Tree Position

R-P312/S116 > L238/S182 > Z2245 > Z2247 > CTS11638 > 7823627-G-A

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRKane-Dante
60820188484168
30688-G-T +
9303945-A-AC 9466336-A-AC +
16270107-G-A 14158227-G-A YY+
16232660-A-T 14120780-A-T YY+
16132308-TGATAGATA-T 14020428-TGATAGATA-T 7×GATA+
15628839-G-GT 13516959-G-GT +
15209698-CAAAG-C 13097784-CAAAG-C +
15078225-C-A 12966315-C-A YY+
14919786-A-G 12807851-A-G YY+
12514112-TACCC-T +
12514116-C-CGTT +
16420609-C-G 14308729-C-G YY+
16601600-C-CAA 14489720-C-CAA 31×A+
14457711-G-A 12336984-G-A Y+
14228201-G-A 12107495-G-A YY+
22346828-C-T 20184942-C-T DYZ19 +
22367158-G-C 20205272-G-C DYZ19 +
56744450-TGGA-T +
56744446-GAA-G +
22480677-TGTTG-T 20318791-TGTTG-T DYZ19 +
16297344-T-G 14185464-T-G YY+
21940037-C-CATAT 19778151-C-CATAT 22×AT+
22435752-TAG-T 20273866-TAG-T DYZ19 +
17994878-A-C 15882998-A-C P7_Prx Y+
21551733-A-G 19389847-A-G Y+
21180653-A-G 19018767-A-G YY+
20838607-T-C 18676721-T-C P4_Gap +
3960344-G-GTA 4092303-G-GTA +
19355366-C-T 17243486-C-T Y+
18982547-C-CAAAAAAAAAAAAAAAAAAAA 16870667-C-CAAAAAAAAAAAAAAAAAAAA 39×A+
56737339-G-A +
18111455-G-A 15999575-G-A YY+
13589194-G-A 11433518-G-A Z10476 +
58846314-G-C 56744557-C-G +
17653450-G-T 15541570-G-T YY+
17621631-T-A 15509751-T-A Y+
17576194-T-C 15464314-T-C YY+
17449027-G-A 15337147-G-A YY+
17201611-C-A 15089731-C-A YY+
22367134-T-A 20205248-T-A DYZ19 +
17162203-T-A 15050323-T-A Y+
17121026-T-A 15009146-T-A YY+
22435755-T-TAC 20273869-T-TAC DYZ19 +
22366554-C-T 20204668-C-T DYZ19 +
22346829-T-A 20184943-T-A DYZ19 +
9120994-G-T 9283385-G-T Y+
5414420-T-C 5546379-T-C +
5484695-C-A 5616654-C-A +
6066611-G-A 6198570-G-A FTB62304 +
6984748-A-G 7116707-A-G YY+
9432763-C-T 9595154-C-T Y+
22271047-C-A 20109161-C-A BY191925 DYZ19 +
7536337-CAAA-C 7668296-CAAA-C 28×A+
9159245-ACTT-A 9321636-ACTT-A +
7657788-T-G 7789747-T-G YY+
4156739-A-C 4288698-A-C +
3588094-GTATATATATATA-G 3720053-GTATATATATATA-G 24×TA+
8732064-G-A 8864023-G-A Y+
16680978-C-T 14569098-C-T FT30326 YY+
22460499-C-T 20298613-C-T BY220540 DYZ19 +
5108708-C-CT 5240667-C-CT +
8466194-A-T 8598153-A-T BY209321 YY11×AAAT+
7832398-C-T 7964357-C-T YY+
23729272-C-CG 21567386-C-CG +
5219042-G-T 5351001-G-T +
3963557-C-T 4095516-C-T +
4392282-CAA-C 4524241-CAA-C 45×A+
13228411-C-T 11072735-C-T +
10756701-A-T +
24422478-C-CAAAAAA 22276331-C-CAAAAAA 43×A+
22352583-T-G 20190697-T-G DYZ19 +
4356606-AT-A 4488565-AT-A 9×T+
3930762-A-ATATATATATACATATATATTT 4062721-A-ATATATATATACATATATATTT +
17920941-C-CAAAAAAA 15809061-C-CAAAAAAA 45×A+
58823335-TCATTC-T 56767529-GGGAAT-G +
13428345-T-A 11272669-T-A +
13202997-G-C 11047321-G-C +
3571752-G-GTTTTTTTTTTTTTTT 3703711-G-GTTTTTTTTTTTTTTT 45×T+
11028340-T-TTCACCATTCCATTGCATTCCATTCCATCCAATTCTATTCCACTCTATTTCACTCCA +
56737190-A-G +
2888870-CA-C 3020829-CA-C 32×A+
17624520-G-A 15512640-G-A YY+
15865946-C-CTTTTTTTTTTTTTTTTTTTTTTTTTTT 13754066-C-CTTTTTTTTTTTTTTTTTTTTTTTTTTT 37×T+
3238466-A-G 3370425-A-G +
10649041-TATTCC-T +
3355402-C-A 3487361-C-A +
21847377-T-C 19685491-T-C Y+
7950280-T-G 8082239-T-G YY+
22466723-A-C 20304837-A-C DYZ19 +
58853629-G-A 56737242-C-T +
28696916-A-C 26550769-A-C +
28491303-CA-C 26345156-CA-C 42×A+
22463297-G-A 20301411-G-A BY221089 DYZ19 +
13726743-G-A 11571067-G-A +
28474141-A-G 26327994-A-G +
26684800-G-T 24538653-G-T P1_g2 +
20569614-C-CAAAAAAAAAA 18407728-C-CAAAAAAAAAA P5_Dst 33×A+
26617372-A-G 24471225-A-G P1_g2 +
22653538-A-G 20491652-A-G YY+
24109474-T-A 21963327-T-A P3_b1 +
24432419-A-AAGGG 22286272-A-AAGGG +
56737314-G-A +
24520884-T-G 22374737-T-G +
23235402-C-G 21073516-C-G Y+
24432420-T-G 22286273-T-G Y+
8218120-CTTCTTTCTTTCT-C 8350079-CTTCTTTCTTTCT-C 15×TTCT+
10787491-CA-C *
10917342-T-A *
10909759-G-T *
13482257-G-A 11326581-G-A *
13482865-T-G 11327189-T-G *
10909757-A-C *
10787904-CTCA- *
10627165-AAC-A *
10627160-A-C *
13470656-G-A 11314980-G-A *
10787495-G-GC *
10787479-CACTT-C *
13462854-G-A 11307178-G-A *
56831484-C-CT *
13482870-A-T 11327194-A-T *
13701444-CAATGA-C 11545768-CAATGA-C *
13575274-G-A 11419598-G-A *
13473172-C-G 11317496-C-G *
10776047-TTCCATTCCATTCCATTCCGCTCCACTCAATTCCACTCCACTCCACTCCACTCCATTCCAC- *
13489476-G-GCA 11333800-G-GCA *
17543962-TA-T,T 15432082-TA-T,T 11×A*
10006130-T-C 10168521-T-C Y*
11333953-CCACCCA- *
22510826-G-A 20348940-G-A BY38140 DYZ19 *
13462810-A-T 11307134-A-T *
13462937-G-C 11307261-G-C *
13478456-C-G 11322780-C-G *
13477789-T-C 11322113-T-C *
13477832-T-G 11322156-T-G *
13477831-G-C 11322155-G-C *
13477827-A-G 11322151-A-G *
13477824-A-C 11322148-A-C *
13477815-A-C 11322139-A-C *
13477813-A-C 11322137-A-C *
13477807-A-G 11322131-A-G *
22510590-T-A 20348704-T-A DYZ19 *
13477806-C-T 11322130-C-T *
13477791-T-TGG 11322115-T-TGG *
10006127-T-C 10168518-T-C Y*
13470743-A-ATAAT 11315067-A-ATAAT *
13477578-A-G 11321902-A-G *
13477410-A-G 11321734-A-G *
13477409-C-T 11321733-C-T *
13477402-G-T 11321726-G-T *
13477397-C-A 11321721-C-A *
13469468-GC-G 11313792-GC-G *
13478862-C-A 11323186-C-A BY34351 *
13477234-A-T 11321558-A-T *
13476778-GTTCCA-G 11321102-GTTCCA-G *
13470744-GTACC-G 11315068-GTACC-G *
13478873-G-GA 11323197-G-GA *
17731014-C-CA 15619134-C-CA 35×A*
13730123-A-C 11574447-A-C *
9397727-T-C 9560118-T-C YY*
13478478-C-CCGGA 11322802-C-CCGGA *
13480247-A-C 11324571-A-C *
9397722-T-TG 9560113-T-TG *
13480239-G-C 11324563-G-C *
13480237-G-T 11324561-G-T *
13372146-G-A 11216470-G-A *
13284205-G-C 11128529-G-C *
9980763-G-GGAAAGAAC 10143154-G-GGAAAGAAC *
5088747-T-G 5220706-T-G *
4773474-C-A 4905433-C-A *
22509308-G-T 20347422-G-T DYZ19 *
22509305-A-G 20347419-A-G DYZ19 *
13464502-C-T 11308826-C-T *
13484135-G-A 11328459-G-A *
11308162-T- *
10980578-T- *
10688072-T-TTCCTC *
10688066-T-TCCATTGCA *
10688064-C-CCA *
10006150-GA-G 10168541-GA-G *
10006146-G-GGA 10168537-G-GGA *
13488707-C-CT 11333031-C-CT *
11333027-GT- *
13469494-G-T 11313818-G-T *
9397731-A-AGTGAAGCAAACCTGGCGGGAGAAAATAAATCTTGGTT 9560122-A-AGTGAAGCAAACCTGGCGGGAGAAAATAAATCTTGGTT *
13480248-AG-A 11324572-AG-A *
13485053-G-A 11329377-G-A *
11332080-A- *
10006131-G-A 10168522-G-A Y*
13485061-T-A 11329385-T-A *
13471807-C-A 11316131-C-A *
13462530-C-A 11306854-C-A *
10912884-C-G *
10912869-A-G *
10912862-C-T *
13477869-A-G 11322193-A-G *
22510877-G-A 20348991-G-A BY225697 DYZ19 *
10745759-C-T *
10745745-AT-A *
10745740-ATTCC-A *
10006139-G-A 10168530-G-A Y*
17926604-G-C 15814724-G-C YY*
13487746-C-CCA 11332070-C-CCA *
13803193-G-A 11682487-G-A *
13803182-G-A 11682476-G-A *
22510878-C-G 20348992-C-G DYZ19 *
13803177-G-A 11682471-G-A *
56709284-G- *
19048394-G-T,T 16936514-G-T,T *
13478437-G-A 11322761-G-A *
13466572-T-A 11310896-T-A *
28785742-G-A 26639595-G-A *
9397721-A-AC 9560112-A-AC *
10750028-ATCCATTCCATTCCAT-A *
13485256-A-T 11329580-A-T *
11323178-A- *
5020828-A-ACT 5152787-A-ACT *
5510044-G-GGGCAAGTGCCAACA 5642003-G-GGGCAAGTGCCAACA *
5510042-T-G 5642001-T-G *
13485411-A-G 11329735-A-G *
13485418-A-T 11329742-A-T *
5326153-A-ATGATCCGGGGGGTGTTGTCACCCGCGGCAGCCGGGCGCTGGTGACCGCTGATAAGGGGAACGGCCCGCTGCGTGTGAGGTCTAACGCAGGC 5458112-A-ATGATCCGGGGGGTGTTGTCACCCGCGGCAGCCGGGCGCTGGTGACCGCTGATAAGGGGAACGGCCCGCTGCGTGTGAGGTCTAACGCAGGC *
13721600-G-A 11565924-G-A *
5206283-C-CTGTCGCTCGCAGAAGTCGTCGCGGAAATGCTCCAACGACGAGCCTGCGGCGTGGAAGAGCAGCAGGCGGAGCTCGGCGCGAAAGTGCTGCGGG 5338242-C-CTGTCGCTCGCAGAAGTCGTCGCGGAAATGCTCCAACGACGAGCCTGCGGCGTGGAAGAGCAGCAGGCGGAGCTCGGCGCGAAAGTGCTGCGGG *
5122282-A-AACCATGTCCCAAGAAATCCTCGACCAAGTGCGCCGCCGCCGCACGTTTGCCATCATCTCCCACCCTGACGCGGGTAAAACCACGCTGACCGAAAAACTGCTGCTGTTTTCAGG 5254241-A-AACCATGTCCCAAGAAATCCTCGACCAAGTGCGCCGCCGCCGCACGTTTGCCATCATCTCCCACCCTGACGCGGGTAAAACCACGCTGACCGAAAAACTGCTGCTGTTTTCAGG *
5078869-GTAGTT-G 5210828-GTAGTT-G *
5020834-A-ACTGGCTACTTGGC 5152793-A-ACTGGCTACTTGGC *
5020832-A-AAACTGATTGGCTTTATTCCTGTTATTG 5152791-A-AAACTGATTGGCTTTATTCCTGTTATTG *
5020829-G-GATATGCTTA 5152788-G-GATATGCTTA *
4520429-A-AAGTAATT 4652388-A-AAGTAATT *
10818752-A-C *
4520427-A-ATC 4652386-A-ATC *
4520425-G-T 4652384-G-T *
4258617-A-AATCCTGCCGAACAGGTTCGCTCCGCTTTGGCCGAATTGGCCGCGCATCCT 4390576-A-AATCCTGCCGAACAGGTTCGCTCCGCTTTGGCCGAATTGGCCGCGCATCCT *
4258614-C-CAAAACGCTGCCGTTTTAAAAGAGGCCGTCTGAAATGTATCCGCATTTTGCCGTTATCGCTTTGGGCAGCAATCTCG 4390573-C-CAAAACGCTGCCGTTTTAAAAGAGGCCGTCTGAAATGTATCCGCATTTTGCCGTTATCGCTTTGGGCAGCAATCTCG *
56737259-GAATGGAATTGAATGGAATGGAATAATATGA-G,G *
3929870-T-TATCCTGCCGGTGTAGGTAGAGCGATAGAAGCTAAACAGTTGCCCTATGGTAGCCGCCTCATTGCGCTGCACTGACCTATAATTCTTGTACATACCGGTAGTAAAGGGCGTTACAA 4061829-T-TATCCTGCCGGTGTAGGTAGAGCGATAGAAGCTAAACAGTTGCCCTATGGTAGCCGCCTCATTGCGCTGCACTGACCTATAATTCTTGTACATACCGGTAGTAAAGGGCGTTACAA *
9962117-A-T 10124508-A-T Y*
10631708-C-A *
10631750-A-C *
3314486-A-T 3446445-A-T *
10631751-C-A *
2786245-ATTGT-A 2918204-ATTGT-A *
5756015-A-C 5887974-A-C *
10652666-TCCAC-T *
2731503-C-CCGTCGACAGCGGTT 2863462-C-CCGTCGACAGCGGTT *
22813269-C-T 20651383-C-T YY*
13488749-A-C 11333073-A-C *
13488833-G-GT 11333157-G-GT *
13489229-CACCCTTCAGCGAGGAAGAATACCGGACTCTGCTGGAGGAGCTTTAGGATGCGGGGTTGGGACAGGGTCGGATCGGGGCAGGGCGGTGGCCTCTCTTTCGCAGGGAACACCTGGCTGGCTATGGAGGTGCGTGTCTTCTCCCCGCCCCCTCCACCGGGCTGACCTGCCTGGGATTCCTGCCTTCT-C 11333553-CACCCTTCAGCGAGGAAGAATACCGGACTCTGCTGGAGGAGCTTTAGGATGCGGGGTTGGGACAGGGTCGGATCGGGGCAGGGCGGTGGCCTCTCTTTCGCAGGGAACACCTGGCTGGCTATGGAGGTGCGTGTCTTCTCCCCGCCCCCTCCACCGGGCTGACCTGCCTGGGATTCCTGCCTTCT-C *
18742025-T-A 16630145-T-A YY*
7755020-T-TTCGGCTGGCGCTGCCATCCCCCCATGTCCCTTCCCGGTCAGCCCCCTTTCAACATCCCCTTTTTCGCTTCCCCGGCATTTCATCATGGCCATTCCTTCCATCCGCAGCTACCCCATGC 7886979-T-TTCGGCTGGCGCTGCCATCCCCCCATGTCCCTTCCCGGTCAGCCCCCTTTCAACATCCCCTTTTTCGCTTCCCCGGCATTTCATCATGGCCATTCCTTCCATCCGCAGCTACCCCATGC *
7713858-A-ATAATGATGTGTAAGCGTGCTATTGTTCCAATTTCGAAGTGCCCAAAGATAGCAAAAAAGCGCCTACACCCAGTGGATCTCTGCAGGCTTTGAAGGCAAGCCAAAGAGATGCATTAGATAACC 7845817-A-ATAATGATGTGTAAGCGTGCTATTGTTCCAATTTCGAAGTGCCCAAAGATAGCAAAAAAGCGCCTACACCCAGTGGATCTCTGCAGGCTTTGAAGGCAAGCCAAAGAGATGCATTAGATAACC *
22813242-G-C 20651356-G-C YY*
7675422-A-AACACTCTTCAATCCAATACGAAGGTGTTACAACAATGGCTAAAGATGGATATGGTGAAATGAGCTGTATCTCATGT 7807381-A-AACACTCTTCAATCCAATACGAAGGTGTTACAACAATGGCTAAAGATGGATATGGTGAAATGAGCTGTATCTCATGT *
22813248-A-G 20651362-A-G FT51486 YY*
22813255-A-G 20651369-A-G YY*
22813261-A-G 20651375-A-G YY*
22813268-C-A 20651382-C-A YY*
22938095-T-TCG 20776209-T-TCG *
6988243-TA-T 7120202-TA-T 9×A*
7644477-C-CTAAAAGGGAAGGAAAGCAAGGTGACTAGTGATTTTCTCGCTAGTAGTGTTGGAGTCAATCCTGTTATTATCCGAAAAACTTTGT 7776436-C-CTAAAAGGGAAGGAAAGCAAGGTGACTAGTGATTTTCTCGCTAGTAGTGTTGGAGTCAATCCTGTTATTATCCGAAAAACTTTGT *
7644474-A-AGCCGATTTACCATTGCGACACATATGTTGGTAATCATTG 7776433-A-AGCCGATTTACCATTGCGACACATATGTTGGTAATCATTG *
13466686-GCGTAGACAAGAGTTACATCA-G 11311010-GCGTAGACAAGAGTTACATCA-G *
7290011-C-CCCTGCCCACGTTACCGCGTGGGGTTTTCCTTTTTACGGCCTTCGCTAAATCTCTCAATCTGTCCATGATTTGGTATCGTGGATTCTGACGTTCGCCGCTTGCTATCTTAT 7421970-C-CCCTGCCCACGTTACCGCGTGGGGTTTTCCTTTTTACGGCCTTCGCTAAATCTCTCAATCTGTCCATGATTTGGTATCGTGGATTCTGACGTTCGCCGCTTGCTATCTTAT *
7290009-C-CGTGCCTAA 7421968-C-CGTGCCTAA *
7197821-T-TATTTTCCTTTTCTAAGACATTAAGAATATCTTTACCATGATGTTGAACTAGGTTAGTAGCCTTATTCTCGCTAACGATAGTGGACAGGAAATCAA 7329780-T-TATTTTCCTTTTCTAAGACATTAAGAATATCTTTACCATGATGTTGAACTAGGTTAGTAGCCTTATTCTCGCTAACGATAGTGGACAGGAAATCAA *
7190708-A-G,G 7322667-A-G,G *
28814615-T-G 26668468-T-G *
7136245-CA-C,C 7268204-CA-C,C 14×A*
7125909-A-AGCATACCGTGGAGCAGGTTCTTCTGCGTAAGAACTAGAGGTTCTTTAGGTTTTTAGTGTTCGTGTGCGGCTTTTAGCCGGTATTGTGGTGCATTCTAGTAGAAGGCGCCGGAGGCTCCACTCC 7257868-A-AGCATACCGTGGAGCAGGTTCTTCTGCGTAAGAACTAGAGGTTCTTTAGGTTTTTAGTGTTCGTGTGCGGCTTTTAGCCGGTATTGTGGTGCATTCTAGTAGAAGGCGCCGGAGGCTCCACTCC *
7125908-C-CG 7257867-C-CG *
13484741-G-T 11329065-G-T *
7075237-G-T 7207196-G-T YY*
2731505-G-GAAACAGGCGTTTTTTACCTGTCAAAAGCCCGCTGAAGAAGACTTTGCAGGGATTATCGTTTGGGTTTCTGAAAACGCAGCCGTACCGACCATAGACGCAAACAAAGTCTATGA 2863464-G-GAAACAGGCGTTTTTTACCTGTCAAAAGCCCGCTGAAGAAGACTTTGCAGGGATTATCGTTTGGGTTTCTGAAAACGCAGCCGTACCGACCATAGACGCAAACAAAGTCTATGA *
10669378-C-G *
13479311-G-T 11323635-G-T *
11295260-T- *
13712904-G-C 11557228-G-C FT379555 *
13475409-T-G 11319733-T-G *
13475400-C-G 11319724-C-G *
13472202-C-G 11316526-C-G *
10652673-C-CT *
10652671-G-GTAT *
10006280-G-C 10168671-G-C Y*
9924443-A-C 10086834-A-C Y*
10124953-A- *
22509927-G-GTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTGTATTCCTTCTGGCAGGTTCATGGTCTTGCTCCCTTCACTAATGAAGCTGCAGACCTTACTGT 20348041-G-GTGAGTGTTACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTGTATTCCTTCTGGCAGGTTCATGGTCTTGCTCCCTTCACTAATGAAGCTGCAGACCTTACTGT DYZ19 *
11312646-C- *
13479017-A-G 11323341-A-G *
13468962-G-A 11313286-G-A *
10978918-C-T *
9946671-C-CCA 10109062-C-CCA *
28803142-G-A 26656995-G-A *
13487249-T-G 11331573-T-G *
13479251-T-C 11323575-T-C *
10914493-G-C *
13464513-C-G 11308837-C-G *
13469922-C-T 11314246-C-T *
13488954-C-T 11333278-C-T *
13488132-G-T 11332456-G-T *
13488107-T-A 11332431-T-A *
13485262-T-C 11329586-T-C *
13477128-C-A 11321452-C-A *
13485250-G-A 11329574-G-A *
13712906-A-AAG 11557230-A-AAG *
13450879-A-ACCACTCCACTCCTCTCCCCAACACT,ACCATTCCACTCCACCCCAACACT 11295203-A-ACCACTCCACTCCTCTCCCCAACACT,ACCATTCCACTCCACCCCAACACT *
56721525-A-T *
13464108-G-A 11308432-G-A BY85675 *
21638263-T-TAGCC 19476377-T-TAGCC *
21638260-TG-T 19476374-TG-T *
13734193-A-C 11578517-A-C *
13734185-T-A 11578509-T-A *
13471160-A-C 11315484-A-C *
13471116-G-C 11315440-G-C *
13471096-C-G 11315420-C-G *
13471090-A-T 11315414-A-T *
13471068-A-AAG 11315392-A-AAG *
13471066-A-G 11315390-A-G *
13471065-A-C 11315389-A-C *
13469511-A-T 11313835-A-T *
13462681-C-T 11307005-C-T *
23069075-G-C 20907189-G-C YY*
13462669-T-TG 11306993-T-TG *
13462663-C-G 11306987-C-G *
13462640-G-C 11306964-G-C *
13462627-C-T 11306951-C-T *
13460939-G-A 11305263-G-A *
9992599-C-A 10154990-C-A Y*
9985801-G-T 10148192-G-T Y*
9916828-T-C 10079219-T-C Y*
9916818-T-G 10079209-T-G Y*
9916816-T-A 10079207-T-A Y*
11332081-C- *
13488805-C-CT 11333129-C-CT *
13488801-AAG-A 11333125-AAG-A *
13485059-A-G 11329383-A-G *
11025286-TG-T *
13477108-C-G 11321432-C-G *
13690677-G-A 11535001-G-A BY88628 *
9923966-G-A 10086357-G-A Y*
13477114-G-C 11321438-G-C BY85968 *
13477141-G-T 11321465-G-T *
9923961-T-A 10086352-T-A Y*
56832492-CACCGCACTCCACTCCACTCCACTCA- *
13354869-A-AAT 11199193-A-AAT *
56863745-T-G *
21757041-A-C *
11332064-C- *
13478984-G-T 11323308-G-T *
10974782-CTA-C *
2786282-T-C 2918241-T-C Y*
13477165-G-T 11321489-G-T *
9923979-G-C 10086370-G-C Y*
13690671-TC-T 11534995-TC-T *
9964772-T-C 10127163-T-C Y*
9964767-T-C 10127158-T-C Y*
13470379-CG-C 11314703-CG-C *
13477414-T-C 11321738-T-C *
13489891-T-G 11334215-T-G *
13489884-C-G 11334208-C-G *
56834249-GTTCCA- 4×TTCCA*
56757349-CA-C *
13477437-C-G 11321761-C-G *
56721430-G-T *
56710277-G-T *
13476775-T-A 11321099-T-A *
9923991-A-T 10086382-A-T Y*
56710255-A-G *
22509544-C-A 20347658-C-A DYZ19 *
10934864-ATTCCAT-A *
56834770-C-CCA *
56703130-G-A *
22509968-T-C 20348082-T-C DYZ19 *
13462506-G-A 11306830-G-A *
13479411-C-A 11323735-C-A *
13465315-G-A 11309639-G-A *
11295321-A- *
13269573-C-CAA 11113897-C-CAA 8×A*
13467559-A-C 11311883-A-C *
13467579-C-T 11311903-C-T *
13467598-A-T 11311922-A-T *
22509528-A-G 20347642-A-G DYZ19 *
13476766-C-T 11321090-C-T *
22508065-C-A 20346179-C-A DYZ19 *
13469708-C-A 11314032-C-A *
22508050-T-A 20346164-T-A DYZ19 *
12865784-CT-C,C 15×T*
13476303-GAGATATGTCACAATGCCCCCATGGGCAGAGCCTAGAATAAAGTCCCATCAGCTGGGTGATCAGTGTAGAGATATGTCACAAAGCCCTGTAA-G 11320627-GAGATATGTCACAATGCCCCCATGGGCAGAGCCTAGAATAAAGTCCCATCAGCTGGGTGATCAGTGTAGAGATATGTCACAAAGCCCTGTAA-G *
13476689-G-A 11321013-G-A *
13489473-CCT-C 11333797-CCT-C *
13476720-G-C 11321044-G-C *
11294473-T- *
9923994-G-A 10086385-G-A Y*
13476724-T-A 11321048-T-A *
13476763-TC-T 11321087-TC-T *
56710270-G-C *
56696977-C-T *
10934897-CCACTGCAT-C *
28229-A-T *
13488036-C-G 11332360-C-G *
13488023-C-T 11332347-C-T *
13435009-A-G 11279333-A-G *
10978921-C-T *
9984072-A-G 10146463-A-G Y*
9984071-C-T 10146462-C-T Y*
22436906-T-A 20275020-T-A DYZ19 *
13463837-GTTTTC-G 11308161-GTTTTC-G *
13508326-A-AGCTC 11352650-A-AGCTC *
13488384-G-T 11332708-G-T *
13470302-C-T 11314626-C-T *
13482887-C-T 11327211-C-T *
28227-T-A *
13489609-C-G 11333933-C-G *
56767324-T-G *
56743150-T-A *
56700015-G-A *
56700004-A-T *
19209854-C-T 17097974-C-T YY*
13636946-G-C 11481270-G-C *
13487602-C-T 11331926-C-T *
13557839-A-G 11402163-A-G *
13488665-C-G 11332989-C-G *
13488247-G-C 11332571-G-C *
13487665-A-AGCTGTGAAACGC 11331989-A-AGCTGTGAAACGC *
13487656-C-T 11331980-C-T *
13488043-A-C 11332367-A-C *
13494553-T-A 11338877-T-A *
21757018-G-T *
10949654-ATTCCC-A *
21756997-T-C *
11312225-CAGAATTCCCTGTAGGCAGTGCTTATAAAAGTGTTACATCACCTAGGTGATCAGTGCAGAGATTTGTCA- *
11312222-T- *
13464097-A-C 11308421-A-C *
13478741-C-T 11323065-C-T *
11307508-A- *
10949690-T-C *
10949684-ATTC-A *
10949678-AATT-A *
13479356-C-G 11323680-C-G *
10949672-CCTTT-C *
10949667-C-G *
13479365-G-A 11323689-G-A *
13606055-T-C 11450379-T-C *
4909353-T-C 5041312-T-C *
11333950-CCA- *
13470093-A-G 11314417-A-G *
13470076-C-G 11314400-C-G *
13415407-AT-A 11259731-AT-A 10×T*
10627143-CCCCAA-C *
56735852-T-C *
9924414-T-C 10086805-T-C Y*
13479382-T-G 11323706-T-G *
9924411-C-A 10086802-C-A Y*
9200466-G-A 9362857-G-A Y*
13606061-AATG-A 11450385-AATG-A *
13480089-C-A 11324413-C-A *
10934872-GCATTCCATC-G *
10934924-A-G *
13472057-G-C 11316381-G-C *
13477698-G-T 11322022-G-T *
13477797-A-G 11322121-A-G *
13477788-GTT-G 11322112-GTT-G *
13477774-G-A 11322098-G-A *
13477742-CGT-C 11322066-CGT-C *
13477740-C-CAG 11322064-C-CAG *
13477732-G-A 11322056-G-A *
13477731-A-G 11322055-A-G *
13477721-T-TG 11322045-T-TG *
13477716-CG-C 11322040-CG-C *
13477710-G-T 11322034-G-T *
13477706-C-T 11322030-C-T *
13477700-C-T 11322024-C-T *
13477697-G-C 11322021-G-C *
13478134-T-TGC 11322458-T-TGC *
13477690-C-G 11322014-C-G *
13477678-T-C 11322002-T-C *
7979740-A-AGTTGCTTTATCTTCAAATACTCCACGTCCTGTTTCTTCAAAGGCATGTAAAGCCAAT 8111699-A-AGTTGCTTTATCTTCAAATACTCCACGTCCTGTTTCTTCAAAGGCATGTAAAGCCAAT *
13477673-T-C 11321997-T-C *
13477671-G-T 11321995-G-T *
13477670-G-A 11321994-G-A *
13477667-A-G 11321991-A-G *
13477490-C-CT 11321814-C-CT *
13477372-G-A 11321696-G-A *
13477358-C-T 11321682-C-T *
13475525-GA-G 11319849-GA-G *
13474148-G-GCA 11318472-G-GCA *
13477803-T-A 11322127-T-A FT444141 *
13478813-C-A 11323137-C-A *
13472891-A-G 11317215-A-G *
13493852-G-GTTATTTTATTTTATT 11338176-G-GTTATTTTATTTTATT 7×TTATT*
11307507-TAC- *
11025288-CATTCCATTCCATTCCTTTCTTTTGAGAGTGTCT-C *
13487652-T-C 11331976-T-C *
10969318-G-GGAGC *
10969313-ACAAT-A *
10800356-A-ATT *
10800352-C-T *
14331158-C-G 12210452-C-G YY*
56770638-G-T *
11660002-G-T *
13709335-GAAATGGAGT-G 11553659-GAAATGGAGT-G *
13709315-CGAATGGAATGGACTG-C 11553639-CGAATGGAATGGACTG-C *
11332083-C- *
13478814-C-T 11323138-C-T *
13487505-C-T 11331829-C-T *
13484709-T-G 11329033-T-G *
13484680-G-T 11329004-G-T *
13484674-T-C 11328998-T-C *
13484656-A-G 11328980-A-G *
13482951-A-T 11327275-A-T *
13482946-C-A 11327270-C-A *
13482934-G-A 11327258-G-A *
13482926-C-G 11327250-C-G *
13479350-A-G 11323674-A-G *
13479334-A-G 11323658-A-G *
13478824-C-A 11323148-C-A *
13474145-GTT-G 11318469-GTT-G *
13472872-A-T 11317196-A-T *
13462494-G-T 11306818-G-T *
9989912-A-C 10152303-A-C Y*
13462815-C-G 11307139-C-G *
13462174-A-C 11306498-A-C *
13462160-G-C 11306484-G-C *
10992832-CAG-C *
10992831-C-CTG *
10753017-C-CTGTTT *
10903733-G-C *
10745758-G-C *
10688227-TTCCAC-T *
9995350-T-TGA 10157741-T-TGA *
9995325-C-T 10157716-C-T Y*
9989914-C-A 10152305-C-A Y*
9989896-G-A 10152287-G-A Y*
13470284-C-T 11314608-C-T *
9909218-T-C 10071609-T-C Y*
56886107-C-CAAAAAAAAAACTT *
28812900-T-TGAAGA 26666753-T-TGAAGA *
10903736-C-T *
13462456-A-T 11306780-A-T *
13462480-G-A 11306804-G-A *
13462486-G-A 11306810-G-A *
13823283-GGGTGGTTTAA-G 11702577-GGGTGGTTTAA-G *
13478848-T-TC 11323172-T-TC *
13478828-A-AC 11323152-A-AC *
13462491-C-A 11306815-C-A *
13447591-T-C 11291915-T-C *
13469691-G-T 11314015-G-T *
13470300-T-TTTTAC 11314624-T-TTTTAC *
13472861-AG-A 11317185-AG-A *
13472795-G-T 11317119-G-T *
13472858-AG-A 11317182-AG-A *
13472850-C-G 11317174-C-G *
13472843-C-G 11317167-C-G *
10006155-T-G 10168546-T-G Y*
10006161-G-GGA 10168552-G-GGA *
10006371-T-C 10168762-T-C Y*
13472837-T-A 11317161-T-A *
13472829-G-T 11317153-G-T *
13472817-GCA-G 11317141-GCA-G *
10653557-C-G *
13472816-A-ATT 11317140-A-ATT *
13472812-G-T 11317136-G-T *
13472782-G-A 11317106-G-A *
10903708-A-C *
13472772-C-A 11317096-C-A *
13471159-T-C 11315483-T-C *
13471113-C-T 11315437-C-T *
13470422-A-T 11314746-A-T *
13470407-G-T 11314731-G-T *
13470385-G-A 11314709-G-A *
13470371-C-A 11314695-C-A *
13470356-C-T 11314680-C-T *
13470341-C-T 11314665-C-T *
13470332-C-A 11314656-C-A *
13470327-C-T 11314651-C-T *
10903706-C-T *
13470326-G-T 11314650-G-T *
13477674-G-C 11321998-G-C *
9814172-G-GGCGTTTTAGATTAGCAAGCCCTTCTGCACCAAAGTGCGCATATTTTTCACCATTGGCAGCAATATCGTTTGTGAGTTTTTTTAACTCTTGATATTGGCTAATTCCACCATCTTGCAGATTGGCTTTTA 9976563-G-GGCGTTTTAGATTAGCAAGCCCTTCTGCACCAAAGTGCGCATATTTTTCACCATTGGCAGCAATATCGTTTGTGAGTTTTTTTAACTCTTGATATTGGCTAATTCCACCATCTTGCAGATTGGCTTTTA *
8000904-TTGAGTATAGGC-T 8132863-TTGAGTATAGGC-T *
14707644-A-AAT 12595710-A-AAT *
15791485-TGA-T 13679605-TGA-T *
15520589-A-AGAAGTTGGTGAAGAAGATTGAGGTGAAGGGCATACGCCAGGTGGGAAGTACGGCTACCAATAGC 13408709-A-AGAAGTTGGTGAAGAAGATTGAGGTGAAGGGCATACGCCAGGTGGGAAGTACGGCTACCAATAGC *
15502133-A-AGTAGAGGTATCTGACCTATTTCCCTCAAATACATTTTAATAGGCTCATCTACATC 13390253-A-AGTAGAGGTATCTGACCTATTTCCCTCAAATACATTTTAATAGGCTCATCTACATC *
15338563-C-CTTCCAACCTTTGAATCGAATGATTGGATTATTGTGGA 13226681-C-CTTCCAACCTTTGAATCGAATGATTGGATTATTGTGGA *
15338560-T-TTTTATTGGGACTCCATACACGGTGGTGGGATCAAGTA 13226678-T-TTTTATTGGGACTCCATACACGGTGGTGGGATCAAGTA *
15269062-G-GTAATCAAGATTTGTAAGGTCTGGAGCA 13157151-G-GTAATCAAGATTTGTAAGGTCTGGAGCA *
15269059-A-AAAACTTTTCGTTGATGAACATAATGTTCTGAATAATTTTCTGGTAATCTATCATCTTAAC 13157148-A-AAAACTTTTCGTTGATGAACATAATGTTCTGAATAATTTTCTGGTAATCTATCATCTTAAC *
15219441-T-TCTGCCTTGTAAAAATATCCCAAAACTTGAGTACTATAATCTACTAAGGCAGGAGAAGAAGCTTGATATTTACGGTAAAGATAAATAAATACTTTATATTTTGCAGCCTGC 13107527-T-TCTGCCTTGTAAAAATATCCCAAAACTTGAGTACTATAATCTACTAAGGCAGGAGAAGAAGCTTGATATTTACGGTAAAGATAAATAAATACTTTATATTTTGCAGCCTGC *
15193542-C-CAGGAGAACCGCCAAGTGCGACTAACTGACGAGCCACATAAGAACGTGCCATCGGAATTACTTCCACTGGCAATGGGAAAGTTGAACCAAGCACATCAACTTGTTTTGAACTATCAACGA 13081628-C-CAGGAGAACCGCCAAGTGCGACTAACTGACGAGCCACATAAGAACGTGCCATCGGAATTACTTCCACTGGCAATGGGAAAGTTGAACCAAGCACATCAACTTGTTTTGAACTATCAACGA *
14899262-T-TCTTTCGCAAAGCTTTTGGTGAAAATCACAACCAGCGTGGAGAGTTTATAGTGAGGGTAAG 12787329-T-TCTTTCGCAAAGCTTTTGGTGAAAATCACAACCAGCGTGGAGAGTTTATAGTGAGGGTAAG *
14899259-T-TTCGATGAGCATGAAGTGATAGA 12787326-T-TTCGATGAGCATGAAGTGATAGA *
14894932-C-CCACCACAAGCTGTAAATAACATAATAAAAGCTAATACTGATAACAATGATAAAACTCTAAATTTCTTCATTTTGCGCCTCCTAAAAATTTAACTAAGTAAT 12782998-C-CCACCACAAGCTGTAAATAACATAATAAAAGCTAATACTGATAACAATGATAAAACTCTAAATTTCTTCATTTTGCGCCTCCTAAAAATTTAACTAAGTAAT *
14872663-T-TGACCGCACTTGAAGCCCATGAACAAGCTGAATTAACCGAGCGTTTATCTGATTACTATTCGCCGGATGATGTGGAACTGCAACCAGCACCTAAATCTGAAGCTAAGTCCTAGAGAATAATTATGAGCA 12760733-T-TGACCGCACTTGAAGCCCATGAACAAGCTGAATTAACCGAGCGTTTATCTGATTACTATTCGCCGGATGATGTGGAACTGCAACCAGCACCTAAATCTGAAGCTAAGTCCTAGAGAATAATTATGAGCA *
14707642-A-AT 12595708-A-AT *
15797625-G-GAATTCCCTAGAATTTAAAACCTTTAGAATAGAATTTCTAAACGTTTCATCTGTT 13685745-G-GAATTCCCTAGAATTTAAAACCTTTAGAATAGAATTTCTAAACGTTTCATCTGTT *
14707639-A-T 12595705-A-T YY*
14707636-A-T 12595702-A-T YY*
14652986-T-TGATGTAATGTGGGTTGTTTTTTGAATGATTTGCATAATATTGAATTGTTTTTGAGTTTTGAATTATTATCCTATA 12541051-T-TGATGTAATGTGGGTTGTTTTTTGAATGATTTGCATAATATTGAATTGTTTTTGAGTTTTGAATTATTATCCTATA *
14609799-CAA-C,CAAAA 12498001-CAA-C,CAAAA 23×A*
14609508-T-TTTTACCTAAAGAAACATATATAATTGAGAATAAAATAAACACTTGCAACTCAAGCGAGACAGCCCAGTACACCCCAAACCAACTAACATCCGTTGTTTCTGTAAAATTACGAAGAAACATAATA 12497710-T-TTTTACCTAAAGAAACATATATAATTGAGAATAAAATAAACACTTGCAACTCAAGCGAGACAGCCCAGTACACCCCAAACCAACTAACATCCGTTGTTTCTGTAAAATTACGAAGAAACATAATA *
14572108-A-AATGAGCATGACAGCGAAGAGATAGGCCAGCCAGTTCTGCTTGAGTGCCGTCTGGATGTAGTAGGCCGGGCCACCGTAGGAGTGGTGGGGT 12460308-A-AATGAGCATGACAGCGAAGAGATAGGCCAGCCAGTTCTGCTTGAGTGCCGTCTGGATGTAGTAGGCCGGGCCACCGTAGGAGTGGTGGGGT *
12372815-A-ATTT *
14482904-T-TCCACCCGCTCGGCTGCCAGTTTTTCCGCCATC 12362173-T-TCCACCCGCTCGGCTGCCAGTTTTTCCGCCATC *
14482903-C-CG 12362172-C-CG *
14482901-T-TGCCGTCCGGCGAGGGTC 12362170-T-TGCCGTCCGGCGAGGGTC *
14108384-C-CAATTTTTCTAATATTCAATGATACAAAATAATGAATTTTAGTATTTTTTTATCTAAAAATTAATATAATTCTTTTTCTGATTGGAAATATTTTTTAATTATTT 11987678-C-CAATTTTTCTAATATTCAATGATACAAAATAATGAATTTTAGTATTTTTTTATCTAAAAATTAATATAATTCTTTTTCTGATTGGAAATATTTTTTAATTATTT *
14108383-T-TA 11987677-T-TA *
14073222-A-T 11952516-A-T YY*
15797620-A-AAATATGTTCTCGAATACCTGTTG 13685740-A-AAATATGTTCTCGAATACCTGTTG *
15940641-A-G 13828761-A-G YY*
14024208-C-CAGATTTTTTGCTTTATGACAAAAAAGCAGATGGAAAAACTCTCTGAGAAAGTCTTCTTCTCCTTCTGGGGAAAGTATACCG 11903502-C-CAGATTTTTTGCTTTATGACAAAAAAGCAGATGGAAAAACTCTCTGAGAAAGTCTTCTTCTCCTTCTGGGGAAAGTATACCG *
17705897-A-C 15594017-A-C YY*
18217520-T-TAATC 16105640-T-TAATC *
18217517-T-TTAGCAG 16105637-T-TTAGCAG *
18217514-C-CTAGCA 16105634-C-CTAGCA *
18183665-G-GTACGGTGGCTGCGATTAAAAACTTTATGAAAAGCAGTTCGATTGTATGGCGCATTGTGCCGGTCGGCATCGTTGCGGCTTTAATCGGGGCGTTCGTCGGTGCGAAAGTCATTCTGATTCTGCCTGTGGAA 16071785-G-GTACGGTGGCTGCGATTAAAAACTTTATGAAAAGCAGTTCGATTGTATGGCGCATTGTGCCGGTCGGCATCGTTGCGGCTTTAATCGGGGCGTTCGTCGGTGCGAAAGTCATTCTGATTCTGCCTGTGGAA *
18063477-G-GTATGGAAAGGATAATGGTTATAACCCCCTTTCATATCAGGATTTCCAAAATAGATGTATGGAATATTGGGGGCTCTCCCTGCATAAAGAGCCCAAAGATTATGTTCTCAGCATAGGA 15951597-G-GTATGGAAAGGATAATGGTTATAACCCCCTTTCATATCAGGATTTCCAAAATAGATGTATGGAATATTGGGGGCTCTCCCTGCATAAAGAGCCCAAAGATTATGTTCTCAGCATAGGA *
18034099-T-TAATCGGTTCCTTCACGTAAAATGACGCTTTCCACAATATTGATTAAAG 15922219-T-TAATCGGTTCCTTCACGTAAAATGACGCTTTCCACAATATTGATTAAAG *
18008676-G-GTTT 15896796-G-GTTT P7_Dst 11×T*
17920935-C-T 15809055-C-T YY*
17880724-G-GGATTATGTACGTGTACATCCGCTTGGGAGGGGCTATC 15768844-G-GGATTATGTACGTGTACATCCGCTTGGGAGGGGCTATC *
17880722-G-GC 15768842-G-GC *
17880718-T-TACAACAAACCAGCAGATCACGAAAGTCATAGCCAGCAGGGGTATAA 15768838-T-TACAACAAACCAGCAGATCACGAAAGTCATAGCCAGCAGGGGTATAA *
17711173-T-TTACCGTGAACACGAACAATCTTGGCAGGAATACCGACAACGGTCACATCACTCGGTACATCGGAGACGACGACCGCTCCCGCTC 15599293-T-TTACCGTGAACACGAACAATCTTGGCAGGAATACCGACAACGGTCACATCACTCGGTACATCGGAGACGACGACCGCTCCCGCTC *
17711170-G-GGCTCATCCT 15599290-G-GGCTCATCCT *
17705887-A-ACTTCTGG 15594007-A-ACTTCTGG *
16273916-C-CGA 14162036-C-CGA *
17705884-TAAA-T 15594004-TAAA-T *
17705878-CAAAG-C 15593998-CAAAG-C *
17705875-A-AG 15593995-A-AG *
17583247-C-T 15471367-C-T YY*
17475026-T-G 15363146-T-G YY*
17295798-G-GCACCTGGTCAACATGGTGCTCGTAAACCGCGTTTGTCTGACTATGGTAGTCAGTTACGTGAGAAACAAAAAGTTCGCCGTATGTACGGTATCTTAGAACGTCAGTTCCGTAACTATT 15183918-G-GCACCTGGTCAACATGGTGCTCGTAAACCGCGTTTGTCTGACTATGGTAGTCAGTTACGTGAGAAACAAAAAGTTCGCCGTATGTACGGTATCTTAGAACGTCAGTTCCGTAACTATT *
17143891-A-ATT,ATT 15032011-A-ATT,ATT 35×T*
17142872-G-GTCTACATCCCTGACCCGCCGCAAGCTCGTCGCCGGTGCAGCCTGGGCGGCACCCGTCGTCGCCGCCTCCGCAACCATCCCCTCCTACGCAGCGTCCGTCGCCGCTACGAACGACTGTAT 15030992-G-GTCTACATCCCTGACCCGCCGCAAGCTCGTCGCCGGTGCAGCCTGGGCGGCACCCGTCGTCGCCGCCTCCGCAACCATCCCCTCCTACGCAGCGTCCGTCGCCGCTACGAACGACTGTAT *
16819638-CAA-C 14707758-CAA-C 9×A*
16690962-T-TATCCGAGAAAAACGTTCCGCAGCAGGATGACCGAGAGAACAACGGCGATAAGGCGGAAA 14579082-T-TATCCGAGAAAAACGTTCCGCAGCAGGATGACCGAGAGAACAACGGCGATAAGGCGGAAA *
16690960-A-AGCCG 14579080-A-AGCCG *
16282398-C-CA,CAA 14170518-C-CA,CAA 24×A*
16273917-T-TGGTTGGGGTCCATATTGGCATGTATCTTGAATACAAAACCTGTAAAGCCCTTCTCATTGGGCTGTACTATCCGTACATCACTGGCTTTGGGTAGG 14162037-T-TGGTTGGGGTCCATATTGGCATGTATCTTGAATACAAAACCTGTAAAGCCCTTCTCATTGGGCTGTACTATCCGTACATCACTGGCTTTGGGTAGG *
14073216-A-T 11952510-A-T YY*
13868047-A-G 11747341-A-G *
18221184-C-CTTTT 16109304-C-CTTTT *
13485128-G-C 11329452-G-C *
13488831-C-CGCAA 11333155-C-CGCAA *
13488829-G-GCA 11333153-G-GCA *
13488609-T-C 11332933-T-C *
13488445-G-A 11332769-G-A *
13488444-G-C 11332768-G-C *
13488419-T-G 11332743-T-G *
13488269-G-T 11332593-G-T *
11332065-CCT- *
13487251-C-A 11331575-C-A *
13485344-A-AG 11329668-A-AG *
13485296-T-A 11329620-T-A *
13485182-G-A 11329506-G-A *
13485151-G-C 11329475-G-C *
13485099-A-C 11329423-A-C *
13489049-A-T 11333373-A-T *
13485075-C-G 11329399-C-G *
13484248-T-A 11328572-T-A *
13484126-G-T 11328450-G-T *
13483988-T-A 11328312-T-A *
13483960-C-G 11328284-C-G *
13483136-C-A 11327460-C-A *
13481833-C-T 11326157-C-T *
13481483-T-TTCATAAAATCAGTGATCAGTGCAGATATTTGTCCCAATGTCCCTATAGGCAGAGCTTAG 11325807-T-TTCATAAAATCAGTGATCAGTGCAGATATTTGTCCCAATGTCCCTATAGGCAGAGCTTAG *
13481426-G-T 11325750-G-T *
13481396-C-G 11325720-C-G *
13481128-T-A 11325452-T-A *
13481045-C-T 11325369-C-T BY86061 *
13481042-TC-T 11325366-TC-T *
13489047-G-C 11333371-G-C *
13489793-T-G 11334117-T-G *
13868045-A-C 11747339-A-C *
13722190-A-T 11566514-A-T *
13868035-GGAAAA-G 11747329-GGAAAA-G *
13852073-ACTGGAATGG-A 11731367-ACTGGAATGG-A *
13825606-T-A 11704900-T-A *
13825605-C-A 11704899-C-A *
13825603-G-A 11704897-G-A *
13825591-C-T 11704885-C-T *
13825590-C-A 11704884-C-A BY90694 *
13825588-G-C 11704882-G-C *
13825586-C-A 11704880-C-A FT328549 *
11662489-A-G *
11662481-G-C *
13734226-G-A 11578550-G-A *
13734091-AGAATGGAATG-A 11578415-AGAATGGAATG-A 8×GAATG*
11562862-A- *
11334127-C- *
13712781-A-T 11557105-A-T *
13704748-G-T 11549072-G-T *
13700999-GACAAGAACGTATTATATTTCAATGTAATTTATTCA-G 11545323-GACAAGAACGTATTATATTTCAATGTAATTTATTCA-G *
13693269-C-T 11537593-C-T *
13690696-T-G 11535020-T-G *
13690681-A-AT 11535005-A-AT *
13678400-AG-A 11522724-AG-A *
13678395-ACTGT-A 11522719-ACTGT-A *
13678379-GACTTGAATAC-G 11522703-GACTTGAATAC-G *
13616427-TAAA-T,TAAAA 11460751-TAAA-T,TAAAA 28×A*
13508997-G-A 11353321-G-A *
13494551-T-TATATATATATGTA 11338875-T-TATATATATATGTA *
11334129-C- *
18217521-G-GCTAATGCGTTCGGCTCCAGGCTTGCCTTGAATGTTGTTGCGCATCATGCCAATTTGGCCAGGAAGGTCAACGATTGTAACCTGTACATTGTTAGAATGGTTAAC 16105641-G-GCTAATGCGTTCGGCTCCAGGCTTGCCTTGAATGTTGTTGCGCATCATGCCAATTTGGCCAGGAAGGTCAACGATTGTAACCTGTACATTGTTAGAATGGTTAAC *
18221188-G-GTGAAACGTCCAACCCCCGATGCGCGATGCAACAGCCCAAACTGGCCTTCATACCCCATCATTATGCCGTCAAAACGTCACTTTTTCGCGCAAAAAGTTGTACTTTTGTA 16109308-G-GTGAAACGTCCAACCCCCGATGCGCGATGCAACAGCCCAAACTGGCCTTCATACCCCATCATTATGCCGTCAAAACGTCACTTTTTCGCGCAAAAAGTTGTACTTTTGTA *
13479649-C-T 11323973-C-T *
22938101-A-AGTTTTGTGTACACCCCTAGCTTGTACACGTTGTTTTCGTCACGTGGTCTGCGGTGGCGCAGTTG 20776215-A-AGTTTTGTGTACACCCCTAGCTTGTACACGTTGTTTTCGTCACGTGGTCTGCGGTGGCGCAGTTG *
24895704-T-G 22749557-T-G g1 *
24420879-A-ATT,ATT 22274732-A-ATT,ATT 43×T*
24387086-C-A 22240939-C-A *
24149056-T-C 22002909-T-C P3_b1 *
23975824-G-GGTCAACATAAAGCTCTAAGGCTACTTTACGACCACTTTTTGTCGTAAAAGTATCTTGTAATAAATCAAAATCACCCGCCACTAAAGCGAATAGATA 21829677-G-GGTCAACATAAAGCTCTAAGGCTACTTTACGACCACTTTTTGTCGTAAAAGTATCTTGTAATAAATCAAAATCACCCGCCACTAAAGCGAATAGATA *
23975821-G-GCGCGATCAAGATTGCC 21829674-G-GCGCGATCAAGATTGCC *
23975819-C-CGA 21829672-C-CGA *
23975815-G-GC 21829668-G-GC *
23763883-G-GATTGCAACGACAATAATGATAATCGCTATGATTTGTGGAATATTCGACTGTGGATATTCTATACTATTAGTTGGATGCATGTGATGATAAATTGCAGGAGATAGAGCTATCATCATCATGGTATATAA 21601997-G-GATTGCAACGACAATAATGATAATCGCTATGATTTGTGGAATATTCGACTGTGGATATTCTATACTATTAGTTGGATGCATGTGATGATAAATTGCAGGAGATAGAGCTATCATCATCATGGTATATAA *
23748022-A-ATCGACGGCGTCGACGTCGGCTCCCTGTCCGACGCCAAGCTCTCGGCCCTGCG 21586136-A-ATCGACGGCGTCGACGTCGGCTCCCTGTCCGACGCCAAGCTCTCGGCCCTGCG *
23401061-G-GGAATACGGTCCTACACCTGGCTTGGGAATTATTCCGGGCACTGTGAAAGTCATTCCCAGTGATTTAGGCCTGCGCGTTCCTCATA 21239175-G-GGAATACGGTCCTACACCTGGCTTGGGAATTATTCCGGGCACTGTGAAAGTCATTCCCAGTGATTTAGGCCTGCGCGTTCCTCATA *
23365410-A-AACCACCCTGAAACCGCCCCACTATTACAGGCTATATCCCAACTCAGCCACCTGCTTTTTCATCGCCTCATCATTGCATCTGCC 21203524-A-AACCACCCTGAAACCGCCCCACTATTACAGGCTATATCCCAACTCAGCCACCTGCTTTTTCATCGCCTCATCATTGCATCTGCC *
23069077-T-TTCCGTGAAGTTCTGCTGGCTGAAACTGGCGGACGCGGCGCTGACTACATCCTCGACGTCGTGGGCGGAAAGTACCTGGACGACAATCTGCACA 20907191-T-TTCCGTGAAGTTCTGCTGGCTGAAACTGGCGGACGCGGCGCTGACTACATCCTCGACGTCGTGGGCGGAAAGTACCTGGACGACAATCTGCACA *
22938099-A-AGGTGTTTTCCTGTTCGGGCTCTGTGTG 20776213-A-AGGTGTTTTCCTGTTCGGGCTCTGTGTG *
25651212-G-T 23505065-G-T P1_b3 *
22938096-T-TACTCTTGCGGTGG 20776210-T-TACTCTTGCGGTGG *
22854879-A-ATCCGCTAATGCGACCGCACTTGCAACGAGTGATTTTGGTAATTCATCGCCGGCAAAGCGAGGCATATATTGTTCGTTTAATGCCACCGCTACTTCTTCATCTTCACCATCAT 20692993-A-ATCCGCTAATGCGACCGCACTTGCAACGAGTGATTTTGGTAATTCATCGCCGGCAAAGCGAGGCATATATTGTTCGTTTAATGCCACCGCTACTTCTTCATCTTCACCATCAT *
22812861-T-TCGAGCGGGCCACCCACCTGGCACGCGACATGGTC 20650975-T-TCGAGCGGGCCACCCACCTGGCACGCGACATGGTC *
22812859-A-AACGAGATGACCACGGGTGCCTCCAACGAC 20650973-A-AACGAGATGACCACGGGTGCCTCCAACGAC *
22812855-T-TGCTCTTCGGTGGCCGCATTGCCGAAGAGGTGTTC 20650969-T-TGCTCTTCGGTGGCCGCATTGCCGAAGAGGTGTTC *
22812852-T-TCTC 20650966-T-TCTC *
22785275-T-TTTATTTTATCGTTTAATTGTCATAATGCACAAAAAAAAATAATATGAAATCAAATGAAAGAATTGTTTATGCTTTA 20623389-T-TTTATTTTATCGTTTAATTGTCATAATGCACAAAAAAAAATAATATGAAATCAAATGAAAGAATTGTTTATGCTTTA *
22685325-G-GCGCTTTAAAACGGCATGTTACAGATTTTATTTATTCTGATGGGCAGCAATCAAAAGGCCGTCTGAAAACAGGTTTTCAGACGGCCTTTATT 20523439-G-GCGCTTTAAAACGGCATGTTACAGATTTTATTTATTCTGATGGGCAGCAATCAAAAGGCCGTCTGAAAACAGGTTTTCAGACGGCCTTTATT *
22657035-A-AG 20495149-A-AG *
22657032-C-T 20495146-C-T YY*
22657031-T-TA 20495145-T-TA *
22657029-T-TAGATGA 20495143-T-TAGATGA *
22657025-C-CTATCAAAATCACTTTAAAGAAGTCA 20495139-C-CTATCAAAATCACTTTAAAGAAGTCA *
24895705-A-T 22749558-A-T g1 *
28554022-G-C 26407875-G-C *
22510920-C-G 20349034-C-G DYZ19 *
56742335-T-C *
28303-A-G *
27484-T-G *
13587-A-T *
56834772-T-TCCAGTCCATTCCATTACATTCCAC *
56831485-C-CTCCACTCCACTCCATTCCATTCCA *
56761633-G-A *
56758770-C-A *
56756510-C-T *
56756503-G-A *
56747429-A-T *
56747428-C-A *
56744297-T-G *
56744041-C-T *
56742329-A-T *
28778852-C-CT,CTTT 26632705-C-CT,CTTT 33×T*
56741388-G-C *
56741382-G-T *
56740198-G-T *
56737508-T-A *
56737502-A-G *
56716187-T-A *
56716047-G-T *
56714460-T-A *
28818360-G-GGGGTTGAGTGGAATGGCGTGGAATGGAATGGGATGAATC 26672213-G-GGGGTTGAGTGGAATGGCGTGGAATGGAATGGGATGAATC *
28816455-T-C 26670308-T-C *
28801178-C-CGAATA 26655031-C-CGAATA *
28793223-T-C 26647076-T-C *
28785785-T-TCAACCCGAGTGCAGG 26639638-T-TCAACCCGAGTGCAGG *
22657021-T-A 20495135-T-A YY*
22510915-C-T 20349029-C-T DYZ19 *
18248756-A-ACTCTAAATTC 16136876-A-ACTCTAAATTC *
19440483-T-TAATTCAAGGTAATCCAATTGCAGACTATCAAGCTGCACA 17328603-T-TAATTCAAGGTAATCCAATTGCAGACTATCAAGCTGCACA *
21553439-GC-G 19391553-GC-G *
21553436-G-T 19391550-G-T Y*
21553434-TG-T 19391548-TG-T *
21531475-T-TCGTTTTGATAGTGGAGAAGTTAAAGGGCATCCTGTTGGAAACCTAATGA 19369589-T-TCGTTTTGATAGTGGAGAAGTTAAAGGGCATCCTGTTGGAAACCTAATGA *
21490373-A-ATT 19328487-A-ATT 15×T*
21454564-C-CGTGGGTCTTGGCCGCAAGCATACCCGTGGCGATGGGTCGCGAGAACTCGGTAGACGAGCCAGAGACGTAAACGCCAGCAGGAACGTTTTCAACGGGGTCGAA 19292678-C-CGTGGGTCTTGGCCGCAAGCATACCCGTGGCGATGGGTCGCGAGAACTCGGTAGACGAGCCAGAGACGTAAACGCCAGCAGGAACGTTTTCAACGGGGTCGAA *
21133193-G-GAGTGCAAGGCCCTTGAGGTACGTACCCGTGCTTACTTCAGAGAAGAGTGCGGTGCTACGGCAGCCATCCTCGGCGATATCCTC 18971307-G-GAGTGCAAGGCCCTTGAGGTACGTACCCGTGCTTACTTCAGAGAAGAGTGCGGTGCTACGGCAGCCATCCTCGGCGATATCCTC *
21076346-A-AGTTACATAAATCATCACTCTCAAATTCTGATATTTCACCTGCAACTTTATTCGGAATTGGGAATAAGCGTACAGTTAGTGGTTTATTTAAGCGAAATGCCATTGTTCCTG 18914460-A-AGTTACATAAATCATCACTCTCAAATTCTGATATTTCACCTGCAACTTTATTCGGAATTGGGAATAAGCGTACAGTTAGTGGTTTATTTAAGCGAAATGCCATTGTTCCTG *
21076344-A-AAAGGCGG 18914458-A-AAAGGCGG *
20815177-T-TTAGCCTATACCATCTTTGCGAGTATCCAAAAACTCATATTTGATACTGAGAACCCACTGAAAAATGCACAAAAATATGGTCCTTACTA 18653291-T-TTAGCCTATACCATCTTTGCGAGTATCCAAAAACTCATATTTGATACTGAGAACCCACTGAAAAATGCACAAAAATATGGTCCTTACTA P4_Gap *
19663298-CGTGTGT-C,CGTGT 17551418-CGTGTGT-C,CGTGT P5_Prx 17×GT*
19481029-T-TTGAGCAACGCCGAGCACCTCAAGTGCGCTCCCACGTTGCGGTGAGTTCGTTGTGTGCGGCGAGTTCTCCGTTGAAAAACAAGTCATAGCGGAGCTCGATCAAGCCGCGTCGGTCGTC 17369149-T-TTGAGCAACGCCGAGCACCTCAAGTGCGCTCCCACGTTGCGGTGAGTTCGTTGTGTGCGGCGAGTTCTCCGTTGAAAAACAAGTCATAGCGGAGCTCGATCAAGCCGCGTCGGTCGTC *
19440487-C-CTATAAAGAAGGCAAATCTAACCCTGCGGTCGATTGTTTAAATGCGATGAATTATGA 17328607-C-CTATAAAGAAGGCAAATCTAACCCTGCGGTCGATTGTTTAAATGCGATGAATTATGA *
19440482-A-ACC 17328602-A-ACC *
21621641-C-CCGGG 19459755-C-CCGGG *
19380466-A-AGAATTAGTAAATAACACTTCCATACCTATAAAAACAATTTTATTATATTGTCTTCCAGCTACAGCACTATCAAT 17268586-A-AGAATTAGTAAATAACACTTCCATACCTATAAAAACAATTTTATTATATTGTCTTCCAGCTACAGCACTATCAAT *
19380465-T-TC 17268585-T-TC *
19138488-A-AAT 17026608-A-AAT *
19130738-C-CTTTTT 17018858-C-CTTTTT 33×T*
19002998-A-ATCCCGCATACCTACTTATAGTACATATTTCTCTTCCTGTGAATCCATTGACTAATCCCTCTGGTTCGTCTAT 16891118-A-ATCCCGCATACCTACTTATAGTACATATTTCTCTTCCTGTGAATCCATTGACTAATCCCTCTGGTTCGTCTAT *
19002995-C-CCGAGAGCTGAGAGCT 16891115-C-CCGAGAGCTGAGAGCT *
18785104-T-TTCCAAGAACCCCTTGGCAGCCGCCTTCGGAACTTCGATAACAGAACACTTCCTTGCTGGTATCTTCTCTGGTGAAGCACCAAGCATGGATTCAATCATGGATGAGACCGTATCCCATCTGGTGATG 16673224-T-TTCCAAGAACCCCTTGGCAGCCGCCTTCGGAACTTCGATAACAGAACACTTCCTTGCTGGTATCTTCTCTGGTGAAGCACCAAGCATGGATTCAATCATGGATGAGACCGTATCCCATCTGGTGATG *
18742022-C-CTATACCTGCATACCAACCTGTTGATTCCCCAAGTCTTACAGTTTCATCTTCATGAACATAAGCAACTCCATAA 16630142-C-CTATACCTGCATACCAACCTGTTGATTCCCCAAGTCTTACAGTTTCATCTTCATGAACATAAGCAACTCCATAA *
18410598-T-TTTGGATCGGCTTTAATTGGGCTTTTCACGCCGTCCATGACCACGTCTTCTGGCAGGATAATCGGTAAATCTTCGATTGGTGCCGGTACGGTTTCACCGTTTGGCAAGGTCAGCATTGGA 16298718-T-TTTGGATCGGCTTTAATTGGGCTTTTCACGCCGTCCATGACCACGTCTTCTGGCAGGATAATCGGTAAATCTTCGATTGGTGCCGGTACGGTTTCACCGTTTGGCAAGGTCAGCATTGGA P6_Gap *
18398218-TATATAC-T 16286338-TATATAC-T P6_Gap *
18398208-T-C 16286328-T-C P6_Gap *
18398202-T-C 16286322-T-C P6_Gap *
18248757-G-GCCTTGGCGCAACACCCTTGGTATGAGCCTATGCGCAATGTTCAAGCTTATGCCAAAGAAGATAGCCTAAATATCATCACCCCTAAAATAGGGGAAGTTATAC 16136877-G-GCCTTGGCGCAACACCCTTGGTATGAGCCTATGCGCAATGTTCAAGCTTATGCCAAAGAAGATAGCCTAAATATCATCACCCCTAAAATAGGGGAAGTTATAC *
21575219-C-CT,CTTTTT 19413333-C-CT,CTTTTT *
21621643-A-ATCATT 19459757-A-ATCATT *
22510896-C-G 20349010-C-G DYZ19 *
22341536-A-T 20179650-A-T DYZ19 *
22509128-C-G 20347242-C-G DYZ19 *
22508303-T-G 20346417-T-G DYZ19 *
22508079-A-G 20346193-A-G DYZ19 *
22507939-G-T 20346053-G-T DYZ19 *
22506234-C-G 20344348-C-G DYZ19 *
22475327-G-A 20313441-G-A BY155319 DYZ19 *
22459727-CGTTG-C 20297841-CGTTG-C DYZ19 *
22446570-G-A 20284684-G-A DYZ19 *
22445127-T-A 20283241-T-A DYZ19 *
22445121-C-A 20283235-C-A DYZ19 *
22445117-G-T 20283231-G-T BY32574 DYZ19 *
22359417-T-C 20197531-T-C DYZ19 *
22346810-C-A,G 20184924-C-A,G DYZ19 *
22316250-A-G 20154364-A-G DYZ19 *
21621649-A-AAACAC 19459763-A-AAACAC *
22295144-CCTTTTGGCAGGTACA-C 20133258-CCTTTTGGCAGGTACA-C DYZ19 *
22254864-G-T 20092978-G-T BY58 DYZ19 *
22115454-TTTTTTGTTTTTTTG-T 19953568-TTTTTTGTTTTTTTG-T *
22115453-TTTTTTTGTTTTTTTG-T 19953567-TTTTTTTGTTTTTTTG-T *
21868554-T-TTGGGATCGTCGTAATTTCTATTACTATCAAATGCTTACCTCGTTAGCGAAACATTATAAATTTGATATTGAAACGCCATACGAAGATTTGCCACAAAAAATTAAAGATATTGTGATGCACGGTTCAG 19706668-T-TTGGGATCGTCGTAATTTCTATTACTATCAAATGCTTACCTCGTTAGCGAAACATTATAAATTTGATATTGAAACGCCATACGAAGATTTGCCACAAAAAATTAAAGATATTGTGATGCACGGTTCAG *
21819858-T-TACGAACATTTGTTTTCATAGTTATTCATAG 19657972-T-TACGAACATTTGTTTTCATAGTTATTCATAG *
21714805-T-A 19552919-T-A YY*
21714801-ATTG-A 19552915-ATTG-A *
21664515-C-CTACTTTCGACGGCTACGCCGTAGTCGCGGGCAAAGTTGCTGCGGAAGGTGGAGAGGGAGACGACGTTGTCCAA 19502629-C-CTACTTTCGACGGCTACGCCGTAGTCGCGGGCAAAGTTGCTGCGGAAGGTGGAGAGGGAGACGACGTTGTCCAA *
21638272-C-CGCCTTTATTTCGCTTTCCGAAAACTTGTTTCTTCCCATTCAATTATTGTTTAAAAACACCTCTAAAAAATAACGATGCCTTATA 19476386-C-CGCCTTTATTTCGCTTTCCGAAAACTTGTTTCTTCCCATTCAATTATTGTTTAAAAACACCTCTAAAAAATAACGATGCCTTATA *
21638269-G-GCT 19476383-G-GCT *
21638267-G-GAAGTTT 19476381-G-GAAGTTT *
21621652-C-CAACTGCCATTGTGATCCACGGACGACCAATTGGTTTACGGTAAACATCATCA 19459766-C-CAACTGCCATTGTGATCCACGGACGACCAATTGGTTTACGGTAAACATCATCA *
13480627-C-T 11324951-C-T *
13479580-T-G 11323904-T-G *
8181213-T-TTTTTG 8313172-T-TTTTTG *
10850935-A-C *
10917363-T-C *
10914505-T-A *
10910931-C-T *
10909811-A-AGG *
10909791-G- *
10909775-T-A *
10909768-A-G *
10906054-G-T *
10906045-GA-G *
10906044-A-T *
10906033-T-A *
10903734-A-G *
10876034-T-C *
10850927-T-C *
10932775-C-CATT *
10850922-C-T *
10846994-ATTCTAATCCACTAGATTT-A *
10846987-C-G *
10846957-TCACTCCACTCAAA-T *
10846927-CCGATCCACTCCACTCAACTCCCCTCCA-C *
10846894-TTTTC-T *
10846879-TCTCC-T *
10846876-TCC-T *
10846871-TCCAC-T *
10821998-ACTCCAATTCACTCCACTCTCATTCACTCCC-A *
10821993-A-AG *
10821984-TTCTATTC-T *
10821981-C-CA *
10917365-T-C *
10932776-C-CTA *
10814018-C-T *
11001422-C-CACTCAACTCCACTCCATTTCACTCT *
11030322-CGG-C *
11030318-T-TCC *
11026130-A-AACT *
11026128-A-ATTCCGTTCCTTTACGT *
11025354-CAATCTCAGCTCACATTTCATTGAACAATACCATCCATTTCAT-C *
11020289-A-T *
11010346-C-T *
11010322-CTAATTCCAATCCACT-C *
11005451-TC-T *
11001509-A-AAAG *
11001504-GGC-G *
11001433-A-ATTACATTCCG *
11001426-C-CCATTTCACTTTGCTCCATTCCATTA *
11001412-C-CATTCCATCCGGTTCCATTAG *
10932796-A-C *
11001400-T-TGCACTCCACA *
10998101-C-CTCCATTCCATTGCACTCGGGTTGAT *
10989144-T-TTCCACTCCACTCCATTCCACTCCACTCCACTCCATTCCACTCCACTTCACTCCATTTCAC *
10979592-C-T *
10969315-A- *
10969314-C- *
10954320-T-TTG *
10954315-CCA-C *
10934891-TCA-T *
10932815-A-G *
10932814-C-T *
10932808-T-G *
10932801-T-A *
10821968-ATTCCATTCCC-A *
10814016-G-T *
13222050-GGT-G 11066374-GGT-G *
9304467-T-G 9466858-T-G Y*
9909220-A-G 10071611-A-G Y*
13488604-G-C 11332928-G-C *
9780396-G-A 9942787-G-A Y*
9758306-T-G 9920697-T-G Y*
9643332-CA-C 9805723-CA-C IR3_Prx 9×A*
9483715-G-GCCGAGCAGCTCATCATAGGAAGTACCAGCATTGTAACCAACCGACTACGTTTACTCTCAATAGTTCGGGTAGCCATTAC 9646106-G-GCCGAGCAGCTCATCATAGGAAGTACCAGCATTGTAACCAACCGACTACGTTTACTCTCAATAGTTCGGGTAGCCATTAC *
9483712-G-GAAGTC 9646103-G-GAAGTC *
9397740-AACC-A 9560131-AACC-A *
9397728-T-TGATGTCATCC 9560119-T-TGATGTCATCC *
9361369-A-T 9523760-A-T Y*
9361090-A-ACCCC 9523481-A-ACCCC *
9330869-CAT-C 9493260-CAT-C *
13472620-T-C 11316944-T-C *
9304459-G-GGGGGGGGGGGCC 9466850-G-GGGGGGGGGGGCC *
9924451-TC-T 10086842-TC-T *
9304445-A-AGGG 9466836-A-AGGG *
9181191-G-T 9343582-G-T Y*
8901076-C-CAT,T 9033035-C-CAT,T 15×AT*
8895195-A-AAATTGTAGAAAATAAGGAAGAACAAAAACAAGCACGTCTAGCCTTGAAACCTAACAGAATGGAGGATATAGAGATATT 9027154-A-AAATTGTAGAAAATAAGGAAGAACAAAAACAAGCACGTCTAGCCTTGAAACCTAACAGAATGGAGGATATAGAGATATT *
8663077-T-TTATACGCGCTTATGCCATCTGTATGATGTTACAAGGGCACTTTATTACTGCCCTACTCGCTGAACAATATTGTGACGAAAGTAATCCTTAC 8795036-T-TTATACGCGCTTATGCCATCTGTATGATGTTACAAGGGCACTTTATTACTGCCCTACTCGCTGAACAATATTGTGACGAAAGTAATCCTTAC *
8654714-T-TTGCCACGCGAGGGGCCTATCGTGATGGAGTTCTAACAGAGGAAGGAGCAGAAATCTTCTATCTCTGGACGAGTTTTGAAAATATGCTTCGCGA 8786673-T-TTGCCACGCGAGGGGCCTATCGTGATGGAGTTCTAACAGAGGAAGGAGCAGAAATCTTCTATCTCTGGACGAGTTTTGAAAATATGCTTCGCGA *
8588757-T-TTATTGCTATCAATGATTTTCCGCTGGCAGATGTGGCAGCGCCTATTTTCAGTGCGGAGCAAGTTCAGACGGCTTTCAGAGAGGGAGCATCCTATGAG 8720716-T-TTATTGCTATCAATGATTTTCCGCTGGCAGATGTGGCAGCGCCTATTTTCAGTGCGGAGCAAGTTCAGACGGCTTTCAGAGAGGGAGCATCCTATGAG *
8588754-A-AAGCTT 8720713-A-AAGCTT *
8528777-C-CCAAGGGCCGACAGAGCTGATCTATGATGATATGGATAAGGGAGCGGAGGAGCTATTGGCTTATGTCCATACTCGTCGGTACTTGGATGATAGTTCTTGGATAGAGCCT 8660736-C-CCAAGGGCCGACAGAGCTGATCTATGATGATATGGATAAGGGAGCGGAGGAGCTATTGGCTTATGTCCATACTCGTCGGTACTTGGATGATAGTTCTTGGATAGAGCCT *
8528775-T-TGCAG 8660734-T-TGCAG *
8371537-T-TCTGACGGAACTGAACAGAATCGGGCAACTGTTCTTTGTTTAATACACG 8503496-T-TCTGACGGAACTGAACAGAATCGGGCAACTGTTCTTTGTTTAATACACG *
8371535-T-TTTGTAGCTGCTGCGACTTGA 8503494-T-TTTGTAGCTGCTGCGACTTGA *
8210304-G-GGTACAGGTAAAGAATTGGCACGTCGTAACTACGTACCAGGACAACACGGACCAAACAACCGTTCTAAATTGTCAGAATACGGTT 8342263-G-GGTACAGGTAAAGAATTGGCACGTCGTAACTACGTACCAGGACAACACGGACCAAACAACCGTTCTAAATTGTCAGAATACGGTT *
9910061-C-T 10072452-C-T Y*
10086843-CAGTGTGCTCCAAATATCCACTTGCAGATTCTATAAAAAGAGTGTTTCCAAACTGCTCAATCAAATG- *
10805384-C-T *
10600059-A-C *
10805371-A-T *
10805361-A-C *
10791005-A-T *
10771851-C-G *
10756202-C-CATTCCATTCCATTCCATTGCACTCCCCTGCACTCCATTGCATTCCACTGCGTTCCATTCCATTCT *
10691416-C-T *
10691404-C-CTCTAA *
10691398-A-G *
10663721-C-T *
10663719-C-CTCGGGTTG *
10657417-T-TATCAGTGTAC *
10627170-C-G *
10627164-T-TTC *
10600056-C-T *
9924453-AGTG-A 10086844-AGTG-A *
10600055-G-T *
10600051-C-G *
10600049-A-T *
10600045-T-G *
10600044-C-T *
10600015-G-C *
10600007-G-T *
10056378-C-A 10218769-C-A *
10004479-C-CAA 10166870-C-CAA *
9927904-C-CTGTTCGGTGTCCATATAGACGACGGTGCCGGGCCAGGTGCGACCGCGGGAGTCCTGCACGACGGGGGAGGTCACGCCGGCGACCACGTGGGCGTTGGTGACGACCAGGCCGTTAT 10090295-C-CTGTTCGGTGTCCATATAGACGACGGTGCCGGGCCAGGTGCGACCGCGGGAGTCCTGCACGACGGGGGAGGTCACGCCGGCGACCACGTGGGCGTTGGTGACGACCAGGCCGTTAT *
9924500-C-T 10086891-C-T Y*
9924459-C-CGA 10086850-C-CGA *
9924457-T-TAA 10086848-T-TAA *
13194499-TCATTC-T,T 11038823-TCATTC-T,T 4×CATTC*
13222078-AGGGG-A 11066402-AGGGG-A *
13479289-T-C 11323613-T-C *
13472028-A-T 11316352-A-T *
13477013-G-A 11321337-G-A *
13477012-A-G 11321336-A-G *
13477001-G-T 11321325-G-T *
13476989-C-A 11321313-C-A *
13476924-C-T 11321248-C-T *
13476671-C-A 11320995-C-A *
13475073-G-A 11319397-G-A *
13474647-C-G 11318971-C-G *
13474619-G-A 11318943-G-A *
13474572-G-A 11318896-G-A *
13474538-C-G 11318862-C-G *
13472606-G-T 11316930-G-T *
11316447-G- *
13471237-C-T 11315561-C-T *
13477026-T-TGGG 11321350-T-TGGG *
13471226-G-A 11315550-G-A *
11315386-TGGAACA- *
13470917-C-CGCCTGTATCATAAA 11315241-C-CGCCTGTATCATAAA *
13470472-TGGCTGTCCGGGCAGGCCTCCTGGCTGCACCTGCCGCA-T 11314796-TGGCTGTCCGGGCAGGCCTCCTGGCTGCACCTGCCGCA-T *
13470404-C-T 11314728-C-T *
13470362-C-G 11314686-C-G *
13470348-CA-C 11314672-CA-C *
13470316-C-T 11314640-C-T *
13470314-A-G 11314638-A-G *
13470301-C-G 11314625-C-G *
13470294-C-A 11314618-C-A *
13470234-C-A 11314558-C-A *
13470180-C-G 11314504-C-G *
13477021-T-C 11321345-T-C *
13477029-GTCA-G 11321353-GTCA-G *
13468950-TTATATCACTTAGATGATCAGTGCAGAGATATGTCACAATACCCCTTGTAAGCAGAGCCTAGAGAAGA-T 11313274-TTATATCACTTAGATGATCAGTGCAGAGATATGTCACAATACCCCTTGTAAGCAGAGCCTAGAGAAGA-T *
13477782-T-C 11322106-T-C *
13479079-C-G 11323403-C-G *
13478867-C-CACAAA 11323191-C-CACAAA *
11323181-G- *
11323176-G- *
11323174-A- *
13478847-C-T 11323171-C-T *
13478832-CA-C 11323156-CA-C *
13478769-G-C 11323093-G-C *
13478762-T-G 11323086-T-G *
11323082-CGG- *
13478757-GC-G 11323081-GC-G *
13478755-G-GC 11323079-G-GC *
13478746-A-T 11323070-A-T *
13477780-A-ACCTG 11322104-A-ACCTG *
13477035-CTGTT-C 11321359-CTGTT-C *
13477582-C-G 11321906-C-G *
11321818-A- *
13477439-A-T 11321763-A-T *
13477419-G-C 11321743-G-C *
13477357-C-T 11321681-C-T *
13477349-A-G 11321673-A-G *
13477333-C-T 11321657-C-T *
13477330-G-T 11321654-G-T *
13477287-G-A 11321611-G-A *
13477175-G-C 11321499-G-C *
13477095-T-A 11321419-T-A *
13477046-C-T 11321370-C-T *
13477040-A-ATTCC 11321364-A-ATTCC *
13469274-C-T 11313598-C-T *
13468946-ATT-A 11313270-ATT-A *
13222419-C-A,A 11066743-C-A,A *
13457881-CATTCTA-C 11302205-CATTCTA-C *
13462542-C-CCTCTCTCTGCCCGTGTCCATCTGTGAAATTCCGGCCGGGGCTCCTCGCGA 11306866-C-CCTCTCTCTGCCCGTGTCCATCTGTGAAATTCCGGCCGGGGCTCCTCGCGA *
13462540-C-CAGGG 11306864-C-CAGGG *
13462397-C-CAG 11306721-C-CAG *
13462393-CGT-C 11306717-CGT-C *
13462332-C-CT 11306656-C-CT *
13462329-C-CT 11306653-C-CT *
13461347-T-C 11305671-T-C *
13458955-CCATTGTGTTCCATTT-C 11303279-CCATTGTGTTCCATTT-C *
13457982-GTTCC-G 11302306-GTTCC-G *
13457977-GTTCC-G 11302301-GTTCC-G *
13457949-TCCACTCCACTCCACTCCACTCCACTC-T 11302273-TCCACTCCACTCCACTCCACTCCACTC-T *
13457944-TCA-T 11302268-TCA-T *
13457897-GGTTTA-G 11302221-GGTTTA-G *
13457877-A-G 11302201-A-G *
11307000-G- *
13453402-TCCTATCCATTCTATTTCATG-T 11297726-TCCTATCCATTCTATTTCATG-T *
13450931-CATTCT-C,TATTCT 11295255-CATTCT-C,TATTCT *
11294938-C- *
11294919-ATTCC- *
13449384-C-CCA 11293708-C-CCA *
11291908-T- *
11291904-ATTGTAT- *
13436191-T-A 11280515-T-A *
13395119-T-C 11239443-T-C *
13377635-G-A 11221959-G-A *
13362607-T-C 11206931-T-C *
13263168-C-A 11107492-C-A *
13222420-T-G,G 11066744-T-G,G *
13462546-C-CCCTCCCGATACCTTCGGACGGCAACCTCCAAGCGGAAGCCCTGGGACATGGGAGCCCGCCGACCT 11306870-C-CCCTCCCGATACCTTCGGACGGCAACCTCCAAGCGGAAGCCCTGGGACATGGGAGCCCGCCGACCT *
13462990-T-A 11307314-T-A *
13466670-G-GTC 11310994-G-GTC *
13464121-G-C 11308445-G-C *
13466662-GTCACAA-G 11310986-GTCACAA-G *
13466628-A-T 11310952-A-T *
13466608-GTA-G 11310932-GTA-G *
13466606-C-CG 11310930-C-CG *
13466603-TC-T 11310927-TC-T *
13466598-C-T 11310922-C-T *
13465362-T-A 11309686-T-A *
13465332-G-A 11309656-G-A *
13465151-C-G 11309475-C-G *
13464656-A-T 11308980-A-T *
13464505-T-G 11308829-T-G *
13464146-G-GGAGCAT 11308470-G-GGAGCAT *
13464128-A-C 11308452-A-C *
11308441-A- *
13462997-G-A 11307321-G-A *
13464116-TA-T 11308440-TA-T *
13464114-G-GGA 11308438-G-GGA *
13464111-C-CT 11308435-C-CT *
13464100-CTG-C 11308424-CTG-C *
13464070-C-G 11308394-C-G FT443980 *
13464053-C-A 11308377-C-A *
13464046-T-A 11308370-T-A *
13463925-G-A,T 11308249-G-A,T *
13463751-C-T 11308075-C-T *
11307879-G- *
13463548-C-A 11307872-C-A *
11307857-A- *
13463501-G-A 11307825-G-A *
13463498-C-T 11307822-C-T FT285481 *
13488721-T-C 11333045-T-C *
10808037-A-C *
13488296-A-G 11332620-A-G *
13469897-G-A 11314221-G-A *
10022129-A-G 10184520-A-G Y*
10805372-C-T *
10669371-T-C *
27390-G-T *
23793697-T-A 21631811-T-A Y*
23793696-C-A 21631810-C-A Y*
23793682-G-T 21631796-G-T Y*
23793669-T-G 21631783-T-G Y*
13477695-T-C 11322019-T-C *
10750070-C-A *
10976202-C-T *
13466693-C-A 11311017-C-A *
10906050-C-A *
13696900-G-A 11541224-G-A *
13462525-T-A 11306849-T-A *
10655881-A-T *
11011947-C-CTTTAT *
10914456-G-A *
13482935-C-A 11327259-C-A *
10971589-C-T *
11011951-A-G *
10928066-T-A *
9943708-C-A 10106099-C-A Y*
13488064-C-A 11332388-C-A *
13470405-A-T 11314729-A-T *
10850837-T-A *
13461857-G-C 11306181-G-C *
13463539-C-A 11307863-C-A *
11662475-G-T *
10022132-A-G 10184523-A-G Y*
13462151-C-A 11306475-C-A *
13489522-G-A 11333846-G-A *
13463790-G-T 11308114-G-T *
10883414-G-C *
10906036-T-C *
10827937-T-G *
13486507-C-T 11330831-C-T *
15428337-CTT-C 13316457-CTT-C 10×T*
10912537-G-A *
23789324-GTTT-G 21627438-GTTT-G 13×T*
24157205-G-A 22011058-G-A P3_b1 *
13460946-G-C 11305270-G-C *
13478266-G-C 11322590-G-C *
22316240-T-A 20154354-T-A DYZ19 *
13488614-C-A 11332938-C-A *
28807417-G-A 26661270-G-A *
13463766-A-AG 11308090-A-AG *
27287-G-A *
10787525-A-G *
17926601-G-C 15814721-G-C YY*
13464035-C-A 11308359-C-A *
10914506-C-T *
10028195-A-G 10190586-A-G Y*
10028176-G-A 10190567-G-A Y*
10028173-G-A 10190564-G-A Y*
10028171-T-A 10190562-T-A Y*
10028170-G-A 10190561-G-A Y*
10028154-G-A 10190545-G-A Y*
13722755-A-C 11567079-A-C *
13461777-T-C 11306101-T-C *
10984417-T-C *
22509503-C-A 20347617-C-A DYZ19 *
5426382-C-G 5558341-C-G *
13478778-TG-T 11323102-TG-T *
11662471-A-T *
9985006-G-A 10147397-G-A FT258147 Y*
13488514-G-A 11332838-G-A *
9916837-T-G 10079228-T-G Y*
58898263-C-G 56692608-G-C *
58887405-C-A 56703466-G-T 10×CCATT*
9962446-T-G 10124837-T-G Y*
13853650-A-G 11732944-A-G *
13462091-A-G 11306415-A-G *
28814583-T-A 26668436-T-A *
9992523-C-A 10154914-C-A Y*
22508376-G-A 20346490-G-A DYZ19 *
13846498-T-A 11725792-T-A *
13486559-A-T 11330883-A-T *
13486532-G-A 11330856-G-A *
13486615-T-A 11330939-T-A *
10846922-G-T *
13520266-G-A 11364590-G-A FGC26056 *
21698309-T-TA 19536423-T-TA 24×A*
13480695-C-A 11325019-C-A *
10043030-C-A 10205421-C-A S3055 *
10043028-T-A 10205419-T-A *
22635546-CCAG-C 20473660-CCAG-C *
13462929-A-T 11307253-A-T *
13803163-G-C 11682457-G-C A16245 *
13476807-C-T 11321131-C-T *
22288939-C-T 20127053-C-T DYZ19 *
22316227-A-T 20154341-A-T DYZ19 *
22476785-C-G 20314899-C-G FT459909 DYZ19 *
22510448-G-T 20348562-G-T DYZ19 *
58853472-G-A 56737399-C-T *
58904706-G-C 56686165-C-G *
10913601-T-G *
10850924-G-T *
10671048-T-C *
10827939-C-G *
13857868-A-G 11737162-A-G *
5204641-C-CAA 5336600-C-CAA 22×A*
10752977-C-A *
10805395-T-C *
16305924-C-CAA 14194044-C-CAA 24×A*
13466318-T-C 11310642-T-C *
10831517-ACTGCACTC-A *
10976195-A-C *
10976175-ACTCCG-A *
13488133-T-C 11332457-T-C *
10846867-T-G *
13480909-CT-C 11325233-CT-C *
28800450-G-A 26654303-G-A FT462156 *
10949635-T-C *
13487739-TCC-T 11332063-TCC-T *
13480183-T-A 11324507-T-A *
13460680-A-T 11305004-A-T *
13472127-G-A 11316451-G-A *
10932745-A-T *
10928715-T-A *
13488579-C-T 11332903-C-T *
10787457-A-T *
13467260-G-C 11311584-G-C *
13467245-G-C 11311569-G-C *
11020304-A-T *
13471935-G-T 11316259-G-T *
13462355-C-G 11306679-C-G *
10787746-A-G *
10827957-C-G *
13482370-C-A 11326694-C-A *
28800419-C-T 26654272-C-T *
13464054-C-A 11308378-C-A BY32169 *
13462696-C-T 11307020-C-T FGC45845 *
10821982-C-G *
13477707-C-G 11322031-C-G *
13471171-A-C 11315495-A-C *
13480835-T-C 11325159-T-C *
13471934-G-T 11316258-G-T *
13477493-GA-G 11321817-GA-G *
13472066-G-A 11316390-G-A *
13488744-T-C 11333068-T-C *
56689056-C-A *
13484475-A-G 11328799-A-G *
13484470-T-C 11328794-T-C *
13470256-C-T 11314580-C-T *
36453-T-G FGC77518 *
10979605-T-C *
58905453-G-T 56685418-C-A *
13471136-C-T 11315460-C-T *
28807405-G-A 26661258-G-A *
28807391-C-G 26661244-C-G *
10631709-C-T *
13489777-C-A 11334101-C-A *
13711317-A-G 11555641-A-G *
13404839-G-C 11249163-G-C *
28553992-C-CAA 26407845-C-CAA 28×A*
23793688-A-G 21631802-A-G Y*
13468569-G-A 11312893-G-A *
10756238-ACTCTC-A *
13469074-G-A 11313398-G-A *
10906043-C-T *
13489550-C-T 11333874-C-T *
9965116-G-T 10127507-G-T Y*
13482920-C-T 11327244-C-T *
13463541-C-A 11307865-C-A *
10653555-A-G *
13481861-C-A 11326185-C-A *
10827932-A-G *
13488317-C-A 11332641-C-A *
13475059-C-A 11319383-C-A *
13472536-G-T 11316860-G-T *
10831553-T-C *
29797-GC-G *
13700750-T-TATGGAATGGAATGGAATGGAATGGA 11545074-T-TATGGAATGGAATGGAATGGAATGGA *
13485348-C-A 11329672-C-A *
13483706-C-A 11328030-C-A *
5742778-GTCTC-G 5874737-GTCTC-G *
10914492-T-C *
10860041-C-A *
13488702-TG-T 11333026-TG-T *
13478026-A-T 11322350-A-T *
28807446-G-A 26661299-G-A *
28807421-G-T 26661274-G-T *
56771244-A-C *
13480770-C-T 11325094-C-T *
13480769-C-G 11325093-C-G *
13480768-G-T 11325092-G-T *
13433634-C-A 11277958-C-A *
10979561-T-C *
27353-A-C *
27336-T-C *
10807844-CAATTA-C *
28800441-T-C 26654294-T-C *
10846891-TC-T *
15205272-AT-A 13093358-AT-A 9×T*
10910496-G-A *
13474635-C-G 11318959-C-G *
10914450-A-C *
13474409-C-A 11318733-C-A *
13392768-CAA-C 11237092-CAA-C 11×A*
13478488-C-A 11322812-C-A *
10912313-A-G *
11001511-TC-T *
11001498-T-A *
10669365-A-T *
13474613-C-T 11318937-C-T *
10791937-C-T *
10653554-C-G *
14566770-CAAA-C 12454970-CAAA-C 13×A*
56850905-C-T *
10914455-A-T *
10753011-TCCCCC-T *
11011508-C-T *
10822040-A-T *
9984674-A-G 10147065-A-G Y*
9984669-C-G 10147060-C-G Y*
22510751-G-T 20348865-G-T DYZ19 *
9992534-G-A 10154925-G-A Y*
13488390-C-A 11332714-C-A *
13489697-GT-G 11334021-GT-G *
10903805-G-T *
10903801-C-T *
13489845-C-A 11334169-C-A *
13466447-G-A 11310771-G-A *
13466439-T-G 11310763-T-G *
10756249-C-A *
13478477-A-T 11322801-A-T *
10876035-T-C *
11011509-A-G *
10910492-C-T FT369710 *
10921358-T-C *
13713034-C-T 11557358-C-T *
10982906-C-T *
10004446-A-C 10166837-A-C Y*
10777063-C-T *
10827960-C-A *
10752993-C-A *
58823473-G-T 56767398-C-A *
22510426-G-A 20348540-G-A DYZ19 *
10752998-T-C *
56850998-G-A *
13748426-C-T 11592750-C-T *
10932800-T-C *
10787475-T-A *
13477203-G-A 11321527-G-A *
9929351-A-T 10091742-A-T Y*
13461231-G-T 11305555-G-T *
10903761-C-A *
10903759-G-C *
10903755-A-G *
10903746-A-C *
56845505-G-T *
15021685-GTT-G 12909774-GTT-G 13×T*
13478636-C-A 11322960-C-A *
8314326-G-A 8446285-G-A YY*
56850889-G-A *
13477097-A-C 11321421-A-C *
59030478-AAAAC-A,AAAACAAAC 56884331-AAAAC-A,AAAACAAAC 6×AAAC*
10917356-T-A *
10954340-C-G *
4373595-C-CT 4505554-C-CT 10×T*
28800436-G-T 26654289-G-T *
28800418-A-G 26654271-A-G *
10805486-T-C *
5981186-A-T 6113145-A-T *
13287080-T-C 11131404-T-C *
10057128-A-G 10219519-A-G *
10041603-A-C 10203994-A-C *
10041584-A-C 10203975-A-C *
10028180-A-G 10190571-A-G Y*
10006250-C-T 10168641-C-T Y*
10006207-G-A 10168598-G-A Y*
10006033-T-G 10168424-T-G Y*
9984069-A-G 10146460-A-G Y*
9964922-T-C 10127313-T-C Y*
9943530-T-C 10105921-T-C Y*
9929359-C-A 10091750-C-A Y*
5995474-T-A 6127433-T-A *
5981178-G-A 6113137-G-A *
13399966-T-C 11244290-T-C *
4512176-A-G 4644135-A-G *
3377786-T-A 3509745-T-A *
13283394-G-T 11127718-G-T *
58868763-G-A 56722108-C-T *
13485263-T-G 11329587-T-G *
28812236-A-G 26666089-A-G *
13435000-C-A 11279324-C-A *
10006376-C-T 10168767-C-T BY82731 Y*
10006373-A-G 10168764-A-G Y*
13489725-C-A 11334049-C-A *
13482879-A-C 11327203-A-C *
2786264-G-A 2918223-G-A Y*
13482884-G-A 11327208-G-A *
13481514-C-G 11325838-C-G *
13287081-G-A 11131405-G-A *
13440146-C-T 11284470-C-T *
13467600-C-T 11311924-C-T *
28800409-T-A 26654262-T-A *
9930156-G-C 10092547-G-C Y*
4585401-A-G 4717360-A-G *
58834587-C-A 56756284-G-T *
9997152-T-C 10159543-T-C Y*
58882303-G-A 56708568-C-T *
58882500-G-A 56708371-C-T *
13473207-A-T 11317531-A-T *
13462116-C-T 11306440-C-T FGC71610 *
28588291-A-T 26442144-A-T *
9780251-T-C 9942642-T-C Y*
13480906-C-T 11325230-C-T *
28588314-A-G 26442167-A-G *
9930165-A-C 10092556-A-C Y*
13611794-C-T 11456118-C-T *
13471087-A-G 11315411-A-G *
13611716-T-G 11456040-T-G *
13611684-C-A 11456008-C-A *
13611675-T-G 11455999-T-G *
13578291-C-G 11422615-C-G *
13570120-A-AG 11414444-A-AG *
13570109-C-T 11414433-C-T *
13563039-A-G 11407363-A-G *
13559115-G-A 11403439-G-A *
13540300-A-T 11384624-A-T *
13538367-A-G 11382691-A-G *
13520293-G-A 11364617-G-A *
13520279-A-C 11364603-A-C *
13482900-C-T 11327224-C-T *
13477874-A-C 11322198-A-C A10795 *
13482899-G-T 11327223-G-T *
58881186-G-C 56709685-C-G *
9943574-A-C 10105965-A-C Y*
13477072-A-G 11321396-A-G *
9992627-T-C 10155018-T-C Y*
13472129-G-T 11316453-G-T *
13469182-G-A 11313506-G-A *
22361548-C-A 20199662-C-A DYZ19 *
22361546-G-C 20199660-G-C DYZ19 *
13486018-T-C 11330342-T-C *
13706787-A-G 11551111-A-G *
22442916-C-A 20281030-C-A DYZ19 *
10005900-A-G 10168291-A-G Y*
13254002-GTTT-G,TTTT 11098326-GTTT-G,TTTT 17×T*
13728881-A-C 11573205-A-C *
13447598-G-C 11291922-G-C *
6347741-A-AGAAAGAAGGAAGGAAG 6479700-A-AGAAAGAAGGAAGGAAG 9×GAAG*
13477061-A-G 11321385-A-G *
13505284-T-A 11349608-T-A *
13474136-C-G 11318460-C-G *
13474133-AT-A 11318457-AT-A *
13471054-G-C 11315378-G-C *
13853638-G-A 11732932-G-A *
13803427-G-A 11682721-G-A FT451702 *
13803188-G-A 11682482-G-A *
13803185-C-T 11682479-C-T *
17196757-A-T 15084877-A-T YY*
13474129-T-C 11318453-T-C *
13478967-G-A 11323291-G-A *
13447603-G-C 11291927-G-C *
22445113-C-T 20283227-C-T FT456935 DYZ19 *
9992628-G-A 10155019-G-A BY82602 Y*
58855286-CCCATTCCATT-C 56735539-CAATGGAATGG-C 9×CCATT*
13473747-C-G 11318071-C-G *
13471733-G-A 11316057-G-A *
10082062-G-T 10244453-G-T *
58858705-G-T 56732166-C-A *
9966703-T-C 10129094-T-C Y*
4909318-G-C 5041277-G-C *
13477042-T-A 11321366-T-A *
13475419-A-G 11319743-A-G *
13473510-A-G 11317834-A-G *
13473507-G-T 11317831-G-T *
28761382-C-CAAA 26615235-C-CAAA 31×A*
13473398-G-T 11317722-G-T *
10038681-A-G 10201072-A-G *
58823124-T-C 56767747-A-G *
58887801-T-C 56703070-A-G *
9177929-T-G 9340320-T-G A3734 Y15×TG*
7483638-T-TA 7615597-T-TA IR1_L 23×A*
58898280-A-T 56692591-T-A *
58819477-C-G 56771394-G-C *
10036671-C-T 10199062-C-T *
13488182-C-T 11332506-C-T *
13488459-A-T 11332783-A-T *
13483759-T-A 11328083-T-A *
23084704-G-GT 20922818-G-GT 19×T*
13487638-T-G 11331962-T-G *
13485114-T-G 11329438-T-G *
13803417-C-T 11682711-C-T *
13485089-A-C 11329413-A-C *
58843447-T-C 56747424-A-G *
58843446-G-A 56747425-C-T *
13463573-C-CG 11307897-C-CG *
58848519-G-A 56742352-C-T *
13463567-A-C 11307891-A-C *
13462731-C-T 11307055-C-T BY47068 *
9943551-G-A 10105942-G-A Y*
9957145-C-T 10119536-C-T FT373532 Y*
13460813-C-T 11305137-C-T *
58858743-T-A 56732128-A-T *
58890836-G-A 56700035-C-T *
13730454-G-T 11574778-G-T *
13451191-T-C,TC 11295515-T-C,TC *
58997054-G-A 56850907-G-A *
13480198-G-C 11324522-G-C *
58826927-T-A 56763944-A-T *
22508740-T-A 20346854-T-A DYZ19 *
13466300-G-C 11310624-G-C *
13711559-G-T 11555883-G-T *
13468428-T-G 11312752-T-G *
58882523-C-A 56708348-G-T *
58882509-A-G 56708362-T-C *
4909354-G-A 5041313-G-A *
58865545-T-G 56725326-A-C *
13483169-G-A 11327493-G-A *
10038638-A-G 10201029-A-G BY83343 *
58833419-G-T 56757452-C-A *
58891476-C-A 56699395-G-T *
58891429-T-C 56699442-A-G *
58912874-A-G 56677997-T-C *
13488979-C-T 11333303-C-T *
13463547-C-G 11307871-C-G *
58898313-C-T 56692558-G-A *
13470764-C-G 11315088-C-G *
13470758-G-T 11315082-G-T *
13464268-A-G 11308592-A-G *
13468958-C-A 11313282-C-A *
58979990-CCCACT-C,TCCACT 56833843-CCCACT-C,TCCACT 4×CCACT*
13484445-C-T 11328769-C-T *
22436903-G-T 20275017-G-T BY48552 DYZ19 *
13483170-T-C 11327494-T-C *
58855285-A-T 56735586-T-A *
13460674-A-T 11304998-A-T *
13474593-G-C 11318917-G-C *
58914478-C-T 56676393-G-A *
58890725-G-C 56700146-C-G *
58890723-C-T 56700148-G-A *
58890697-C-T 56700174-G-A *
13469043-A-C 11313367-A-C *
13462604-C-T 11306928-C-T *
16000952-G-A 13889072-G-A FTB21410 Y*
22255403-G-A 20093517-G-A DYZ19 *
28810223-G-A 26664076-G-A *
58844833-T-C 56746038-A-G *
4822446-G-GAGGC 4954405-G-GAGGC *
13474612-G-A 11318936-G-A *
13480279-G-A 11324603-G-A *
28588320-A-G 26442173-A-G *
13468448-C-T 11312772-C-T *
3314557-C-T 3446516-C-T *
58901588-C-A 56689283-G-T *
58852185-G-T 56738686-C-A *
28798965-A-T 26652818-A-T *
22510737-C-T 20348851-C-T BY225677 DYZ19 *
58844750-C-T 56746121-G-A *
13520080-A-G 11364404-A-G *
13701724-G-C 11546048-G-C *
13470353-G-A 11314677-G-A *
58890696-G-C 56700175-C-G *
13486398-T-C 11330722-T-C *
13734725-G-A 11579049-G-A *
13477871-G-T 11322195-G-T FGC409 *
13462944-A-T 11307268-A-T *
13479063-C-T 11323387-C-T *
9957175-A-G 10119566-A-G Y*
13462449-G-T 11306773-G-T *
22303579-T-C 20141693-T-C DYZ19 *
13852072-A-C 11731366-A-C *
13706781-T-C 11551105-T-C *
13692720-G-T 11537044-G-T *
13692710-G-C 11537034-G-C *
13577929-A-C 11422253-A-C *
13530059-T-G 11374383-T-G *
13530058-T-G 11374382-T-G *
13517037-C-T 11361361-C-T *
13471093-C-T 11315417-C-T *
13470675-A-G 11314999-A-G *
13462852-A-G 11307176-A-G *
13462683-A-T 11307007-A-T Z19342 *
13460673-G-C 11304997-G-C *
22506237-A-G 20344351-A-G Z12112 DYZ19 *
13429251-T-G 11273575-T-G *
13429243-A-C 11273567-A-C *
13399953-T-G 11244277-T-G *
13399280-T-C 11243604-T-C *
13399269-T-C 11243593-T-C *
13362880-G-C 11207204-G-C *
10065195-G-C 10227586-G-C *
10041614-G-C 10204005-G-C *
10022163-G-A 10184554-G-A Y*
10006198-C-T 10168589-C-T FGC82332 Y*
10006006-G-T 10168397-G-T A10370 Y*
10005997-A-T 10168388-A-T A10369 Y*
9966699-A-T 10129090-A-T Y*
9962099-T-A 10124490-T-A Y*
22506236-G-A 20344350-G-A DYZ19 *
22507961-G-C 20346075-G-C DYZ19 *
9997194-C-T 10159585-C-T Y*
13464095-A-G 11308419-A-G FT443982 *
13462782-G-C 11307106-G-C *
58854810-T-G 56736061-A-C *
58829930-T-G 56760941-A-C *
58840778-T-C 56750093-A-G *
58840770-C-A 56750101-G-T *
58840760-C-G 56750111-G-C *
58828066-T-C 56762805-A-G *
10028169-T-C 10190560-T-C Y*
10004373-T-C 10166764-T-C Y*
13469124-A-T 11313448-A-T *
13399871-G-T 11244195-G-T *
9937980-C-T 10100371-C-T Y*
22341523-C-T 20179637-C-T DYZ19 *
9962289-G-A 10124680-G-A Y*
58910666-T-C 56680205-A-G *
28790631-G-T 26644484-G-T *
58866285-T-C 56724586-A-G *
22476788-C-T 20314902-C-T DYZ19 *
58869371-G-C 56721500-C-G *
58837820-T-C 56753051-A-G *
16757414-GA-G 14645534-GA-G BY33829 9×A*
10009220-T-C 10171611-T-C BY82833 Y*
58840925-C-A 56749946-G-T *
59025138-A-G 56878991-A-G *
59025136-G-A 56878989-G-A *
59013334-T-C 56867187-T-C *
59013267-C-T 56867120-C-T *
59013265-G-T 56867118-G-T *
59012433-G-T 56866286-G-T *
28805360-AT-A 26659213-AT-A *
10903711-T-C *
13471624-G-A 11315948-G-A BY85876 *
13488258-C-T 11332582-C-T *
56830278-C-CCTTCCATTACACTCCACTCA *
13470714-C-A 11315038-C-A *
13463870-T-A 11308194-T-A *
13463836-C-CAGCCT 11308160-C-CAGCCT *
13461726-ATGTCACAAAGCCCCTG-A 11306050-ATGTCACAAAGCCCCTG-A *
13461697-CCCATCACCTGGCTGATCAGTGCAGAGT-C 11306021-CCCATCACCTGGCTGATCAGTGCAGAGT-C *
9995169-C-A 10157560-C-A Y*
9995149-T-G 10157540-T-G Y*
9962394-A-G 10124785-A-G Y*
8314317-TA-T 8446276-TA-T *
2786289-T-G 2918248-T-G Y*
2786278-G-A 2918237-G-A Y*
2786244-C-T 2918203-C-T YY*
2786242-A-G 2918201-A-G YY*
56676361-C-G *
13481074-T-A 11325398-T-A *
28809680-A-G 26663533-A-G *
28791437-GGA-G 26645290-GGA-G *
22510599-C-A 20348713-C-A DYZ19 *
22484094-G-A 20322208-G-A DYZ19 *
22484076-T-C 20322190-T-C DYZ19 *
13669130-TGAAATGGATGGGAACGAAATGGAAGAGAACGGACTGGAGTAGAACGGAAA-T 11513454-TGAAATGGATGGGAACGAAATGGAAGAGAACGGACTGGAGTAGAACGGAAA-T *
13669116-GGAAAGGACAA-G 11513440-GGAAAGGACAA-G *
13669101-AGAATG-A 11513425-AGAATG-A *
13485204-G-A 11329528-G-A BY86149 *
13485042-C-A 11329366-C-A *
13483788-A-C 11328112-A-C *
13480961-A-T 11325285-A-T *
13480925-G-A 11325249-G-A *
13480920-GGC-G 11325244-GGC-G *
13479085-C-T 11323409-C-T *
13481092-T-A 11325416-T-A *
13480707-A-AT 11325031-A-AT *
10057157-A-G 10219548-A-G *
56876124-CAAAAAAAAAAAAAAAAAAAA-C,CAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 50×A*
56771416-A-T *
56734110-G-A *
21757109-G-C *
21757108-G-T *
21757081-C-A *
21757080-A-C *
13480108-C-G 11324432-C-G *
13478966-C-T 11323290-C-T *
13477051-C-T 11321375-C-T *
11016405-TG-T *
11016400-TCCAC-T *
10057167-T-G 10219558-T-G *
10038687-T-G 10201078-T-G *
13481497-G-A 11325821-G-A *
10038686-C-T 10201077-C-T *
10038676-T-C 10201067-T-C *
10038674-G-T 10201065-G-T *
10038666-T-C 10201057-T-C *
10038665-A-T 10201056-A-T *
56680343-G-A *
28785786-G-GCTATGGA 26639639-G-GCTATGGA *
22509181-G-T 20347295-G-T DYZ19 *
22484115-G-A 20322229-G-A BY224553 DYZ19 *
13737509-G-A 11581833-G-A *
13561827-G-A 11406151-G-A *
13489700-C-G 11334024-C-G *
13481505-C-A 11325829-C-A BY86076 *
13481502-G-T 11325826-G-T *
13480710-GT-G 11325034-GT-G *
13477248-A-T 11321572-A-T *
10831528-T-G *
13445780-C-T 11290104-C-T *
13478616-G-C 11322940-G-C *
13478610-C-G 11322934-C-G *
13474627-A-G 11318951-A-G *
13465707-G-A 11310031-G-A BY85727 *
13465679-A-G 11310003-A-G *
13463232-G-GGT 11307556-G-GGT *
13463193-GC-G 11307517-GC-G *
13463186-G-GCA 11307510-G-GCA *
13462780-T-G 11307104-T-G *
13449379-C-CCACTG 11293703-C-CCACTG *
13447606-T-C 11291930-T-C *
13447601-A-C 11291925-A-C *
13446026-A-G 11290350-A-G *
13404854-A-G 11249178-A-G *
13478993-TCG-T 11323317-TCG-T *
13195306-C-CTAGAG 11039630-C-CTAGAG *
10980575-TCCTC-T *
10980573-AG-A *
10980561-C-CCATTT *
10841994-C-CGT *
10056993-C-G 10219384-C-G *
9965114-A-C 10127505-A-C Y*
9933575-G-A 10095966-G-A Y*
4909304-C-G 5041263-C-G *
4909300-TC-T 5041259-TC-T *
56831433-G-GCATTCCATCCCACTC *
22509518-G-A 20347632-G-A DYZ19 *
22509509-C-G 20347623-C-G DYZ19 *
22316224-C-A 20154338-C-A DYZ19 *
13478856-CG-C 11323180-CG-C *
13479389-T-C 11323713-T-C *
13475513-G-T 11319837-G-T *
18410596-T-TTCGCCCA 16298716-T-TTCGCCCA P6_Gap *
13421119-G-T 11265443-G-T *
13421099-A-T 11265423-A-T *
10910699-C-CTGTAGT *
10883432-T-C *
10883422-C-A *
10883417-T-C *
10883407-T-TTTTC *
10671359-CTATTG-C *
9933594-C-G 10095985-C-G Y*
9933593-A-AT 10095984-A-AT *
56771229-G-T *
56713931-G-A *
28795194-TCAAATGGAATG-T 26649047-TCAAATGGAATG-T *
28583682-G-C 26437535-G-C *
13489806-C-CTAAT 11334130-C-CTAAT *
13479393-T-C 11323717-T-C *
13488491-G-C 11332815-G-C *
13488456-G-T 11332780-G-T *
13488435-G-T 11332759-G-T *
13488414-C-T 11332738-C-T *
13486447-G-A 11330771-G-A *
13485441-T-A 11329765-T-A *
13483091-C-T 11327415-C-T *
13483084-T-A 11327408-T-A *
13483072-G-T 11327396-G-T *
13482878-C-A 11327202-C-A *
13482862-C-A 11327186-C-A *
13482615-A-T 11326939-A-T *
13482608-A-C 11326932-A-C *
13480227-C-G 11324551-C-G *
10669335-TTCCAG-T *
10831529-T-G *
13489751-C-T 11334075-C-T *
13463651-T-A 11307975-T-A *
13470240-G-C 11314564-G-C *
13470216-G-C 11314540-G-C *
13469985-GT-G 11314309-GT-G *
13469982-CT-C 11314306-CT-C *
13469969-A-AT 11314293-A-AT *
13469484-C-G 11313808-C-G *
13467590-G-T 11311914-G-T *
13467584-A-G 11311908-A-G *
13467583-G-T 11311907-G-T *
13465423-C-T 11309747-C-T *
13465354-T-G 11309678-T-G *
13464069-C-G 11308393-C-G *
13463679-C-G 11308003-C-G *
13463624-G-A 11307948-G-A *
13470643-G-C 11314967-G-C *
13463604-C-T 11307928-C-T *
13463554-CGG-C 11307878-CGG-C *
13463549-C-CAG 11307873-C-CAG *
13463537-A-AGT 11307861-A-AGT *
13463532-CAG-C 11307856-CAG-C *
13463508-G-T 11307832-G-T *
13463053-GCAGGGCGCCTGCATAGGCCGGCGGCCTGTGCAACGCGGCCCCCCA-G 11307377-GCAGGGCGCCTGCATAGGCCGGCGGCCTGTGCAACGCGGCCCCCCA-G *
13463034-AGGCACCCGGGATATG-A 11307358-AGGCACCCGGGATATG-A *
13462941-C-T 11307265-C-T *
13462927-C-G 11307251-C-G *
13462923-T-C 11307247-T-C *
13462910-G-A 11307234-G-A BY210272 *
13462903-C-T 11307227-C-T *
13462892-C-CT 11307216-C-CT *
13470247-C-A 11314571-C-A *
13470666-C-G 11314990-C-G *
13462865-C-T 11307189-C-T *
13477380-T-A 11321704-T-A *
13488190-A-T 11332514-A-T *
13487266-A-G 11331590-A-G *
13479038-G-A 11323362-G-A *
13479005-C-G 11323329-C-G *
13478761-G-A 11323085-G-A *
13477268-C-A 11321592-C-A *
13477238-C-A 11321562-C-A *
13477214-T-C 11321538-T-C *
13477164-G-A 11321488-G-A *
13477161-T-G 11321485-T-G *
13477157-C-T 11321481-C-T *
13477144-G-A 11321468-G-A *
13474380-G-T 11318704-G-T *
13472588-T-C 11316912-T-C *
13470699-C-T 11315023-C-T *
13472550-C-G 11316874-C-G *
13471836-G-A 11316160-G-A *
13471821-C-G 11316145-C-G *
13471811-G-A 11316135-G-A *
13471805-C-T 11316129-C-T *
13471793-C-T 11316117-C-T *
13471773-G-T 11316097-G-T *
13471748-G-T 11316072-G-T *
13471746-C-G 11316070-C-G *
13471724-GGC-G 11316048-GGC-G *
13471722-C-CTT 11316046-C-CTT *
13471706-G-C 11316030-G-C *
13471060-GAT-G 11315384-GAT-G *
13470912-A-AGCC 11315236-A-AGCC *
13462867-C-T 11307191-C-T *
13462859-G-A 11307183-G-A *
10831599-TCC-T *
13479500-AG-A 11323824-AG-A *
13482379-G-T 11326703-G-T *
13469332-C-T 11313656-C-T *
13489748-G-C 11334072-G-C *
13464258-T-C 11308582-T-C *
56757336-AT-A *
56756309-G-A *
56751877-G-A *
56751862-GAATGC-G *
13857866-T-TTG 11737160-T-TTG *
13857863-AAC-A 11737157-AAC-A *
13856785-A-AT 11736079-A-AT *
13856783-A-AGGGG 11736077-A-AGGGG *
13479511-A-T 11323835-A-T *
13479497-AC-A 11323821-AC-A *
9938087-T-C 10100478-T-C Y*
13479476-T-A 11323800-T-A *
13474499-A-T 11318823-A-T *
11014999-C-CCAAAA *
9931420-G-A 10093811-G-A Y*
9931419-A-G 10093810-A-G Y*
9931375-T-C 10093766-T-C Y*
9187277-G-GA 9349668-G-GA 10×A*
13869679-TGA-T 11748973-TGA-T *
13869678-T-TCA 11748972-T-TCA *
13692901-AATC-A 11537225-AATC-A *
13692898-TGG-T 11537222-TGG-T *
13466337-T-C 11310661-T-C *
13269594-CAAA-C 11113918-CAAA-C *
10831603-C-CAT *
9013060-T-A 9175451-T-A Y*
9944521-A-T 10106912-A-T Y*
13462858-T-C 11307182-T-C *
10948385-C-CGAGTT *
13462851-C-T 11307175-C-T *
13462843-T-C 11307167-T-C *
13462828-G-C 11307152-G-C *
13462789-T-C 11307113-T-C *
13462779-G-C 11307103-G-C *
13462762-G-T 11307086-G-T *
13462675-CG-C 11306999-CG-C *
13462149-C-T 11306473-C-T *
13462120-G-C 11306444-G-C *
13460340-G-C 11304664-G-C *
10998120-T-A *
10948393-C-T *
10948388-C-T *
10948386-C-G *
10883427-T-C *
9962561-CAG-C 10124952-CAG-C *
10010312-C-CG 10172703-C-CG *
10010308-C-A 10172699-C-A Y*
10010285-A-T 10172676-A-T Y*
10009225-G-A 10171616-G-A BY82834 Y*
10009215-T-A 10171606-T-A Y*
10006042-A-G 10168433-A-G Y*
10006038-G-T 10168429-G-T Y*
10004450-C-T 10166841-C-T Y*
9995355-GAT-G 10157746-GAT-G *
9974223-T-TTTTC 10136614-T-TTTTC *
9962589-T-C 10124980-T-C Y*
9962584-T-G 10124975-T-G Y*
9962569-C-T 10124960-C-T Y*
9962564-G-GTA 10124955-G-GTA *
13718529-TGGAACGGAAC-T 11562853-TGGAACGGAAC-T *
13488714-CCA-C 11333038-CCA-C *
13487633-C-T 11331957-C-T *
28807454-ATGAATGAAAT-A 26661307-ATGAATGAAAT-A *
13477312-A-G 11321636-A-G *
13473166-A-T 11317490-A-T *
13470676-C-A 11315000-C-A *
13465768-C-G 11310092-C-G *
13267148-G-T 11111472-G-T *
10824772-C-A *
9944768-A-C 10107159-A-C Y*
9929379-G-C 10091770-G-C Y*
9929374-T-C 10091765-T-C Y*
9929373-G-A 10091764-G-A Y*
9929372-T-C 10091763-T-C Y*
28807514-C-G 26661367-C-G *
28807465-G-C 26661318-G-C *
28801182-C-T 26655035-C-T *
13477356-C-A 11321680-C-A BY85973 *
21757093-C-T *
22511273-C-G 20349387-C-G DYZ19 *
22510760-A-T 20348874-A-T DYZ19 *
22509559-T-A 20347673-T-A DYZ19 *
16000957-T-C 13889077-T-C Y*
16000948-C-T 13889068-C-T Y*
16000935-T-C 13889055-T-C Y*
16000930-C-G 13889050-C-G Y*
14711798-A-G 12599865-A-G YY*
14711796-G-T 12599863-G-T YY*
14711761-A-G 12599828-A-G YY*
14711759-C-T 12599826-C-T YY*
13711604-G-T 11555928-G-T *
13711597-C-A 11555921-C-A *
13477337-G-A 11321661-G-A *
13477378-A-C 11321702-A-C *
13692681-A-T 11537005-A-T *
22341456-G-A 20179570-G-A DYZ19 *
9980755-G-A 10143146-G-A Y*
9946013-C-G 10108404-C-G Y*
10038641-G-A 10201032-G-A *
13470198-G-T 11314522-G-T *
13488158-G-A 11332482-G-A *
13470684-C-T 11315008-C-T *
13549902-GTGTGTC-G 11394226-GTGTGTC-G *
56709520-G-A *
56757376-C-A *
13517758-A-G 11362082-A-G *
13484935-A-G 11329259-A-G *
28807400-G-A 26661253-G-A *
28816647-CG-C 26670500-CG-C *
22346787-C-CAAGA 20184901-C-CAAGA DYZ19 *
13477382-A-G 11321706-A-G *
56722035-A-C *
56710301-T-C *
28582945-G-T 26436798-G-T *
13825568-G-A 11704862-G-A *
13825566-T-A 11704860-T-A *
13705116-G-T 11549440-G-T *
13565877-A-C 11410201-A-C *
13562665-T-A 11406989-T-A *
13528269-T-C 11372593-T-C *
13523973-C-T 11368297-C-T *
13517787-C-T 11362111-C-T *
13516291-C-A 11360615-C-A *
13507428-T-G 11351752-T-G *
13485372-G-T 11329696-G-T *
13711591-A-C 11555915-A-C *
13691377-C-G 11535701-C-G BY88672 *
10082019-C-A 10244410-C-A *
10961197-A-G *
13462390-G-T 11306714-G-T *
13489820-T-A 11334144-T-A *
13488792-C-T 11333116-C-T *
10038748-G-GCAGCA 10201139-G-GCAGCA *
10038742-AATGGT-A 10201133-AATGGT-A *
10006143-AC-A 10168534-AC-A *
19209891-A-G 17098011-A-G YY*
13606219-G-A 11450543-G-A *
13481864-T-A 11326188-T-A *
13481853-A-C 11326177-A-C *
10004369-A-G 10166760-A-G Y*
9925318-T-A 10087709-T-A Y*
9929378-A-T 10091769-A-T Y*
10984419-C-A *
6091720-A-AT 6223679-A-AT 28×T*
10928721-T-C *
13456095-A-C 11300419-A-C BY210229 *
13470988-C-T 11315312-C-T *
13471012-A-G 11315336-A-G *
10791010-T-A *
10827959-C-A *
13462164-C-A 11306488-C-A *
10982893-TTGAAC-T *
10979600-T-C *
10949643-C-T *
13488275-G-A 11332599-G-A *
13488235-C-G 11332559-C-G *
10791016-T-C *
13470547-C-A 11314871-C-A *
4539032-C-A 4670991-C-A *
12372594-A-T FTB17014 *
13691372-T-C 11535696-T-C FT425955 *
13465770-A-G 11310094-A-G *
13611671-C-T 11455995-C-T *
13578321-C-T 11422645-C-T *
13570107-T-C 11414431-T-C *
13539154-G-A 11383478-G-A *
13528263-T-C 11372587-T-C *
13519113-C-A 11363437-C-A *
13487912-C-T 11332236-C-T *
13485349-C-T 11329673-C-T *
13479537-C-T 11323861-C-T *
13474171-T-A 11318495-T-A *
13473717-G-C 11318041-G-C *
13473708-C-A 11318032-C-A *
13469437-C-G 11313761-C-G *
13467300-C-A 11311624-C-A *
13465767-C-A 11310091-C-A *
10038650-A-G 10201041-A-G *
10831555-C-T *
10752985-T-C *
10752975-T-C *
10068354-A-G 10230745-A-G *
10068331-T-C 10230722-T-C *
10068330-T-A 10230721-T-A *
10068328-T-G 10230719-T-G *
10068321-A-T 10230712-A-T *
10068317-T-A 10230708-T-A *
10022128-C-T 10184519-C-T Y*
9924461-C-A 10086852-C-A Y*
13468750-A-T 11313074-A-T *
14010016-TA-T 11889310-TA-T 9×A*
10038655-A-G 10201046-A-G *
10082017-T-A 10244408-T-A *
10082033-A-C 10244424-A-C *
13488198-G-A 11332522-G-A *
10980571-T-G *
13734073-A-T 11578397-A-T *
13470783-G-T 11315107-G-T *
28584340-A-G 26438193-A-G *
13480712-C-A 11325036-C-A *
13283402-T-C 11127726-T-C *
22255161-C-T 20093275-C-T DYZ19 *
13478466-C-T 11322790-C-T *
13477243-C-T 11321567-C-T *
13462375-G-A 11306699-G-A *
13853363-G-A 11732657-G-A *
13853358-G-A 11732652-G-A M423 *
13466593-T-A 11310917-T-A *
13433639-T-C 11277963-T-C *
28797409-G-T 26651262-G-T *
14711763-A-G 12599830-A-G YY*
13475063-G-A 11319387-G-A *
13478893-G-T 11323217-G-T *
13222054-A-G 11066378-A-G *
10038642-T-C 10201033-T-C *
19513143-CT-C,CTT 17401263-CT-C,CTT 20×T*
13488104-C-G 11332428-C-G *
13488098-G-C 11332422-G-C *
13467562-G-A 11311886-G-A *
10917362-C-G FT141527FT255341 *
13480171-T-A 11324495-T-A *
13488450-G-T 11332774-G-T *
13481061-G-GA 11325385-G-GA *
21757128-A-G *
21757062-T-C *
13734079-A-C 11578403-A-C *
9933547-T-C 10095938-T-C Y*
14711779-T-C 12599846-T-C FTB17019 YY*
13449727-T-TAAA 11294051-T-TAAA *
13488193-G-T 11332517-G-T *
13488183-G-A 11332507-G-A *
13478964-C-T 11323288-C-T *
13472110-T-C 11316434-T-C *
13468869-G-C 11313193-G-C *
13468849-T-C 11313173-T-C *
13468818-G-A 11313142-G-A *
13468804-C-A 11313128-C-A *
13468474-G-T 11312798-G-T *
13468464-C-T 11312788-C-T *
13465104-C-A 11309428-C-A *
13463745-C-A 11308069-C-A *
13449729-CATT-C 11294053-CATT-C *
13444978-C-A 11289302-C-A *
9933548-G-A 10095939-G-A Y*
13444976-G-A 11289300-G-A *
10986944-T-C *
10986925-TCTATTTCATTCCATC-T *
11662464-T-A *
13483147-T-C 11327471-T-C *
13482596-G-C 11326920-G-C *
13480839-C-A 11325163-C-A *
13404831-A-G 11249155-A-G *
13348259-C-T 11192583-C-T *
13348257-G-T 11192581-G-T *
10808021-C-T *
10805490-A-T *
10748662-C-A *
9933549-T-C 10095940-T-C Y*
19209872-A-T 17097992-A-T YY*
14711773-G-A 12599840-G-A FTB17436 YY*
10082046-G-A 10244437-G-A *
13433640-T-C 11277964-T-C *
13479009-GC-G 11323333-GC-G *
13475054-C-G 11319378-C-G *
27477-A-C *
27472-A-T *
13481112-T-C 11325436-T-C *
13481098-T-C 11325422-T-C *
13481091-G-T 11325415-G-T *
13481082-T-C 11325406-T-C *
13488093-C-T 11332417-C-T *
4517054-GAA-G 4649013-GAA-G 15×A*
13470377-A-AC 11314701-A-AC *
13478911-T-C 11323235-T-C *
13469039-G-A 11313363-G-A *
13575300-C-T 11419624-C-T *
13482395-A-T 11326719-A-T *
13404738-G-A 11249062-G-A *
13404713-A-T 11249037-A-T *
13378265-C-A 11222589-C-A *
13469069-G-A 11313393-G-A *
13472290-C-T 11316614-C-T *
22508279-G-C 20346393-G-C DYZ19 *
13605976-A-G 11450300-A-G *
13605913-C-T 11450237-C-T *
13538421-T-G 11382745-T-G *
13473943-G-A 11318267-G-A *
13473911-T-A 11318235-T-A *
13466448-C-T 11310772-C-T *
10082066-T-A 10244457-T-A *
10082056-G-C 10244447-G-C *
13469964-CA-C 11314288-CA-C *
13476644-G-T 11320968-G-T *
13485144-C-A 11329468-C-A *
9944527-G-T 10106918-G-T Y*
13479322-C-G 11323646-C-G *
13479304-T-A 11323628-T-A *
13195279-C-A 11039603-C-A *
13478505-T-G 11322829-T-G *
56688727-T-C *
13484905-A-C 11329229-A-C *
19209886-T-A 17098006-T-A YY*
19209881-T-C 17098001-T-C YY*
9980050-A-G 10142441-A-G Y*
9980039-C-G 10142430-C-G Y*
13484247-A-G 11328571-A-G *
13466591-C-G 11310915-C-G *
13362602-CT-C 11206926-CT-C *
9984088-C-A 10146479-C-A Y*
13479283-G-A 11323607-G-A *
13242234-C-T 11086558-C-T *
13462518-A-C 11306842-A-C *
13422989-T-G 11267313-T-G *
13348249-G-A 11192573-G-A *
13348228-A-T 11192552-A-T *
13348221-G-A 11192545-G-A *
56693959-A-C *
10930792-A-C *
4278778-G-GTT 4410737-G-GTT 15×T*
13469207-A-G 11313531-A-G *
7972855-CTT-C 8104814-CTT-C 12×T*
13466654-G-A 11310978-G-A BY210299 *
13462632-A-G 11306956-A-G *
13477227-C-A 11321551-C-A *
13473522-T-A 11317846-T-A *
9310539-CAT-C,CATAT 9472930-CAT-C,CATAT 17×AT*

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 6082018848416817227286105200398463933
Used in age calculations17227286105200398463933
Counts of SNPs21671
Variant counts last updated 2022-11-19 02:52:10.



Big Tree Main Page