-T-G 11315013-T-G *
13464508-T-A 11308832-T-A *
56832539-C-CCAT *
56832931-T-TCCTCTCCAC *
28805430-A-G 26659283-A-G *
28805415-G-T 26659268-G-T BY227407 *
13723454-A-AT 11567778-A-AT *
10668345-T-TCC *
9959873-TAATAATAATAA-T 10122264-TAATAATAATAA-T *
56826965-T-TCCATGGC *
13722919-AATGGAATGGAACGGAATTGAATGTCATGGAATGGAATGGC-A 11567243-AATGGAATGGAACGGAATTGAATGTCATGGAATGGAATGGC-A *
28813320-G-T 26667173-G-T *
13748441-TGGAATGGAA-T 11592765-TGGAATGGAA-T *
13748439-AC-A 11592763-AC-A *
13712693-G-T 11557017-G-T *
13707133-G-C 11551457-G-C *
13707121-T-G 11551445-T-G *
56833540-T-G *
13466420-AAG-A 11310744-AAG-A *
13464522-T-TATGG 11308846-T-TATGG *
28792816-G-T 26646669-G-T *
22562579-T-C 20400693-T-C YY*
13868765-GGAACA-G 11748059-GGAACA-G *
22011859-C-A 19849973-C-A Y*
10822720-T-C *
13468493-C-A 11312817-C-A *
8634381-TACAC-T,TAC 8766340-TACAC-T,TAC 22×AC*
9442809-C-A 9605200-C-A YY*
11655724-C-CGGAAT *
8501818-C-A 8633777-C-A YY*
2862729-C-A 2994688-C-A YY*
22490651-T-G 20328765-T-G DYZ19 *
22571758-C-A 20409872-C-A YY*
22487004-G-A 20325118-G-A DYZ19 *
19107548-C-A 16995668-C-A YY*
17425333-C-A 15313453-C-A YY*
8046307-C-A 8178266-C-A YY*
14377227-C-A 12256523-C-A YY*
17279201-C-A 15167321-C-A YY*
13711713-AGAATGGAATGGAATG-A 11556037-AGAATGGAATGGAATG-A BY33655 7×GAATG*
13474421-A-C 11318745-A-C *
13464976-A-C 11309300-A-C *
13464965-C-A 11309289-C-A *
13694144-C-G 11538468-C-G *
22487005-C-G 20325119-C-G DYZ19 *
4229878-C-A 4361837-C-A *
13711855-G-T 11556179-G-T *
13474331-A-C 11318655-A-C *
56837551-T-A *
56837570-G-A *
56839396-G-A *
56839590-T-A *
56842427-C-T,T *
3345921-C-A 3477880-C-A *
14972949-G-GA 12861024-G-GA 9×A*
56860420-A-G *
8700936-CA-C 8832895-CA-C 9×A*
28811050-A-T 26664903-A-T *
22038867-C-A 19876981-C-A YY*
14841375-AT-A 12729442-AT-A 9×T*
28792815-T-G 26646668-T-G *
28807910-T-C 26661763-T-C FT462461 *
13489955-C-A 11334279-C-A *
13473921-T-C 11318245-T-C *
13465562-A-G 11309886-A-G *
13465551-G-T 11309875-G-T *
9980343-A-T 10142734-A-T Y*
13470781-G-T 11315105-G-T *
13868779-T-TCAAAA 11748073-T-TCAAAA *
56684224-A-G *
13702754-A-AGAACGGAC 11547078-A-AGAACGGAC *
13470680-G-A 11315004-G-A *
13449038-CACT-C 11293362-CACT-C *
22236198-AAG-A 20074312-AAG-A DYZ19 *
13811244-G-C 11690538-G-C *
13811241-A-ATCAACTCGAT 11690535-A-ATCAACTCGAT *
56756784-G-C *
13465169-C-T 11309493-C-T *
13461903-G-A 11306227-G-A *
13702753-A-ATC 11547077-A-ATC *
13446804-GCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATT-G,GCCATTCCATTCCATTCCATTCCATTCCATTCCATT 11291128-GCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCATT-G,GCCATTCCATTCCATTCCATTCCATTCCATTCCATT 12×CCATT*
56827581-C-CGAGTCCATTCCATGT *
56829782-AC-A *
13474366-G-A 11318690-G-A *
13469098-G-T 11313422-G-T *
56706921-C-G *
22229214-A-T 20067328-A-T DYZ19 *
56834420-T-TCCAC *
13989474-T-G 11868768-T-G YY*
56834457-C-CCACTCCATTT *
13473969-G-T 11318293-G-T *
13451897-T-TTC 11296221-T-TTC *
13489384-G-T 11333708-G-T *
20307446-G- DYZ19 *
56685484-T-C *
56707002-T-TGGAAG *
13465171-C-A 11309495-C-A *
56834400-C-CCACTCCAT *
8834964-C-A 8966923-C-A YY*
13485587-C-CG 11329911-C-CG *
28791498-G-T 26645351-G-T *
28791481-T-A 26645334-T-A *
23128176-C-A 20966290-C-A Y*
56707345-A-T *
13483443-G-T 11327767-G-T *
22299274-T-TC,TC 20137388-T-TC,TC DYZ19 *
16747334-C-A 14635454-C-A YY*
14597878-C-A 12486078-C-A YY*
13488089-CGAG-C 11332413-CGAG-C *
13488088-C-CAA 11332412-C-CAA *
13483425-G-T 11327749-G-T *
13472208-CCA-C 11316532-CCA-C *
26645284-TGTAAGGGA- *
26645281-GAA- *
56834419-A-AC *
13469944-C-T 11314268-C-T *
56832493-A-AGT *
13480379-T-C 11324703-T-C *
13471846-C-A 11316170-C-A *
13471819-C-T 11316143-C-T *
56831393-C-CCACTCCATTT,T *
56831647-A-AC *
56831648-T-TCCACTCCAC *
13692901-AATC-A 11537225-AATC-A *
56832008-C-A *
13692898-TGG-T 11537222-TGG-T *
13483303-G-A 11327627-G-A *
56836297-C-CCATTG *
13476528-C-T 11320852-C-T *
22511759-C-A 20349873-C-A DYZ19 *
13451164-A-AC 11295488-A-AC *
56832303-C-T,T *
10822723-C-T *
10822714-TTC-T *
10822712-A-AAT *
10822709-T-G *
24879654-G-C 22733507-G-C g1 *
56832484-T-C *
13471872-G-T 11316196-G-T *
56831386-T-TTCCAC *
13462156-G-A 11306480-G-A *
17913436-C-T 15801556-C-T YY*
13723017-CA-C 11567341-CA-C *
56829787-A-C *
56831239-CACTGA-C *
13722982-GGAATGGAA-G 11567306-GGAATGGAA-G *
13722979-AAT-A 11567303-AAT-A *
13466415-T-TAG 11310739-T-TAG *
13451165-T-TCCACTCCAC 11295489-T-TCCACTCCAC *
28791415-T-C 26645268-T-C *
22502762-G-A 20340876-G-A DYZ19 *
17913434-C-A 15801554-C-A YY*
13476701-G-C 11321025-G-C *
17913371-A-G 15801491-A-G YY*
13707078-A-AATGC 11551402-A-AATGC *
13483732-G-A 11328056-G-A *
13470457-A-C 11314781-A-C *
10934865-T-A *
56832960-C-A,CCACTCCA *
13490016-T-C 11334340-T-C *
56831382-A-ATGATT *
13483314-C-T 11327638-C-T *
8827601-C-A 8959560-C-A YY*
9006824-C-A 9169215-C-A Y*
8860902-T-C 8992861-T-C YY*
16561243-C-A 14449363-C-A YY*
16696818-C-A 14584938-C-A YY*
21971777-CT-C 19809891-CT-C 8×T*
16650351-GAAAGCA-G 14538471-GAAAGCA-G *
21984854-C-A 19822968-C-A YY*
16630387-C-A 14518507-C-A YY*
22002044-T-C 19840158-T-C YY*
16596150-C-A 14484270-C-A YY*
16585397-C-A 14473517-C-A YY*
16558177-T-A 14446297-T-A YY11×TA*
16745829-C-A 14633949-C-A YY*
16434781-C-A 14322901-C-A YY*
16434624-T-C 14322744-T-C YY*
16340909-C-A 14229029-C-A YY*
16337042-A-G 14225162-A-G YY*
22008726-C-A 19846840-C-A YY*
16249005-T-C 14137125-T-C YY*
16221162-C-A 14109282-C-A YY*
16093573-C-A 13981693-C-A Y*
16089549-C-A 13977669-C-A Y*
16740230-C-A 14628350-C-A YY*
16762360-G-A 14650480-G-A YY*
16050604-C-A 13938724-C-A YY*
17112886-A-G 15001006-A-G YY*
17240645-C-A 15128765-C-A YY*
21858898-C-A 19697012-C-A YY*
17192920-G-A 15081040-G-A YY*
17185164-C-A 15073284-C-A YY*
17151921-C-A 15040041-C-A YY*
17133839-C-A 15021959-C-A YY*
21895268-C-A 19733382-C-A YY*
21908573-C-A 19746687-C-A YY*
21928694-G-T 19766808-G-T YY*
17111150-C-A 14999270-C-A YY*
16768253-AG-A 14656373-AG-A *
17072769-C-A 14960889-C-A YY*
21953988-C-A 19792102-C-A YY*
16969655-C-A 14857775-C-A YY*
16933365-C-T 14821485-C-T YY*
16923866-C-A 14811986-C-A YY*
21954090-C-A 19792204-C-A YY*
16913121-C-A 14801241-C-A YY*
16840399-C-A 14728519-C-A YY*
16828608-C-A 14716728-C-A YY*
16078367-C-A 13966487-C-A Y*
15944483-C-A 13832603-C-A YY*
17279228-A-G 15167348-A-G YY*
15091869-C-A 12979958-C-A YY*
15302858-C-A 13190957-C-A Y*
15271480-C-A 13159569-C-A YY*
15253870-C-A 13141956-C-A YY*
13084818-T- *
15174671-C-A 13062757-C-A YY*
15134359-A-G 13022446-A-G YY*
15129337-C-A 13017424-C-A YY*
15114046-C-A 13002133-C-A YY*
15076098-T-C 12964188-T-C YY*
15324301-A-C 13212419-A-C YY*
15050061-T-C 12938152-T-C YY*
15027523-C-A 12915611-C-A YY*
14925568-A-G 12813633-A-G YY*
22133821-CAACA-C 19971935-CAACA-C *
14858206-C-A 12746272-C-A YY*
14856020-C-A 12744086-C-A YY*
14846657-C-A 12734723-C-A YY*
14836612-C-A 12724679-C-A YY*
14827445-C-A 12715512-C-A YY*
15308504-C-A 13196606-C-A YY*
15374390-C-A 13262510-C-A YY*
15848495-C-A 13736615-C-A YY*
15680374-C-A 13568494-C-A Y*
22039886-C-A 19878000-C-A YY*
15821317-C-A 13709437-C-A YY*
15816682-G-A 13704802-G-A YY*
15813159-C-T 13701279-C-T YY*
15785658-C-A 13673778-C-A YY*
15778546-C-A 13666666-C-A YY*
15777378-T-C 13665498-T-C YY*
15731819-C-A 13619939-C-A YY*
15730310-C-A 13618430-C-A YY*
15618910-G-A 13507030-G-A YY*
22121446-C-A 19959560-C-A YY*
15555945-C-A 13444065-C-A YY*
15457843-A-G 13345963-A-G YY*
22040001-C-A 19878115-C-A YY*
15445715-A-G 13333835-A-G YY*
15435641-C-A 13323761-C-A YY*
15434471-T-A 13322591-T-A YY*
15416158-C-A 13304278-C-A YY*
15392806-TACTTAAAA-T 13280926-TACTTAAAA-T *
22113373-C-A 19951487-C-A YY*
17279184-C-A 15167304-C-A YY*
17299921-CATAGATAG-C,CATAG 15188041-CATAGATAG-C,CATAG 12×ATAG*
14782420-C-A 12670490-C-A YY*
19060942-C-A 16949062-C-A YY*
19287290-C-A 17175410-C-A YY*
19266846-C-A 17154966-C-A YY*
19229258-C-A 17117378-C-A YY*
19226369-C-A 17114489-C-A YY*
19205795-C-A 17093915-C-A YY*
19204598-G-A 17092718-G-A YY*
19127329-C-A 17015449-C-A YY*
19127314-C-A 17015434-C-A YY*
19039036-C-A 16927156-C-A YY*
19338993-C-A 17227113-C-A YY*
19010390-C-A 16898510-C-A YY*
21642933-C-A 19481047-C-A YY*
18973329-C-A 16861449-C-A YY*
18898324-C-A 16786444-C-A YY*
18828470-C-A 16716590-C-A YY*
18762543-T-G 16650663-T-G YY*
18716075-G-T 16604195-G-T YY*
21648669-C-A 19486783-C-A YY*
18682473-A-G 16570593-A-G YY*
19324033-C-A 17212153-C-A YY*
19356786-C-A 17244906-C-A YY*
21666908-C-A 19505022-C-A YY*
20841059-C-A 18679173-C-A P4_Gap *
21187164-C-A 19025278-C-A YY*
21162251-C-A 19000365-C-A YY*
21295739-T-C 19133853-T-C YY*
21340463-C-T 19178577-C-T YY*
21145326-C-A 18983440-C-A YY*
21407155-G-A 19245269-G-A YY*
21141595-C-A 18979709-C-A YY*
20895292-G-T 18733406-G-T P4_Dst *
20871643-C-A 18709757-C-A P4_Dst *
20536301-G-T 18374415-G-T P5_Dst *
19395216-C-A 17283336-C-A YY*
20363316-G-T 18201430-G-T P5_Dst *
20000489-G-T 17888609-G-T P5_Prx *
19873690-C-T 17761810-C-T P5_Prx *
19643577-AT-A 17531697-AT-A P5_Prx *
21557020-G-A 19395134-G-A YY*
19502993-TTTA-T 17391113-TTTA-T *
19467536-C-A 17355656-C-A YY*
21603855-C-A 19441969-C-A YY*
21616336-C-A 19454450-C-A YY*
18679356-A-T 16567476-A-T YY*
18677585-ACC-A 16565705-ACC-A *
17327503-C-A 15215623-C-A YY*
17751091-C-A 15639211-C-A YY*
17928626-A-C 15816746-A-C Y*
17913669-C-A 15801789-C-A YY*
17894308-C-A 15782428-C-A YY*
21731635-C-A 19569749-C-A YY*
17852933-C-A 15741053-C-A YY*
17756042-G-A 15644162-G-A YY*
17755771-C-A 15643891-C-A YY*
21785133-G-A 19623247-G-A YY*
17729996-A-G 15618116-A-G YY*
18020271-C-A 15908391-C-A Y*
21814785-C-A 19652899-C-A YY*
17715914-C-A 15604034-C-A FTB60593 YY*
17709137-C-A 15597257-C-A YY*
17678480-C-A 15566600-C-A YY*
17673526-C-A 15561646-C-A YY*
17564912-GAAAA-G,GAAAAA 15453032-GAAAA-G,GAAAAA 16×A*
17557953-C-A 15446073-C-A YY*
21818001-C-A 19656115-C-A FT25689 YY*
17416395-C-A 15304515-C-A YY*
18005782-C-A 15893902-C-A P7_Gap Y*
21731608-C-A 19569722-C-A YY*
18663491-C-A 16551611-C-A YY*
18401742-C-A 16289862-C-A P6_Gap *
21672752-C-A 19510866-C-A YY*
21677805-C-A 19515919-C-A Y*
18650346-C-A 16538466-C-A YY*
18646635-C-A 16534755-C-A YY*
18639773-C-A 16527893-C-A YY*
18593162-C-A 16481282-C-A YY*
18561057-C-A 16449177-C-A YY*
18528036-A-G 16416156-A-G P6_Dst *
18421730-C-A 16309850-C-A P6_Gap *
18292656-T-C 16180776-T-C P6_Prx *
18051014-TA-T 15939134-TA-T 8×A*
18286581-C-A 16174701-C-A P6_Prx *
18238850-C-A 16126970-C-A Y*
18238838-A-G 16126958-A-G Y*
21708134-C-CT 19546248-C-CT 8×T*
18184936-C-A 16073056-C-A Y*
18176630-GTA-G 16064750-GTA-G *
18145496-C-A 16033616-C-A YY*
18124632-T-TA,TAA 16012752-T-TA,TAA 15×A*
15948152-T- *
14785991-TTCATTAGTG-T 12674061-TTCATTAGTG-T *
14696353-C-A 12584419-C-A YY*
8866100-G-T 8998059-G-T Y*
22868000-C-A 20706114-C-A FT80059 YY*
10986863-A-ACTCCC *
10970988-T-C *
22489918-A-G 20328032-A-G DYZ19 *
22550268-C-CT 20388382-C-CT 8×T*
13473931-C-T 11318255-C-T *
22758270-CAG-C 20596384-CAG-C *
22759407-A-T 20597521-A-T YY*
22796152-GTATAAATTTGCTTT-G 20634266-GTATAAATTTGCTTT-G *
22920605-CTTTT-C,CTTT 20758719-CTTTT-C,CTTT 25×T*
11018271-TCCACTCCATTCCATTCAACA-T *
22926886-C-A 20765000-C-A YY*
10934875-T-A *
22926896-C-A 20765010-C-A YY*
10934873-C-A *
22935165-C-A 20773279-C-A YY*
23001254-C-A 20839368-C-A YY*
23009553-C-T 20847667-C-T Y*
10869981-CCATTCCATTCCATT-C *
10869978-AT-A *
11001947-C-A *
11018283-C-A *
23254559-C-A 21092673-C-A YY*
13384627-TTAGGAATGCTCA-T 11228951-TTAGGAATGCTCA-T *
20163418-AGCACTTAAGTTTTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTGTGGCAGGTTCATGGTCTTGCTCACTTCAAGAATGAAGCTGCAGAATTTAGTGGTGAGCGTTAC- DYZ19 *
13463892-A-ATTGT 11308216-A-ATTGT *
13463750-C-G 11308074-C-G *
13463405-C-T 11307729-C-T *
21333958-C-A 19172072-C-A YY*
13459518-T-A 11303842-T-A *
22446597-C-T 20284711-C-T DYZ19 *
13451162-C-CCACTCCACTGCACTT 11295486-C-CCACTCCACTGCACTT *
13449372-C-CTCCACTTCACTCCATTCCAG 11293696-C-CTCCACTTCACTCCATTCCAG *
22447547-T-G 20285661-T-G DYZ19 *
11025495-G-A,A *
13299776-C-A 11144100-C-A *
22486125-T-A 20324239-T-A DYZ19 *
13290245-G-A 11134569-G-A *
22486146-C-G 20324260-C-G DYZ19 *
13289921-C-A 11134245-C-A *
13204430-T-A,A 11048754-T-A,A *
11025528-G-C,C *
11025525-A-C,C *
22486178-A-G 20324292-A-G DYZ19 *
23225288-C-A 21063402-C-A Y*
10841991-T-A *
20163416-AC- DYZ19 *
23597089-C-A 21435203-C-A YY*
9736799-G-T 9899190-G-T IR3_Prx *
23579005-G-T 21417119-G-T YY*
9574458-T-C 9736849-T-C IR3_Prx *
9574439-AT-A 9736830-AT-A IR3_Prx 8×T*
9524451-A-G 9686842-A-G *
9500840-G-T 9663231-G-T *
9481254-A-G 9643645-A-G *
9477237-C-A 9639628-C-A *
9469458-G-T 9631849-G-T *
9797079-C-A 9959470-C-A Y*
23598900-C-A 21437014-C-A YY*
9453344-C-A 9615735-C-A YY*
23650948-C-T 21489062-C-T Y*
9022184-G-T 9184575-G-T Y*
21212025-A-G 19050139-A-G YY*
23742023-G-T 21580137-G-T *
8981204-A-G 9143595-A-G Y*
23755709-C-A 21593823-C-A Y*
8898940-C-A 9030899-C-A BY5605 Y*
9770883-C-A 9933274-C-A Y*
23575600-G-GT 21413714-G-GT *
10808997-C-A *
23468435-A-G 21306549-A-G YY*
10804773-T-C *
23364456-A-G 21202570-A-G YY*
23378952-C-A 21217066-C-A YY*
23398050-C-A 21236164-C-A YY*
23412260-C-A 21250374-C-A YY*
23416502-G-A 21254616-G-A YY*
23433458-C-A 21271572-C-A YY*
23436780-C-A 21274894-C-A YY*
10035923-C-A 10198314-C-A *
9961545-G-T 10123936-G-T Y*
9812890-C-A 9975281-C-A YY*
9961525-G-T 10123916-G-T Y*
9961513-G-T 10123904-G-T Y*
9868419-TA-T 10030810-TA-T 10×A*
23471312-C-A 21309426-C-A YY*
9864391-C-A 10026782-C-A YY*
9855730-T-G,G 10018121-T-G,G *
9852463-G-T 10014854-G-T YY*
23491210-G-A 21329324-G-A YY*
9829140-T-C 9991531-T-C YY*
13463894-G-GTGTCCTCTCTTTCACGGGGCACACCTGGATGGCTATAGAGGGGCGTCGTTTCAGGGCAAT,T 11308218-G-GTGTCCTCTCTTTCACGGGGCACACCTGGATGGCTATAGAGGGGCGTCGTTTCAGGGCAAT,T *
13465086-A-T 11309410-A-T *
14653061-C-A 12541126-C-A YY*
14001032-T-C 11880326-T-C YY*
14149555-C-A 12028849-C-A YY*
14149551-C-A 12028845-C-A YY*
14109282-C-A 11988576-C-A YY*
14103316-C-A 11982610-C-A YY*
14091525-C-A 11970819-C-A YY*
14041758-G-A 11921052-G-A FT84904 YY*
14023249-CCCCAAAGAATGT-C 11902543-CCCCAAAGAATGT-C *
14006925-C-A 11886219-C-A Y*
13996126-C-A 11875420-C-A Y*
14286784-CTTTTTTT-C,CTTTTTT 12166078-CTTTTTTT-C,CTTTTTT 22×T*
22257900-A-C 20096014-A-C DYZ19 *
13946388-C-A 11825682-C-A YY*
13885862-T-C 11765156-T-C Y*
13870335-C-A 11749629-C-A *
22281982-C-G 20120096-C-G DYZ19 *
22281985-A-T 20120099-A-T DYZ19 *
13861653-G-T 11740947-G-T *
13860415-G-T 11739709-G-T *
13855539-T-C 11734833-T-C *
14215279-C-A 12094573-C-A YY*
14295118-T-G 12174412-T-G YY*
22281998-C-T 20120112-C-T DYZ19 *
14459175-T-C 12338448-T-C YY*
14604562-ATCTGCCCTTTAAAGTAATTGTTTTCTTCTTTTTTTT-A 12492764-ATCTGCCCTTTAAAGTAATTGTTTTCTTCTTTTTTTT-A *
14588772-T-C 12476972-T-C YY*
14571904-C-A 12460104-C-A YY*
22158918-C-A 19997032-C-A YY*
14548626-CAA-C 12436827-CAA-C 9×A*
14530288-C-A 12418489-C-A YY*
14522114-CCTGG-C 12410315-CCTGG-C *
14489887-C-A 12369156-C-A YY*
14467377-C-A 12346646-C-A YY*
14444685-C-A 12323958-C-A Y*
14317303-C-A 12196597-C-A YY*
14419141-C-A 12298416-C-A YY*
14406816-C-A 12286114-C-A YY*
14403785-G-T 12283082-G-T YY*
14396924-C-A 12276220-C-A YY*
14329633-C-A 12208927-C-A YY*
14328860-C-A 12208154-C-A YY*
22211135-C-A 20049249-C-A Y*
22228161-G-T 20066275-G-T DYZ19 *
22250580-G-C 20088694-G-C DYZ19 *
13836898-G-T 11716192-G-T *
13823244-G-T 11702538-G-T *
13466117-T-TA 11310441-T-TA *
13473940-G-T 11318264-G-T *
13480391-ACC-A 11324715-ACC-A *
13480390-T-TGG 11324714-T-TGG *
13480382-A-C 11324706-A-C *
13477717-G-T 11322041-G-T *
13477708-C-T 11322032-C-T *
13477684-G-A 11322008-G-A *
13474756-G-T 11319080-G-T *
13473974-ACCAGTG-A 11318298-ACCAGTG-A *
13472531-A-G 11316855-A-G *
13480402-GT-G 11324726-GT-G *
13472201-ACC-A,GCC 11316525-ACC-A,GCC *
13470646-G-A 11314970-G-A *
13469096-C-T 11313420-C-T *
13467946-G-T,T 11312270-G-T,T *
13467916-G-A,A 11312240-G-A,A *
22288366-T-A 20126480-T-A DYZ19 *
13467903-G-A,A 11312227-G-A,A *
13467889-G-A 11312213-G-A *
22318050-A-C 20156164-A-C DYZ19 *
13480400-G-C 11324724-G-C *
13485431-A-T 11329755-A-T *
11652857-A-G *
13644708-T-C 11489032-T-C *
13745528-T-C 11589852-T-C *
13728518-T-A 11572842-T-A *
13726359-G-GGAA 11570683-G-GGAA *
13726354-C-CGAATG 11570678-C-CGAATG *
11566629-A- *
11566626-T- *
13718191-G-T 11562515-G-T *
13712862-T-C 11557186-T-C *
13708595-C-A 11552919-C-A *
13642667-T-C 11486991-T-C *
13486007-G-T 11330331-G-T *
13642662-G-A 11486986-G-A *
13567326-C-A 11411650-C-A *
13551102-C-A 11395426-C-A *
13496098-T-C 11340422-T-C *
13489843-C-T 11334167-C-T *
13489525-C-A 11333849-C-A *
13489402-T-A 11333726-T-A *
13487462-T-C,C 11331786-T-C,C *
13487445-G-C,C 11331769-G-C,C *
13463399-C-T 11307723-C-T BY210276 *
10013279-C-T 10175670-C-T Y*
21545659-C-A 19383773-C-A YY*
22475053-T-G 20313167-T-G Z23635 DYZ19 *
22227281-C-A 20065395-C-A DYZ19 *
58905385-G-A 56685486-C-T *
58980580-C-A 56834433-C-A *
28813845-A-T 26667698-A-T *
28793857-T-A 26647710-T-A *
28786688-G-C 26640541-G-C *
28657166-TAC-T 26511019-TAC-T *
23962047-TTA-T 21815900-TTA-T *
23504214-C-A 21342328-C-A Z7371 YY*
21407303-C-T 19245417-C-T YY*
17412493-C-CT 15300613-C-CT 11×T*
19218453-C-A 17106573-C-A Z13801 YY*
18944331-GGT-G 16832451-GGT-G *
17715105-C-A 15603225-C-A CTS7867 YY*
15787059-C-T 13675179-C-T CTS4730 YY*
14004508-GCA-G 11883802-GCA-G 9×CA*
13720737-T-A 11565061-T-A *
13711674-G-C 11555998-G-C *
13705746-G-A 11550070-G-A *
13705734-T-C 11550058-T-C *
13692717-C-T 11537041-C-T FT87462 *
13479018-G-A 11323342-G-A *
8974932-G-GA 9137323-G-GA 12×A*
13502167-C-T 11346491-C-T *
13463922-C-A 11308246-C-A *
13489203-C-G 11333527-C-G *
13465573-A-C 11309897-A-C *
13298598-T-C 11142922-T-C *
13462158-C-T 11306482-C-T *
13463407-C-T 11307731-C-T *
58976094-C-G 56829947-C-G *
7666178-A-AAT 7798137-A-AAT 10×AT*
8182205-CAAAAA-C 8314164-CAAAAA-C 18×A*
14469656-G-GT 12348925-G-GT 10×T*
28791576-CAAAGGAGACA-C 26645429-CAAAGGAGACA-C *
13489483-C-T 11333807-C-T *
13463415-C-A 11307739-C-A *
13866569-G-A 11745863-G-A *
13467875-C-T 11312199-C-T *
13692919-GTAAAGGAATAGAATC-G 11537243-GTAAAGGAATAGAATC-G *
23996211-C-CT 21850064-C-CT 10×T*
22422578-CT-C 20260692-CT-C DYZ19 *
17141709-CAAAA-C 15029829-CAAAA-C 21×A*
21084337-A-G 18922451-A-G BY55215 YY*
58883872-C-CCATTG 56706994-G-GAATGC *
22747717-C-CT 20585831-C-CT 14×T*
13489374-C-T 11333698-C-T *
13692030-T-C 11536354-T-C *
13483722-C-A 11328046-C-A *
13489621-C-CTA 11333945-C-CTA *
17913411-C-G 15801531-C-G YY*
13471963-C-G 11316287-C-G *
15994034-CT-C 13882154-CT-C 10×T*
22479623-G-A 20317737-G-A BY25221 DYZ19 *
22479600-A-G 20317714-A-G BY25219 DYZ19 *
22479595-G-T 20317709-G-T BY25218 DYZ19 *
22479589-C-G 20317703-C-G Z25184 DYZ19 *
22479601-A-G 20317715-A-G BY25220 DYZ19 *
18944408-C-CA 16832528-C-CA 10×A*
18703927-GGA-G 16592047-GGA-G 9×GA*
17913413-T-A 15801533-T-A YY*
13642644-T-C 11486968-T-C *
58987950-C-A 56841803-C-A *
13642643-A-C 11486967-A-C *
13642630-G-A 11486954-G-A *
13450880-C-CCACTCCACTCCTCTCCCCAA 11295204-C-CCACTCCACTCCTCTCCCCAA *
13449337-T-TTCCAA 11293661-T-TTCCAA *
13314327-G-A 11158651-G-A *
9368301-CTG-C 9530692-CTG-C 9×TG*
22237029-C-G 20075143-C-G DYZ19 *
58983177-C-T 56837030-C-T *
7608540-T-TA 7740499-T-TA 17×A*
9992193-A-G 10154584-A-G FT165082 Y*
22364710-C-G 20202824-C-G DYZ19 *
24115164-CCACA-C 21969017-CCACA-C P3_b1 23×CA*
13471836-G-C 11316160-G-C *
13332029-G-T 11176353-G-T *
13466813-C-T 11311137-C-T *
13466806-A-G 11311130-A-G *
13449355-C-T 11293679-C-T *
13449001-A-T 11293325-A-T *
9994793-G-A 10157184-G-A Y*
9994781-T-C 10157172-T-C Y*
9941204-C-A 10103595-C-A Y*
8513634-TTG-T 8645593-TTG-T *
23498316-C-CT 21336430-C-CT 10×T*
58983741-T-C 56837594-T-C *
22475023-C-A 20313137-C-A DYZ19 *
18343673-TA-T 16231793-TA-T P6_Prx 13×A*
22475014-T-G 20313128-T-G DYZ19 *
13473949-A-G 11318273-A-G *
13470752-G-C 11315076-G-C *
13470717-A-T 11315041-A-T F18176 *
58988625-AG-A 56842478-AG-A *
58988606-T-C 56842459-T-C *
13482511-A-T 11326835-A-T *
13476700-G-A 11321024-G-A *
27914925-T-A 25768778-T-A P1_Y2 18×A*
13462756-G-T 11307080-G-T *
13476477-G-A 11320801-G-A *
14342065-TA-T 12221360-TA-T 10×A*
13470735-G-A 11315059-G-A *
22447497-C-G 20285611-C-G DYZ19 *
13314328-T-C 11158652-T-C *
22253232-G-T 20091346-G-T BY214121 DYZ19 *
13477719-G-C 11322043-G-C *
13469347-T-A 11313671-T-A *
58983668-G-T 56837521-G-T *
9964625-A-G 10127016-A-G Y*
17459485-CAAAA-C 15347605-CAAAA-C 25×A*
13483721-C-T 11328045-C-T *
58978014-C-G 56831867-C-G *
10025454-A-C 10187845-A-C Y*
13462142-C-G 11306466-C-G *
15196730-CTT-C 13084816-CTT-C 16×T*
7196046-CTT-C 7328005-CTT-C 16×T*
8221228-CTTT-C,CTT 8353187-CTTT-C,CTT 16×T*
13465143-G-T 11309467-G-T *
13463856-T-C 11308180-T-C *
13489992-T-A 11334316-T-A *
13708679-G-T 11553003-G-T *
14517398-AAT-A 12405599-AAT-A *
9936420-T-G 10098811-T-G Y*
13461082-A-T 11305406-A-T *
13461823-T-C 11306147-T-C *
23761776-CCACA-C 21599890-CCACA-C 12×CA*
13466461-A-T 11310785-A-T *
58862667-T-C 56728204-A-G *
22007266-T-G 19845380-T-G YY*
22229201-A-G 20067315-A-G BY23228 DYZ19 *
22229191-T-C 20067305-T-C BY23225 DYZ19 *
17913389-A-G 15801509-A-G CTS8278 YY*
15208845-CAAAA-C 13096931-CAAAA-C 23×A*
14967881-T-TA 12855956-T-TA 10×A*
28795249-T-A 26649102-T-A *
13450161-C-T 11294485-C-T *
9645653-CTTTT-C 9808044-CTTTT-C IR3_Prx 20×T*
13706076-ATGGAATGGTATGGCG-A 11550400-ATGGAATGGTATGGCG-A *
58833940-G-C 56756931-C-G *
18940147-G-GA 16828267-G-GA 11×A*
22279250-T-G 20117364-T-G BY22448 DYZ19 *
13470741-A-G 11315065-A-G *
13480377-C-A 11324701-C-A A17123 *
13461048-T-C 11305372-T-C *
13461034-A-T 11305358-A-T *
16019397-G-GA 13907517-G-GA 10×A*
13474197-T-G 11318521-T-G *
13825488-G-GA 11704782-G-GA *
13465099-C-T 11309423-C-T BY85719 *
13488678-G-A 11333002-G-A *
22483940-A-G 20322054-A-G DYZ19 *
58863010-T-C 56727861-A-G *
9880174-G-GT 10042565-G-GT 9×T*
58863112-C-G 56727759-G-C *
13730144-G-T 11574468-G-T *
58981725-G-T 56835578-G-T *
15545218-C-A 13433338-C-A BY11194 YY*
23098816-C-CA 20936930-C-CA 25×A*
58848204-C-CCATTG 56742657-G-GAATGC *
22660111-A-AT 20498225-A-AT 10×T*
23437955-ATGTG-A 21276069-ATGTG-A 14×TG*
13472230-C-A 11316554-C-A *
13468285-T-G 11312609-T-G *
13463417-C-T 11307741-C-T *
18398192-C-CATAT 16286312-C-CATAT P6_Gap 15×AT*
17050366-A-AT 14938486-A-AT 9×T*
28817647-AGGAATGGAATGGAATGGAATGGAAT-A,AGGAATGGAATGGAATGGAAT 26671500-AGGAATGGAATGGAATGGAATGGAAT-A,AGGAATGGAATGGAATGGAAT 9×GGAAT*
16242632-T-TTCTA,TTCTATCTA 14130752-T-TTCTA,TTCTATCTA 10×TCTA*
13479083-C-T 11323407-C-T *
13470719-C-A 11315043-C-A *
8048556-C-CAG 8180515-C-CAG 13×AG*
6662086-AT-A 6794045-AT-A 11×T*
15018145-AT-A 12906234-AT-A 10×T*
23255668-C-CA 21093782-C-CA 10×A*
28819092-C-A 26672945-C-A *
58976090-C-A 56829943-C-A *
8468065-C-CA 8600024-C-CA 24×A*
13471803-GC-G 11316127-GC-G *
13472200-G-T 11316524-G-T *
13463930-G-T 11308254-G-T *
13485545-A-G 11329869-A-G *
7411637-GTATA-G 7543596-GTATA-G 9×TA*
7456234-T-TA 7588193-T-TA IR1_L 10×A*
6734680-C-CTT 6866639-C-CTT 21×T*
58981827-A-ATCCAT 56835680-A-ATCCAT *
15428680-G-GA 13316800-G-GA 9×A*
22430287-C-T 20268401-C-T DYZ19 *
13473802-G-T 11318126-G-T F10799 *
13473956-T-C 11318280-T-C *
13473970-G-T 11318294-G-T *
58863083-A-C 56727788-T-G *
23535390-C-CT 21373504-C-CT 9×T*
22487889-G-A 20326003-G-A DYZ19 *
22487884-T-G 20325998-T-G DYZ19 *
22485576-C-G 20323690-C-G DYZ19 *
22508740-T-A 20346854-T-A DYZ19 *
15925985-ATATT-A 13814105-ATATT-A 7×TATT*
16612805-ATT-A 14500925-ATT-A 16×T*
13490013-G-C 11334337-G-C *
13689451-G-C 11533775-G-C *
13472214-C-A 11316538-C-A *
21604340-G-GA 19442454-G-GA 9×A*
9340341-GT-G 9502732-GT-G 9×T*
13489675-G-C 11333999-G-C *
13474479-C-T 11318803-C-T *
18019516-G-GTA 15907636-G-GTA 8×TA*
13465552-A-T 11309876-A-T *
6595244-T-A 6727203-T-A FGC40806 15×CA*
22241210-A-C 20079324-A-C DYZ19 *
13473863-C-A 11318187-C-A *
13473848-G-T 11318172-G-T *
13868784-TA-T 11748078-TA-T *
13463887-G-A 11308211-G-A Z25947 *
13472445-C-T 11316769-C-T *
19167003-GA-G 17055123-GA-G 11×A*
13869204-G-A 11748498-G-A *
13470773-G-A 11315097-G-A *
13748396-C-G 11592720-C-G *
13474732-C-T 11319056-C-T *
9944126-A-G 10106517-A-G Y*
13473842-T-C 11318166-T-C *
13466930-G-C 11311254-G-C *
58983114-ACATT-A 56836967-ACATT-A *
58983120-C-A 56836973-C-A *
13805183-A-T 11684477-A-T *
13472262-G-A 11316586-G-A *
13463893-G-A 11308217-G-A *
13470772-T-C 11315096-T-C *
13729081-C-A 11573405-C-A *
13805191-G-T 11684485-G-T *
58977370-G-C 56831223-G-C *
13463884-G-T 11308208-G-T *
13463883-G-T 11308207-G-T *
22241213-G-C 20079327-G-C DYZ19 *
21463581-G-GT 19301695-G-GT 9×T*
13921774-G-A 11801068-G-A BY91916 YY*
13488132-G-A 11332456-G-A *
13488109-C-A 11332433-C-A *
13488084-G-A 11332408-G-A *
13483704-G-A 11328028-G-A *
58977403-C-T 56831256-C-T *
7767824-T-TA 7899783-T-TA 13×A*
13502073-T-C 11346397-T-C *
24210652-T-A 22064505-T-A P3_b1 *
13311937-G-T 11156261-G-T *
13712661-A-T 11556985-A-T *
13470748-C-A 11315072-C-A *
13472278-C-T 11316602-C-T FT444084 *
13472273-T-A 11316597-T-A *
7387944-GA-G 7519903-GA-G 11×A*
13748414-T-A 11592738-T-A *
22505761-G-A 20343875-G-A DYZ19 *
22506149-G-A,C 20344263-G-A,C DYZ19 *
13805197-T-A 11684491-T-A *
13466927-GAA-G 11311251-GAA-G *
58883625-C-T 56707246-G-A *
13448640-ATTCCATTCCAT-A 11292964-ATTCCATTCCAT-A *
13461985-T-A 11306309-T-A *
28817561-T-G 26671414-T-G *
22508716-TG-T 20346830-TG-T DYZ19 *
22473981-A-T 20312095-A-T BY187 SUR35 DYZ19 *
22473978-A-T 20312092-A-T BY186 SUR34 DYZ19 *
22253215-G-T 20091329-G-T DYZ19 *
13714335-T-G 11558659-T-G *
13484381-T-G 11328705-T-G *
13473126-C-A 11317450-C-A *
13449362-T-TTCCACTCCAC 11293686-T-TTCCACTCCAC *
28799818-C-G 26653671-C-G *
22279457-T-C 20117571-T-C DYZ19 *
28799814-C-A 26653667-C-A *
22230252-C-A 20068366-C-A BY213410 DYZ19 *
13805207-T-G 11684501-T-G *
13805204-C-A 11684498-C-A *
13805198-T-A 11684492-T-A *
13805186-T-C 11684480-T-C *
13805185-C-T 11684479-C-T *
13745475-G-T 11589799-G-T *
13478438-A-G 11322762-A-G *
13472732-C-A 11317056-C-A *
13473148-A-T 11317472-A-T *
22279461-G-A 20117575-G-A DYZ19 *
19135814-CTG-C 17023934-CTG-C *
13805194-T-A 11684488-T-A *
28799822-G-A 26653675-G-A *
13470730-A-G 11315054-A-G *
13466904-G-T 11311228-G-T *
22473949-G-T 20312063-G-T BY185 SUR33 DYZ19 *
17007092-CTA-C 14895212-CTA-C *
22439458-A-T 20277572-A-T DYZ19 *
13476904-G-A 11321228-G-A *
17951466-T-A 15839586-T-A BY191275 YY13×CA*
13868787-A-AT 11748081-A-AT *
13823239-G-A 11702533-G-A *
13490054-C-A 11334378-C-A *
13466924-A-T 11311248-A-T *
13473891-T-A 11318215-T-A *
13473839-C-G 11318163-C-G *
13600520-TGGA-T 11444844-TGGA-T *
13600510-AATG-A 11444834-AATG-A *
9177967-A-T 9340358-A-T Y*
22238494-G-T 20076608-G-T FGC9315 DYZ19 *
22228164-C-A 20066278-C-A DYZ19 *
13639670-C-T 11483994-C-T *
13868795-G-C 11748089-G-C *
13488044-C-T 11332368-C-T *
14007942-CAA-C 11887236-CAA-C 15×A*
22509206-A-C 20347320-A-C FGC78969 DYZ19 *
13698960-C-G 11543284-C-G *
22479637-C-T 20317751-C-T BY25222 DYZ19 *
13462138-T-C 11306462-T-C *
13474502-A-G 11318826-A-G *
8716918-AT-A 8848877-AT-A 10×T*
9936398-T-C 10098789-T-C Y*
28819016-G-A 26672869-G-A *
17029465-GAA-G 14917585-GAA-G 15×A*
14398919-CAA-C 12278215-CAA-C 15×A*
10016584-GC-G 10178975-GC-G *
7058019-CT-C 7189978-CT-C 11×T*
21084312-CATAT-C 18922426-CATAT-C 11×AT*
20458988-A-G 18297102-A-G P5_Dst *
13688911-G-A 11533235-G-A *
13462141-C-T 11306465-C-T *
22475607-C-T 20313721-C-T DYZ19 *
17322828-AAG-A 15210948-AAG-A *
22440118-C-A 20278232-C-A FGC78051 DYZ19 *
13465162-G-A 11309486-G-A *
13465161-T-C 11309485-T-C *
15977589-C-CT 13865709-C-CT 11×T*
28814917-T-C 26668770-T-C *
18889266-C-CT 16777386-C-CT 11×T*
13311885-G-A 11156209-G-A BY85096 *
14968772-TAA-T 12856847-TAA-T 12×A*
10016611-T-G 10179002-T-G Y*
22237155-T-A 20075269-T-A DYZ19 *
10017070-T-TCA 10179461-T-TCA 16×CA*
13472526-G-A 11316850-G-A *
22238405-C-T 20076519-C-T DYZ19 *
13472461-C-A 11316785-C-A *
21844894-T-TA 19683008-T-TA 9×A*
22473330-A-G 20311444-A-G DYZ19 *
21362531-T-TA 19200645-T-TA 10×A*
8470549-CAAAAAAAA-C 8602508-CAAAAAAAA-C 22×A*
3332266-A-G 3464225-A-G *
22509487-T-G 20347601-T-G DYZ19 *
22949695-C-CT 20787809-C-CT 10×T*
13136029-G-A 10625515-G-A *
9146901-G-A 9309292-G-A BY19228A6294 Y*
28794511-G-A 26648364-G-A *
13489705-A-T 11334029-A-T *
6866632-T-TA 6998591-T-TA 13×A*
13467859-G-A 11312183-G-A *
13472470-C-G 11316794-C-G *
13448619-C-T 11292943-C-T *
58985041-A-T 56838894-A-T *
58862991-T-C 56727880-A-G *
28799803-GAGTGC-G 26653656-GAGTGC-G *
13136022-C-A 10625508-C-A *
22473325-A-C 20311439-A-C DYZ19 *
13257877-G-A 11102201-G-A *
8346704-CT-C 8478663-CT-C 11×T*
20950550-C-CA 18788664-C-CA P4_Dst 13×A*
13720858-G-T 11565182-G-T *
13688755-T-G 11533079-T-G *
22475593-T-G 20313707-T-G BY49541 DYZ19 *
13711964-G-A 11556288-G-A *
13711825-A-T 11556149-A-T *
25980464-G-GA 23834317-G-GA P1_Y1 11×A*
16076178-TA-T 13964298-TA-T 11×A*
10016576-G-A 10178967-G-A Y*
25080655-CA-C 22934508-CA-C g1 13×A*
15526882-C-CT 13415002-C-CT 11×T*
13462075-T-G 11306399-T-G *
13600558-C-T 11444882-C-T *
9300202-A-G 9462593-A-G Y*
10016600-C-G 10178991-C-G Y*
22506170-A-C 20344284-A-C DYZ19 *
13461038-C-T 11305362-C-T *
16494396-TAG-T 14382516-TAG-T 10×AG*
22430289-A-T 20268403-A-T DYZ19 *
13465566-G-A 11309890-G-A *
22284169-T-C 20122283-T-C DYZ19 *
13489987-A-G 11334311-A-G *
6286901-CA-C 6418860-CA-C IR3_Dst 10×A*
14945826-G-GT 12833900-G-GT 10×T*
22445996-A-G 20284110-A-G YFS033271 DYZ19 *
13550860-C-T 11395184-C-T *
28803430-G-A 26657283-G-A *
22362305-C-G 20200419-C-G BY25525 DYZ19 *
58981805-A-AATTCC 56835658-A-AATTCC *
19048392-TAG-T 16936512-TAG-T 9×AG*
22475594-T-A 20313708-T-A DYZ19 *
22460304-G-T 20298418-G-T DYZ19 *
22460287-G-A 20298401-G-A DYZ19 *
7542819-G-GA 7674778-G-GA 10×A*
28803440-T-G 26657293-T-G *
13688181-A-AGAATGGAATGGAATGGAATG 11532505-A-AGAATGGAATGGAATGGAATG 8×GAATG*
13715045-T-A 11559369-T-A *
7104436-TTC-T 7236395-TTC-T 9×TC*
13465248-C-A 11309572-C-A *
13465235-A-G 11309559-A-G *
13465184-C-T 11309508-C-T *
13476925-T-A 11321249-T-A *
22229194-A-G 20067308-A-G BY23227 DYZ19 *
22229193-T-A 20067307-T-A BY23226 DYZ19 *
22229188-A-C 20067302-A-C BY23224 DYZ19 *
13470018-C-T 11314342-C-T *
22289232-T-A 20127346-T-A DYZ19 *
22475030-G-T 20313144-G-T BY223268 DYZ19 *
7977228-GA-G 8109187-GA-G 10×A*
56841819-T-A *
17799039-C-A 15687159-C-A YY*
22229215-T-A 20067329-T-A DYZ19 *
18793416-G-T 16681536-G-T YY*
6878938-C-A 7010897-C-A YY*
22871016-GT-G 20709130-GT-G 9×T*
10750728-G-T *
7020319-C-A 7152278-C-A Y*
13643373-C-A 11487697-C-A *
21194370-C-A 19032484-C-A YY*
14547295-C-A 12435496-C-A YY*
22430296-C-A 20268410-C-A FGC27660 DYZ19 *
17013364-C-A 14901484-C-A FT305232 YY*
8709760-C-A 8841719-C-A YY*
15734009-C-A 13622129-C-A Y*
13996095-C-A 11875389-C-A Y*
23007471-G-T 20845585-G-T Y*
13478264-A-G 11322588-A-G *
10687237-C-A *
13728528-C-A 11572852-C-A *
16340823-C-A 14228943-C-A YY*
10912465-C-A *
17545602-G-T 15433722-G-T Y*
17051369-C-A 14939489-C-A YY*
13464392-A-C 11308716-A-C *
21329488-C-A 19167602-C-A YY*
13450107-CACTCCACCCCATCCCATCCCATTCT-C 11294431-CACTCCACCCCATCCCATCCCATTCT-C *
13480386-G-T 11324710-G-T *
13637699-C-A 11482023-C-A *
14590067-G-T 12478267-G-T YY*
16275907-G-T 14164027-G-T YY*
13474760-G-A 11319084-G-A *
22037552-C-A 19875666-C-A YY*
14320626-C-A 12199920-C-A YY*
10912479-G-C *
10912478-G-C *
15882429-GTT-G 13770549-GTT-G 13×T*
28818912-G-T 26672765-G-T *
21344907-C-A 19183021-C-A YY*
23367148-C-A 21205262-C-A YY*
3122768-C-A 3254727-C-A *
16763696-C-A 14651816-C-A YY*
14283217-C-A 12162511-C-A YY*
13989475-T-G 11868769-T-G YY*
8535204-GT-G,GTT 8667163-GT-G,GTT 19×T*
8078675-G-T 8210634-G-T Y*
23294070-C-A 21132184-C-A YY*
13472213-C-CTCTT 11316537-C-CTCTT *
21138571-C-A 18976685-C-A FT181940 YY*
15635763-C-A 13523883-C-A YY*
13473950-G-T 11318274-G-T *
13718084-G-A 11562408-G-A *
19663277-G-T 17551397-G-T P5_Prx *
19039047-C-A 16927167-C-A FTA1054 YY*
10912471-A-T *
7284415-C-A 7416374-C-A YY*
14916927-C-A 12804994-C-A YY*
7008355-C-A 7140314-C-A Y*
10912448-G-T *
13489930-T-C 11334254-T-C *
13489925-C-A 11334249-C-A *
15178203-C-A 13066289-C-A Y*
14239052-G-GTA 12118346-G-GTA *
21262356-C-A 19100470-C-A YY*
13597537-C-A 11441861-C-A *
13489479-G-A 11333803-G-A *
18978744-C-A 16866864-C-A YY*
13846630-C-A 11725924-C-A *
3093650-C-A 3225609-C-A *
10778325-T-A *
7646978-C-A 7778937-C-A YY*
9877077-C-CT 10039468-C-CT 8×T*
13700689-G-T 11545013-G-T *
56839393-C-G *
24413864-TTCTC-T 22267717-TTCTC-T 9×TC*
21972408-C-A 19810522-C-A YY*
22940686-G-GT 20778800-G-GT 10×T*
21873566-C-CAA 19711680-C-CAA 14×A*
19513578-AT-A,ATT 17401698-AT-A,ATT 20×T*
56829520-C-CATTCCATTCCAGTCT *
16680621-C-A 14568741-C-A YY*
10785317-C-A *
13462149-C-A 11306473-C-A *
13691686-T-C 11536010-T-C FT448705 *
13474449-G-T 11318773-G-T *
13466524-G-T 11310848-G-T *
17713847-C-A 15601967-C-A YY*
13715022-G-C 11559346-G-C *
13710343-G-A 11554667-G-A *
18793565-G-T 16681685-G-T YY*
22508710-A-T 20346824-A-T DYZ19 *
10889316-T-G *
13723042-G-A 11567366-G-A *
7508008-C-CA 7639967-C-CA 10×A*
56826967-G-T *
13466321-G-C 11310645-G-C *
13464484-C-T 11308808-C-T *
15507783-GTT-G,GT 13395903-GTT-G,GT 25×T*
14431935-C-A 12311208-C-A Y*
14611448-C-A 12499654-C-A YY*
18019066-C-A 15907186-C-A Y*
18241741-C-A 16129861-C-A Y*
14897845-GT-G 12785911-GT-G 10×T*
22509944-T-G 20348058-T-G DYZ19 *
6997225-A-AT 7129184-A-AT 11×T*
10987824-C-T *
4374490-C-A 4506449-C-A *
4862545-C-A 4994504-C-A *
3721218-C-A 3853177-C-A *
13404490-C-A 11248814-C-A *
23742232-T-C 21580346-T-C *
13470539-C-T 11314863-C-T *
17278583-C-A 15166703-C-A YY*
15584874-C-A 13472994-C-A YY*
8819118-G-T 8951077-G-T YY*
22207435-C-A 20045549-C-A YY*
56763589-T-C *
13468347-C-T 11312671-C-T *
15289419-C-A 13177518-C-A Y*
56836310-T-TTCCAG *
13449042-GCA-G 11293366-GCA-G *
13461754-T-A 11306078-T-A *
6580193-C-A 6712152-C-A *
22485573-A-T 20323687-A-T DYZ19 *
17332750-C-CA,CAA 15220870-C-CA,CAA 22×A*
13478364-G-C 11322688-G-C *
17579977-C-A 15468097-C-A YY*
10861454-T-G *
3500844-C-CT 3632803-C-CT 9×T*
16656270-C-A 14544390-C-A YY*
15338678-C-A 13226796-C-A YY*
28492191-C-CAA 26346044-C-CAA 10×A*
21545023-C-A 19383137-C-A Y*
6930359-C-A 7062318-C-A Y*
23043438-C-A 20881552-C-A YY*
10846898-C-T *
13470600-G-T 11314924-G-T *
16888749-C-A 14776869-C-A YY*
23447268-C-A 21285382-C-A Y*
10025437-C-A 10187828-C-A Y*
14449429-C-A 12328702-C-A YY*
13480366-T-A 11324690-T-A *
13462160-G-T 11306484-G-T *
22317915-G-C 20156029-G-C DYZ19 *
18593227-C-A 16481347-C-A YY*
7314707-C-A 7446666-C-A YY*
22486114-C-A 20324228-C-A DYZ19 *
23495669-G-A 21333783-G-A BY23450 YY*
19218428-C-A 17106548-C-A YY*
13464406-C-A 11308730-C-A *
16921129-C-A 14809249-C-A YY*
5125952-C-A 5257911-C-A *
13465553-G-T 11309877-G-T *
13472683-C-T 11317007-C-T *
15123837-C-A 13011924-C-A YY*
28812653-G-T 26666506-G-T BY155831 *
15927177-C-A 13815297-C-A YY*
56839380-A-T *
22035969-T-TA 19874083-T-TA 8×A*
56831251-G-T *
23603441-G-GTT 21441555-G-GTT 10×T*
13461749-G-T 11306073-G-T *
3622079-C-A 3754038-C-A *
13477682-T-C 11322006-T-C *
21766728-G-GAA 19604842-G-GAA 9×A*
16029056-C-A 13917176-C-A Y*
18686928-A-AT 16575048-A-AT 10×T*
9482683-TAA-T 9645074-TAA-T 10×A*
7289752-AAGAG-A 7421711-AAGAG-A 10×AG*
22137850-C-A 19975964-C-A YY*
2695789-C-A 2827748-C-A YY*
13465564-T-A 11309888-T-A *
22236202-G-A 20074316-G-A DYZ19 *
21235227-CAA-C,CA 19073341-CAA-C,CA 19×A*
15740712-C-A 13628832-C-A Y*
13463736-T-G 11308060-T-G *
13464462-C-G 11308786-C-G *
24413442-G-T 22267295-G-T Y*
13489788-C-T 11334112-C-T *
10973613-ATTCCG-A *
8030164-C-A 8162123-C-A YY*
13470574-A-T 11314898-A-T *
9907406-G-T 10069797-G-T Y*
9640889-TTGTG-T,TTG 9803280-TTGTG-T,TTG IR3_Prx 22×TG*
16571684-C-A 14459804-C-A YY*
18511626-G-T 16399746-G-T P6_Dst *
13194800-C-A 11039124-C-A *
23306709-C-A 21144823-C-A YY*
23597971-C-A 21436085-C-A YY*
19225555-G-GA 17113675-G-GA 8×A*
21292869-C-A 19130983-C-A YY*
21437436-C-A 19275550-C-A YY*
10023988-C-A 10186379-C-A Y*
17853126-C-A 15741246-C-A YY*
17329038-C-A 15217158-C-A YY*
28819071-T-A 26672924-T-A *
8300622-GA-G 8432581-GA-G 10×A*
17028699-C-A 14916819-C-A YY*
15272707-C-A 13160796-C-A YY*
14149543-C-A 12028837-C-A YY*
15818395-C-A 13706515-C-A YY*
10934871-T-G *
22485585-C-G 20323699-C-G DYZ19 *
10769282-C-A *
3272687-T-C 3404646-T-C *
18609408-C-A 16497528-C-A YY*
13212647-C-A 11056971-C-A *
14548840-TA-T 12437041-TA-T 9×A*
10759829-C-A *
13449529-TTCCAC-T 11293853-TTCCAC-T *
6672294-C-A 6804253-C-A YY*
9483442-G-T 9645833-G-T *
23981833-ATGTG-A 21835686-ATGTG-A 17×TG*
17944845-C-A 15832965-C-A YY*
11652859-A-G BY27137 *
9945989-C-A 10108380-C-A Y*
19172799-GTT-G 17060919-GTT-G 17×T*
56839456-T-C *
10986403-C-G *
13466369-C-G 11310693-C-G *
10986379-C-T *
19528959-C-A 17417079-C-A YY*
13489501-C-A 11333825-C-A *
4929048-CA-C 5061007-CA-C 8×A*
13456660-T-A 11300984-T-A *
18471858-TACAC-T 16359978-TACAC-T P6_Dst 12×AC*
14607680-G-T 12495882-G-T Y*
13462115-C-G 11306439-C-G *
13487789-C-T 11332113-C-T *
21373615-C-A 19211729-C-A YY*
13466327-A-G 11310651-A-G *
6910435-CT-C,CTT 7042394-CT-C,CTT 16×T*
13468339-C-A 11312663-C-A *
19104509-G-T 16992629-G-T YY*
13484426-A-G 11328750-A-G *
24523629-C-A 22377482-C-A *
13471978-G-C 11316302-G-C *
6144430-C-CA 6276389-C-CA IR3_Dst 13×A*
5999694-C-A 6131653-C-A *
10846915-T-C *
10846894-T-A *
28492334-C-A 26346187-C-A *
10993031-A-C FGC81358 *
7455761-G-GA 7587720-G-GA IR1_L 10×A*
22010462-CA-C,CAA 19848576-CA-C,CAA 16×A*
14847004-CAA-C,CA 12735070-CAA-C,CA 20×A*
10861450-A-T *
13461746-G-T 11306070-G-T *
4113133-G-T 4245092-G-T *
24459328-G-T 22313181-G-T Y*
18973000-C-A 16861120-C-A YY*
7562276-A-C 7694235-A-C YY*
11001908-C-A *
11031615-C-G *
15725767-C-A 13613887-C-A YY*
21731218-C-A 19569332-C-A YY*
19088630-C-A 16976750-C-A YY*
9029736-CTTTT-C 9192127-CTTTT-C 16×T*
16003037-G-T 13891157-G-T Y*
13489803-C-T 11334127-C-T *
56834887-G-T *
14814998-CT-C 12703069-CT-C 10×T*
13466111-A-G 11310435-A-G *
23258373-C-CA 21096487-C-CA 9×A*
13196408-ACCATT-A 11040732-ACCATT-A 5×CCATT*
10909790-A-C *
8550844-TA-T,TAA 8682803-TA-T,TAA 17×A*
6672275-TA-T 6804234-TA-T 9×A*
22007267-T-G 19845381-T-G YY*
23350819-ATT-A 21188933-ATT-A 12×T*
10982260-T-C,G *
13489225-GA-G 11333549-GA-G *
13478285-G-A,T 11322609-G-A,T *
13473843-G-A 11318167-G-A BY210334 *
14771649-CTTTT-C 12659718-CTTTT-C 17×T*
56839388-C-G *
10677522-A-G *
15479942-CTTTTT-C 13368062-CTTTTT-C 21×T*
14071354-CTT-C 11950648-CTT-C 25×T*
17284532-CTTTTT-C 15172652-CTTTTT-C 21×T*
15927169-C-A 13815289-C-A YY*
13468242-A-G 11312566-A-G *
13489216-G-T 11333540-G-T *
13461066-G-T 11305390-G-T *
13483433-G-A 11327757-G-A *
25733034-G-GT 23586887-G-GT P1_b3 17×T*
7247686-T-TA 7379645-T-TA 11×A*
58883633-G-C 56707238-C-G *
16342093-CAA-C 14230213-CAA-C 13×A*
13472203-CAG-C 11316527-CAG-C *
21084333-A-G 18922447-A-G YY*
2759383-C-A 2891342-C-A YY*
16308486-CTT-C,CT 14196606-CTT-C,CT 25×T*
14789257-C-A 12677328-C-A YY*
16282398-CAAA-C 14170518-CAAA-C 24×A*
20640328-G-T 18478442-G-T P4_Prx *
13458734-T-G 11303058-T-G *
4687801-C-A 4819760-C-A *
10778309-T-C *
13466118-G-C 11310442-G-C *
6915796-ATTTT-A 7047755-ATTTT-A 22×T*
13722783-G-A 11567107-G-A *
13467847-G-T 11312171-G-T *
22829644-CAAA-C 20667758-CAAA-C 18×A*
19338659-CA-C 17226779-CA-C 10×A*
10986882-C-G *
14609587-G-A 12497789-G-A YY*
14609583-G-A 12497785-G-A YY*
13726217-A-G 11570541-A-G *
13471966-C-A 11316290-C-A *
17302239-TAA-T,TA 15190359-TAA-T,TA 22×A*
8293978-G-GAA 8425937-G-GAA 10×A*
19438645-C-A 17326765-C-A Y128283 YY*
20685197-T-TA 18523311-T-TA P4_Prx 14×A*
6652918-C-A 6784877-C-A YY*
10993015-A-G *
13477695-T-C 11322019-T-C *
25096627-C-A 22950480-C-A g1 *
10668343-T-TCAA *
13471945-G-A 11316269-G-A *
10993018-G-T *
13460473-T-A 11304797-T-A *
13468335-A-G 11312659-A-G *
7464181-C-CAA 7596140-C-CAA IR1_L 15×A*
13478366-G-A 11322690-G-A *
15721148-C-A 13609268-C-A YY*
19308322-TAA-T 17196442-TAA-T 12×A*
13489891-T-A 11334215-T-A *
6144737-GA-G,GAA 6276696-GA-G,GAA IR3_Dst 12×A*
19536278-G-T 17424398-G-T YY*
6989107-TAAAA-T 7121066-TAAAA-T 23×A*
14385238-C-A 12264534-C-A Y*
15669964-CA-C,CAA 13558084-CA-C,CAA 18×A*
21751527-C-A 19589641-C-A YY*
10846890-T-C *
13458729-T-A 11303053-T-A *
23381198-C-A 21219312-C-A YY*
7314796-AT-A 7446755-AT-A 9×T*
28621718-G-T 26475571-G-T Y*
13483349-A-C 11327673-A-C *
17278566-C-A 15166686-C-A YY*
14816851-C-A 12704922-C-A A12088 YY*
13468338-G-A 11312662-G-A *
10912420-A-G *
13468216-G-A 11312540-G-A *
13690308-T-C 11534632-T-C *
8663165-C-A 8795124-C-A YY*
9029878-G-T 9192269-G-T Y*
28818988-G-C 26672841-G-C *
17913368-T-C 15801488-T-C YY*
17913366-G-A 15801486-G-A FT405881 YY*
21703318-C-A 19541432-C-A YY*
13489828-C-A 11334152-C-A *
6757885-G-T 6889844-G-T YY*
28804018-G-A 26657871-G-A *
13465908-G-T 11310232-G-T *
13465903-G-T 11310227-G-T *
13489502-C-G 11333826-C-G *
5861276-C-A 5993235-C-A *
2762526-C-A 2894485-C-A YY*
13502311-C-A 11346635-C-A *
13471970-A-C 11316294-A-C *
21961897-C-A 19800011-C-A YY*
11033910-C-T *
26047480-C-A 23901333-C-A P1_Y1 *
15564296-C-A 13452416-C-A YY8×A*
11000434-A-G *
4804980-C-A 4936939-C-A *
21442971-C-A 19281085-C-A YY*
16060219-C-A 13948339-C-A Y*
16181484-C-A 14069604-C-A Y*
8139730-C-A 8271689-C-A YY*
13474767-C-T 11319091-C-T *
21532497-C-A 19370611-C-A YY*
7417477-TAAAA-T 7549436-TAAAA-T 14×A*
17386774-TAAA-T 15274894-TAAA-T 15×A*
15682461-C-A 13570581-C-A YY*
16948381-C-A 14836501-C-A YY*
13960989-A-AG 11840283-A-AG *
56835786-G-T *
23829594-G-T 21667708-G-T Y*
28791447-T-A 26645300-T-A *
18726667-C-A 16614787-C-A YY*
13485912-C-G 11330236-C-G *
21754383-G-T *
9504068-C-A 9666459-C-A *
11018260-C-T *
22652628-C-A 20490742-C-A YY*
19447694-GA-G 17335814-GA-G 10×A*
16931754-G-T 14819874-G-T Y*
8875170-C-CA 9007129-C-CA 9×A*
21889822-TA-T 19727936-TA-T 9×A*
19201409-G-A 17089529-G-A FT149744 YY*
13465935-G-C 11310259-G-C *
14730396-CAAAA-C 12618464-CAAAA-C 18×A*
13694752-A-AAATGG 11539076-A-AAATGG 5×AATGG*
23856895-G-GA 21695009-G-GA 10×A*
13465894-T-A 11310218-T-A *
22792913-C-A 20631027-C-A YY*
14609584-A-T 12497786-A-T YY*
10841986-T-C *
28631692-C-A 26485545-C-A Y*
10977093-C-T *
2790457-AT-A 2922416-AT-A 8×T*
56832956-T-TTACATTCCAC *
13489109-C-T 11333433-C-T *
15677521-AC-A 13565641-AC-A *
16506563-C-A 14394683-C-A YY*
11035264-C-A *
18233569-GA-G 16121689-GA-G 8×A*
13857514-C-A 11736808-C-A Y19160 FGC40426 *
23054530-C-A 20892644-C-A YY*

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: B30882895323271659547069663
Used in age calculations895323271659547069663
Counts of SNPs504442
Variant counts last updated 2022-07-13 03:00:42.



Big Tree Main Page