Tree Position

R-M269 > L23 > L51 > P310 > L151 > S1194 > A8039

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRKane-BY3
343463
21201452-CT-C 19039566-CT-C 9×T***
6985100-G-GGT 7117059-G-GGT 10×GT***
16278153-C-T 14166273-C-T FT272525 **
28761417-G-T 26615270-G-T **
19126436-C-CAAAAAAA 17014556-C-CAAAAAAA 25×A**
22481301-C-T 20319415-C-T DYZ19 **
21409460-CA-C 19247574-CA-C 30×A**
3838601-C-CTTTT 3970560-C-CTTTT 31×T**
22767501-T-TA 20605615-T-TA 17×A**
16393351-G-A 14281471-G-A **
16390190-C-A 14278310-C-A BY156566 **
13516726-G-A 11361050-G-A **
16269989-C-A 14158109-C-A FTA23864 **
22298161-T-C 20136275-T-C FTA27191 DYZ19 **
58880442-T-G 56710429-A-C **
13423838-G-C 11268162-G-C **
4632840-ACTAT-A 4764799-ACTAT-A **
18908398-C-T 16796518-C-T BY24162 **
15799177-C-CTT 13687297-C-CTT 13×TCTT**
4736005-A-G 4867964-A-G **
15610098-A-G 13498218-A-G FT168974 **
19232261-T-G 17120381-T-G FT170341 **
4897430-T-C 5029389-T-C FT166318 **
17509940-A-G 15398060-A-G FTA24168 **
32169-TCCTTCTGGCTGGTTCATGGTCTTGCTCACTTCAAGAATGAAGCTACAGACCTTAGTGGTGAGTGTTACAGCACTTAAAGGTATTATGCCCAGGGTTTGTTACTTCAGATGTGTCCAGAGTTTCTC-T **
5001496-G-A 5133455-G-A FT166355 **
20433864-A-G 18271978-A-G P5_Dst **
21577166-T-C 19415280-T-C **
21433342-C-T 19271456-C-T FTA24835 **
22481296-C-T 20319410-C-T DYZ19 **
6142146-G-A 6274105-G-A IR3_Dst **
21318562-C-T 19156676-C-T BY132078 **
21059882-G-T 18897996-G-T **
21059876-G-T 18897990-G-T **
21059875-A-T 18897989-A-T **
20810795-G-A 18648909-G-A FTA24712 P4_Gap **
20596366-G-C 18434480-G-C BY212211 P5_Dst **
19565265-A-T 17453385-A-T BY129991 **
18088013-G-A 15976133-G-A FTA24341 **
19496741-T-G 17384861-T-G BY129558 **
15799167-C-T 13687287-C-T M6488 **
19300443-G-A 17188563-G-A FT170375 **
19253448-C-T 17141568-C-T FT170353 **
19174144-T-C 17062264-T-C **
2685902-C-A 2817861-C-A FTA22556 **
2779916-C-T 2911875-C-T FT165300 **
18637791-C-T 16525911-C-T BY122752 **
8125062-G-GAGAGAAGAGA 8257021-G-GAGAGAAGAGA 12×AGAGA**
18423593-T-C 16311713-T-C P6_Gap **
17767511-A-G 15655631-A-G BY117275 **
15196875-G-A 13084961-G-A FTA23625 **
13845541-A-AAATGGAATGGAATGGAATGGAATGGAATGGAATGG 11724835-A-AAATGGAATGGAATGGAATGGAATGGAATGGAATGG 8×AATGG**
9123611-C-T 9286002-C-T FTA23184 **
8421818-G-C 8553777-G-C FTA22982 **
8616476-G-C 8748435-G-C BY48129 **
2786289-T-G 2918248-T-G **
8718931-G-A 8850890-G-A FTA23072 **
2786278-G-A 2918237-G-A **
2786244-C-T 2918203-C-T **
8972962-G-A 9135353-G-A **
2786242-A-G 2918201-A-G **
2786282-T-C 2918241-T-C **
9910866-T-G 10073257-T-G FTA27192 **
8307170-T-G 8439129-T-G FT167703 **
7098919-G-T 7230878-G-T **
27127606-C-A 24981459-C-A P1_g3 **
27570867-CGT-C 25424720-CGT-C P1_Y2 20×GT***
13328231-A-G 11172555-A-G **
13286508-G-T 11130832-G-T FT442329 **
26707123-CT-C 24560976-CT-C P1_g2 13×T**
11037762-C-A FT440422 **
11014374-T-TTCCAC **
19547453-CA-C 17435573-CA-C 24×A**
7646449-G-A 7778408-G-A FT8541 **
8378984-T-G 8510943-T-G FT426415 **
28761382-CA-C 26615235-CA-C 31×A**
4909318-G-C 5041277-G-C **
8413034-T-TTTCTG 8544993-T-TTTCTG 7×TTCTG**
15042335-C-A 12930425-C-A FT168801 **
2786264-G-A 2918223-G-A **
7126524-CTTTT-C 7258483-CTTTT-C 23×T**
21551933-A-G 19390047-A-G **
14221508-G-A 12100802-G-A FTA23368 **
14177771-T-C 12057065-T-C **
58852204-C-T 56738667-G-A FGC80622 **
58880431-A-T 56710440-T-A **
14006336-G-T 11885630-G-T FT168356 **
5829920-T-C 5961879-T-C FT166797 **
6347740-A-AGG 6479699-A-AGG **
7830982-A-G 7962941-A-G FT167534 **
9946766-G-C 10109157-G-C **
9946769-T-C 10109160-T-C **
6347741-A-AAGGAAG 6479700-A-AAGGAAG 9×GAAG**
13667446-G-T 11511770-G-T **
6687068-TA-T 6819027-TA-T **
6733039-AT-A 6864998-AT-A **
6840950-C-G 6972909-C-G FTA22644 **
7178539-A-G 7310498-A-G FT167280 **
7367189-C-T 7499148-C-T FTA22749 **
2729648-CTT-C 2861607-CTT-C 25×T**
21633291-CTTTAT-C 19471405-CTTTAT-C **
17151662-C-T 15039782-C-T **
22481294-G-T 20319408-G-T DYZ19 **
23768146-G-T 21606260-G-T FT171422 **
13516738-C-T 11361062-C-T **
15799171-T-TC 13687291-T-TC **
15799164-C-CT 13687284-C-CT **
22755727-C-T 20593841-C-T FT171067 **
22872929-A-T 20711043-A-T FTA25155 **
21050838-T-TTATCTATC 18888952-T-TTATCTATC 10×TATC**
23075286-G-A 20913400-G-A FT171192 **
23306939-T-C 21145053-T-C FTA25291 **
56692413-G-T **
23567232-C-A 21405346-C-A FTA25357 **
56692412-G-T **
22260692-TAGATGTGTCTAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAGTAAGAATGAAGCTGCAGACCTTTACGGTGATTGTTACAGCATATAAAGTGTTATGTCCAAAGTTTGTTCCTTC-T 20098806-TAGATGTGTCTAGAGTTTCTTCCTTCTGGCAGGTTCATGGTCTTGCTCACTTCAAGTAAGAATGAAGCTGCAGACCTTTACGGTGATTGTTACAGCATATAAAGTGTTATGTCCAAAGTTTGTTCCTTC-T DYZ19 **
24072340-G-T 21926193-G-T P3_b1 **
13728262-A-T 11572586-A-T **
24659261-T-C 22513114-T-C P3_b2 **
58848073-A-C 56742798-T-G FGC12800 **
25720181-C-A 23574034-C-A P1_b3 **
11024682-TCACTC-T **
16757043-ATTTT-A 14645163-ATTTT-A 27×T**
10761260-TTTCCATTCCA-T **
13479197-T-A 11323521-T-A **
22341506-G-T 20179620-G-T DYZ19 **
20213005-TTTCTTCTTCTTC-T 18051119-TTTCTTCTTCTTC-T P5_Dst 26×TTC**
18067401-T-TAGAAAGAA 15955521-T-TAGAAAGAA 15×AGAA**
5354713-C-CATAT 5486672-C-CATAT 16×AT**
13691539-G-T 11535863-G-T FGC51768BY43184 **
22341511-T-G 20179625-T-G DYZ19 **
13516739-A-G 11361063-A-G **
10946928-A-C **
22198630-T-G 20036744-T-G **
24553622-T-C 22407475-T-C F4346 P3_t2 **
58872680-C-G 56718191-G-C **
22893475-C-T 20731589-C-T FT171127 **
22069035-T-C 19907149-T-C FT170904 **
58872705-A-T 56718166-T-A **
6402084-A-ATATT 6534043-A-ATATT ***
13462386-G-C 11306710-G-C ***
13461800-T-C 11306124-T-C ***
13690756-C-G 11535080-C-G ***
22359610-T-TCA 20197724-T-TCA DYZ19 ***
13460535-C-G 11304859-C-G ***
13460527-G-C 11304851-G-C ***
26659082-G- ***
13460521-T-C 11304845-T-C ***
11334024-C- ***
13460520-A-T 11304844-A-T ***
13690726-T-C 11535050-T-C ***
13449064-AC-A 11293388-AC-A ***
13378665-C-A 11222989-C-A ***
28024704-CA-C 25878557-CA-C P1_Y2 9×A***
9963106-G-T 10125497-G-T ***
28586923-C-G 26440776-C-G ***
56826034-C-CGATTGCATTCCATTT ***
9936525-A-AG 10098916-A-AG ***
9936522-G-C 10098913-G-C ***
13266004-C-T 11110328-C-T FT189859 ***
13470155-CAG-C 11314479-CAG-C ***
13468326-T-C,G 11312650-T-C,G ***
13487994-G-A 11332318-G-A ***
9994745-T-A 10157136-T-A ***
28802582-T-C 26656435-T-C ***
10692336-CCAGTCCACTCCACTCTGCCCAATTA-C ***
13469135-A-T 11313459-A-T ***
22505752-G-A 20343866-G-A DYZ19 ***
13492032-G-T 11336356-G-T ***
13485468-A-C 11329792-A-C ***
9986789-A-G 10149180-A-G ***
13485463-C-T 11329787-C-T ***
13482095-T-G 11326419-T-G ***
13448219-C-CCATTCCATTCCATTCCATTA 11292543-C-CCATTCCATTCCATTCCATTA ***
9994742-GC-G 10157133-GC-G ***
13469675-C-G 11313999-C-G ***
28812519-A-T 26666372-A-T ***
28812492-G-GAA 26666345-G-GAA ***
28812489-CAT-C 26666342-CAT-C ***
22512192-C-G 20350306-C-G DYZ19 ***
22479421-G-C 20317535-G-C DYZ19 ***
13711573-A-G 11555897-A-G ***
10889251-G- ***
9986788-C-T 10149179-C-T ***
6402086-A-ACTGGTGTCGTAAAATACTGACGTATATCTAACT 6534045-A-ACTGGTGTCGTAAAATACTGACGTATATCTAACT ***
56845046-ACTCTTGTCTAGGCTCTGCCTATAG- ***
56845017-ATCACTGCACTGATCACCCATGTGATAT- ***
13470051-C-G 11314375-C-G ***
13470043-A-T 11314367-A-T ***
13404503-T-A 11248827-T-A ***
13482137-G-A 11326461-G-A ***
13478935-A-ACG 11323259-A-ACG ***
13478929-CTG-C 11323253-CTG-C ***
13464119-C-A 11308443-C-A ***
13483773-G-T 11328097-G-T ***
13472065-G-T 11316389-G-T ***
13472030-A-T 11316354-A-T ***
13471892-G-GATTCT 11316216-G-GATTCT ***
13483789-T-C 11328113-T-C ***
13471882-GTGTCA-G 11316206-GTGTCA-G ***
10062592-C-CAA 10224983-C-CAA ***
13483378-C-A 11327702-C-A ***
13404483-C-T 11248807-C-T ***
11018938-T-TCCA ***
11018936-G-GCA ***
10826876-C-CTCCAT ***
56854672-C-T ***
13338643-C-T 11182967-C-T ***
28587207-G-A 26441060-G-A ***
13469186-T-A 11313510-T-A ***
6402454-ACTTTCGTCGTTGTCGTGAAATACCGAC-A 6534413-ACTTTCGTCGTTGTCGTGAAATACCGAC-A ***
56830603-T-A ***
13489487-A-T 11333811-A-T ***
13464109-C-T 11308433-C-T ***
13483385-G-GAA 11327709-G-GAA ***
28588365-C-A 26442218-C-A ***
56834560-C-CCA ***
13472072-C-T 11316396-C-T ***
13470597-A-T 11314921-A-T ***
13471871-G-C 11316195-G-C ***
11316207-T- ***
22228431-A-C 20066545-A-C DYZ19 ***
13719893-G-C 11564217-G-C ***
56878253-G-GCA,GCACACACACACACA 9×CA***
11292967-CCATTCCATTCCATTCCATTCCATT- ***
13464097-A-C 11308421-A-C ***
56838241-C-T ***
28815162-C-T,T 26669015-C-T,T ***
13483388-AAG-A 11327712-AAG-A ***
28814048-A-AATGGC 26667901-A-AATGGC ***
13722988-G-C 11567312-G-C ***
13722920-A-T 11567244-A-T ***
13704524-G-T 11548848-G-T ***
13688200-T-TGGAAA 11532524-T-TGGAAA ***
13484209-G-C 11328533-G-C ***
13464107-C-A 11308431-C-A ***
13484107-A-G 11328431-A-G ***
13484095-A-G 11328419-A-G ***
13483796-G-C 11328120-G-C ***
13483788-A-C 11328112-A-C ***
10692328-A-C ***
13245158-G-C 11089482-G-C ***
28806323-G-C 26660176-G-C ***
4800088-A-G 4932047-A-G ***
13480253-T-A 11324577-T-A ***
10652760-T-TTCCAC ***
13467880-GTGATCAGTGCAGAGATTTGTCAGAATTCCCTGTAGGCAGTGCTTATAAAAGTGTTACATCACCTAGGT-G 11312204-GTGATCAGTGCAGAGATTTGTCAGAATTCCCTGTAGGCAGTGCTTATAAAAGTGTTACATCACCTAGGT-G ***
6402986-ATGTATATATTATATTCCTAGGTGTCGTAAAATAACGTCATATATATTATATTTGTACGTGTTGTAAAATACCGACGTATATAGTATAGGTGTCGTGAAATACCG-A 6534945-ATGTATATATTATATTCCTAGGTGTCGTAAAATAACGTCATATATATTATATTTGTACGTGTTGTAAAATACCGACGTATATAGTATAGGTGTCGTGAAATACCG-A ***
6402984-CG-C 6534943-CG-C ***
13463365-G-A 11307689-G-A ***
13472156-C-A 11316480-C-A ***
7567753-CT-C,CTT 7699712-CT-C,CTT 25×T***
16716806-AT-A 14604926-AT-A ***
13222267-AGG-A 11066591-AGG-A ***
56830602-T-C ***
10994311-T-C ***
56835940-A-ACTCCACTCAATTCCACTCCACGCAATTCCACTCCACTCAATTCCACTCCACTCTG ***
13484144-A-C 11328468-A-C ***
13484091-G-T 11328415-G-T ***
13484069-T-G 11328393-T-G ***
13484067-C-A 11328391-C-A ***
13479113-C-A 11323437-C-A ***
22487925-A-C 20326039-A-C DYZ19 ***
22480276-GAATGAAGCTGCAGACCTTACTGTTTAGTGTAACAGCACTTAAAGGTGTTATTTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGTTATTGCTCCCTTCCC-G 20318390-GAATGAAGCTGCAGACCTTACTGTTTAGTGTAACAGCACTTAAAGGTGTTATTTCCAGAGTTTGTTCCTTCAGATGTGTCCAGAGTTTCTTCCTTCTGGCAGGTTCATGTTATTGCTCCCTTCCC-G DYZ19 ***
22480273-CA-C 20318387-CA-C DYZ19 ***
13489940-A-G 11334264-A-G ***
10652768-C-CATTTCATTAT ***
13480969-C-G 11325293-C-G ***
13463307-T-A 11307631-T-A ***
13450100-TCCACTCCACTCCACCCCATC-T 11294424-TCCACTCCACTCCACCCCATC-T ***
4909238-C-T 5041197-C-T ***
28791432-G-GGAA 26645285-G-GGAA ***
22475557-G-T 20313671-G-T DYZ19 ***
28791407-G-C 26645260-G-C ***
22509358-C-T 20347472-C-T DYZ19 ***
28780696-T-TAAAG 26634549-T-TAAAG ***
22508801-G-A 20346915-G-A DYZ19 ***
28780697-GAC-G 26634550-GAC-G ***
22448751-T-A 20286865-T-A DYZ19 ***
13489750-G-GCCT 11334074-G-GCCT ***
13487749-C-CAA 11332073-C-CAA ***
13479041-T-A 11323365-T-A ***
56833872-T-TTCCAC ***
13515180-G-A 11359504-G-A ***
13745128-TCG-T 11589452-TCG-T ***
13480983-C-G 11325307-C-G ***
13480981-A-C 11325305-A-C ***
13476815-C-T 11321139-C-T ***
9966132-TAAA-T 10128523-TAAA-T ***
9966128-TA-T 10128519-TA-T ***
22486574-A-T 20324688-A-T DYZ19 ***
13480998-G-T 11325322-G-T ***
13488394-G-C 11332718-G-C ***
13482778-C-T 11327102-C-T ***
56734110-G-A ***
13857863-AAC-A 11737157-AAC-A ***
5090542-C-CT 5222501-C-CT 10×T***
13571665-ATT-A,AT 11415989-ATT-A,AT 17×T***
56838244-A-C ***
13737459-G-C 11581783-G-C ***
56826011-C-CATTCGATTGCA ***
13691798-T-TATGGA,TGGA 11536122-T-TATGGA,TGGA ***
28588363-GC-G 26442216-GC-G ***
13473862-C-T 11318186-C-T ***
13857866-T-TTG 11737160-T-TTG ***
13476551-G-A 11320875-G-A ***
13476653-C-A 11320977-C-A ***
13641025-A-T 11485349-A-T ***
13406891-G-A 11251215-G-A ***
56826007-G-GCA ***
10692317-CA-C ***
28814111-G-T 26667964-G-T ***
13480953-G-T 11325277-G-T ***
13269594-CAAA-C 11113918-CAAA-C ***
13269588-CAAAA-C 11113912-CAAAA-C ***
13473858-A-C 11318182-A-C ***
10692320-TACCC-T ***
22475545-C-T 20313659-C-T DYZ19 ***
22746246-AT-A 20584360-AT-A 10×T***
13489860-G-A 11334184-G-A ***
13481026-G-C 11325350-G-C BY210371 ***
13719980-A-G 11564304-A-G ***
13463310-G-A 11307634-G-A ***
13482771-A-C 11327095-A-C ***
13471796-G-C 11316120-G-C ***
13471854-G-A 11316178-G-A ***
13489353-A-AGT 11333677-A-AGT ***
13475824-G-A 11320148-G-A ***
13479153-C-G 11323477-C-G ***
13479152-C-T 11323476-C-T ***
13479043-C-G 11323367-C-G ***
13471856-GGA-G 11316180-GGA-G ***
13469497-A-G 11313821-A-G ***
13489855-C-A 11334179-C-A ***
13244139-G-T 11088463-G-T ***
13468533-T-C 11312857-T-C ***
13450834-T-TCCCCTCCTCTCCATC 11295158-T-TCCCCTCCTCTCCATC ***
13393311-G-A 11237635-G-A ***
13393295-A-G 11237619-A-G ***
13393286-G-A 11237610-G-A ***
13516696-C-T 11361020-C-T ***
13468511-C-T 11312835-C-T ***
4937662-G-T 5069621-G-T 12×T***
13489854-C-G 11334178-C-G ***
28588048-TAC-T 26441901-TAC-T ***
28587200-T-A 26441053-T-A ***
56830539-CTG-C ***
13382570-C-A 11226894-C-A ***
11029523-T-G ***
10062628-T-G 10225019-T-G ***
9964234-T-C 10126625-T-C ***
28628234-CT-C,CTT 26482087-CT-C,CTT 13×T***
13607598-CA-C,CAA 11451922-CA-C,CAA 18×A***
26416299-G-C 24270152-G-C P1_Y1 20×A***
13470813-C-A 11315137-C-A ***
13484145-G-T 11328469-G-T ***
13484079-T-C 11328403-T-C ***
19056508-CA-C 16944628-CA-C 9×A***
13470869-G-C 11315193-G-C ***
13606336-C-T 11450660-C-T ***
13480891-G-C 11325215-G-C ***
11029508-T-C ***
13370192-G-A 11214516-G-A ***
11029507-G-A FT440141 ***
6117070-CTG-C 6249029-CTG-C 8×TG***
56835830-T-C ***
13497335-G-A,C 11341659-G-A,C ***
3819260-G-GA 3951219-G-GA 9×A***
56884831-G-A ***
28582945-G-T 26436798-G-T ***
13598437-A-T 11442761-A-T ***
13484243-A-G 11328567-A-G ***
13465281-A-G 11309605-A-G ***
13375825-T-C 11220149-T-C ***
10029308-A-C 10191699-A-C ***
28816479-C-G 26670332-C-G ***
13591385-T-C 11435709-T-C ***
13374572-C-G 11218896-C-G ***
28816464-G-C 26670317-G-C ***
13712462-G-T 11556786-G-T ***
22107634-CGTGT-C,CGT 19945748-CGTGT-C,CGT 17×GT***
13476632-G-T 11320956-G-T ***
4813273-A-G 4945232-A-G ***
22447545-G-C 20285659-G-C DYZ19 ***
13470514-A-C 11314838-A-C ***
56830619-A-G ***
13538815-T-C 11383139-T-C ***
13443755-C-G 11288079-C-G ***
13443743-G-A 11288067-G-A ***
13411490-C-T 11255814-C-T ***
4154627-G-GA 4286586-G-GA 8×A***
28586295-G-C 26440148-G-C ***
28582980-G-A 26436833-G-A FT353640 ***
13607655-G-C 11451979-G-C ***
13378555-T-C 11222879-T-C ***
13498383-G-A 11342707-G-A ***
13289992-C-A 11134316-C-A ***
6089764-GTTT-G,GTTTTT 6221723-GTTT-G,GTTTTT 31×T***
13479099-C-T 11323423-C-T ***
13478997-A-T 11323321-A-T BY176315 ***
28586287-G-T 26440140-G-T ***
28586285-T-G 26440138-T-G ***
13404443-A-C 11248767-A-C ***
13404392-C-A 11248716-C-A ***
13356237-T-C 11200561-T-C ***
13418039-C-T 11262363-C-T ***
13378664-G-T 11222988-G-T ***
13378654-T-A 11222978-T-A ***
28816471-C-T 26670324-C-T ***
28816457-C-T 26670310-C-T ***
13484448-A-G 11328772-A-G ***
13488695-C-A 11333019-C-A ***
4174030-TA-T 4305989-TA-T 9×A***
5949671-T-TA 6081630-T-TA 10×A***
13482737-T-A 11327061-T-A ***
13482735-T-C 11327059-T-C ***
18528205-T-G 16416325-T-G P6_Dst ***
6076711-C-T 6208670-C-T FGC69308 ***
4167657-CAAA-C 4299616-CAAA-C 18×A***
3259035-CAA-C,CA 3390994-CAA-C,CA 22×A***
5268741-G-T 5400700-G-T FTB70400 ***
13462383-C-T 11306707-C-T ***
3519250-A-AT 3651209-A-AT 10×T***
13469285-G-C 11313609-G-C ***
28634133-T-TA 26487986-T-TA 10×A***
4277201-CTT-C,CT 4409160-CTT-C,CT 20×T***
13475847-C-T 11320171-C-T ***
13479145-C-CT 11323469-C-CT ***
13479125-G-T 11323449-G-T ***
13464525-T-A 11308849-T-A ***
4790634-GA-G 4922593-GA-G 14×A***
6443469-C-CA 6575428-C-CA 11×A***
24408780-T-G 22262633-T-G ***
13489820-T-A 11334144-T-A ***
13523622-C-CAAA 11367946-C-CAAA ***
13463956-C-CCCT 11308280-C-CCCT ***
13463955-C-CA 11308279-C-CA ***
13196117-C-CCACTG 11040441-C-CCACTG ***
9977974-G-GTT 10140365-G-GTT ***
9964034-T-C 10126425-T-C ***
13475841-T-C 11320165-T-C ***
13475853-C-G 11320177-C-G ***
28813677-T-G 26667530-T-G ***
13479108-C-G 11323432-C-G ***
28809777-G-T 26663630-G-T ***
28549852-G-A 26403705-G-A ***
22484047-C-G 20322161-C-G DYZ19 ***
22484034-T-A 20322148-T-A DYZ19 ***
13539154-G-A 11383478-G-A ***
13519113-C-A 11363437-C-A ***
13519065-A-C 11363389-A-C ***
13519054-T-C 11363378-T-C ***
13519024-G-A 11363348-G-A ***
13515709-T-G 11360033-T-G ***
13515707-A-G 11360031-A-G ***
13498814-T-C 11343138-T-C ***
13481022-T-C 11325346-T-C ***
13474637-A-G 11318961-A-G ***
13468354-G-T 11312678-G-T ***
13469478-A-G 11313802-A-G ***
13465127-G-A 11309451-G-A ***
13380274-C-A 11224598-C-A ***
13356080-C-G 11200404-C-G ***
11026257-T-C FGC80881 ***
10068354-A-G 10230745-A-G ***
10068331-T-C 10230722-T-C ***
10068328-T-G 10230719-T-G ***
10068321-A-T 10230712-A-T ***
10068317-T-A 10230708-T-A ***
9958594-C-G 10120985-C-G ***
13252511-C-A 11096835-C-A ***
9730450-T-TCA 9892841-T-TCA IR3_Prx ***
8145399-A-G 8277358-A-G FT40695 ***
9994787-A-C 10157178-A-C ***
13470834-T-A 11315158-T-A ***
22509922-T-C 20348036-T-C DYZ19 ***
13488717-G-GGA 11333041-G-GGA ***
28587205-T-A 26441058-T-A ***
28587016-C-T 26440869-C-T ***
22364699-G-T 20202813-G-T DYZ19 ***
13734180-TGG-T 11578504-TGG-T ***
13718773-C-G,G 11563097-C-G,G ***
13715150-C-T 11559474-C-T ***
13696618-A-T 11540942-A-T ***
13694705-T-A 11539029-T-A ***
13693685-CCTAG-C 11538009-CCTAG-C ***
13687991-G-A 11532315-G-A ***
13607821-ATT-A 11452145-ATT-A 10×T***
13489751-C-T 11334075-C-T ***
13488726-C-T 11333050-C-T ***
13484677-G-A 11329001-G-A ***
56827687-T-C,TGCCATCCGATTGCATGCCATCCGATTC ***
13484676-G-T 11329000-G-T ***
13484662-C-A 11328986-C-A ***
13475874-T-C 11320198-T-C ***
13474296-A-G 11318620-A-G ***
13474287-A-C 11318611-A-C ***
13474281-A-C 11318605-A-C ***
13474257-A-T 11318581-A-T ***
13474240-A-T 11318564-A-T ***
13474229-A-T 11318553-A-T ***
13469160-T-A 11313484-T-A ***
13451445-ATTCCT-A 11295769-ATTCCT-A ***
13451428-CTATTCCATTG-C 11295752-CTATTCCATTG-C ***
13449960-T-TTCCATACCATTCCATTCCATTGCATTCCACTCCATTCCACTCCACTCCAATCAACTCCACTCCACTCCACTTCACTCCAATCCACTCCAC 11294284-T-TTCCATACCATTCCATTCCATTGCATTCCACTCCATTCCACTCCACTCCAATCAACTCCACTCCACTCCACTTCACTCCAATCCACTCCAC ***
28794167-G-A 26648020-G-A ***
56833351-C-CACTGCACTGCACTCCATTCCATTCCATTCT ***
13406875-T-A 11251199-T-A ***
10884980-TTCACTGCAC-T ***
22447570-G-C 20285684-G-C DYZ19 ***
13510267-GACAA-G 11354591-GACAA-G ***
13489801-GCCCC-G 11334125-GCCCC-G ***
13484463-C-A 11328787-C-A ***
13484454-G-A 11328778-G-A ***
13484381-TAA-T 11328705-TAA-T ***
13484379-A-AGG 11328703-A-AGG ***
13476660-A-G 11320984-A-G ***
13472563-C-CT 11316887-C-CT ***
13470619-A-G 11314943-A-G ***
13468422-G-A 11312746-G-A ***
13447601-A-C 11291925-A-C ***
11026250-C-G ***
10882078-C-CCCATTCCACCCCATT,CCCATTCCACCCCATT ***
56833363-C-CTCCATTCCATTCCATTCTACTCCATTCCAT,T ***
9986881-GTCGCC-G 10149272-GTCGCC-G ***
9986880-G-T 10149271-G-T ***
9986869-G-T 10149260-G-T ***
9986865-G-A 10149256-G-A ***
9986861-G-T 10149252-G-T ***
9977973-T-TCA 10140364-T-TCA ***
9966153-G-T 10128544-G-T ***
9965080-T-A 10127471-T-A ***
9958035-T-A 10120426-T-A ***
4909304-C-G 5041263-C-G ***
4909300-TC-T 5041259-TC-T ***
56835939-C-CACTCCACTCAATTCT ***
56834769-G-GTATTCCATTCCAGTC ***
13446323-G-T 11290647-G-T ***
13196196-T-A 11040520-T-A FT258103 ***
13474719-T-A 11319043-T-A ***
9936194-T-TC 10098585-T-TC ***
13530016-G-A 11374340-G-A ***
13469473-G-A 11313797-G-A ***
13263170-A-C,T 11107494-A-C,T ***
13244129-G-A 11088453-G-A ***
9805004-T-A 9967395-T-A ***
13470908-C-A 11315232-C-A ***
6447793-C-A 6579752-C-A FT326582 ***
56884762-C-T ***
13345961-T-TC 11190285-T-TC ***
22509907-T-A 20348021-T-A DYZ19 ***
13412624-A-G 11256948-A-G ***
13404453-G-A 11248777-G-A ***
13502628-AC-A 11346952-AC-A ***
13372426-A-C 11216750-A-C ***
56831062-C-A ***
13356135-G-A 11200459-G-A FGC41397 ***
13296447-A-C 11140771-A-C ***
13470035-C-T 11314359-C-T ***
13469663-G-T 11313987-G-T ***
56856103-CAAA-C,CA 14×A***
13470574-A-C 11314898-A-C ***
9933499-G-A 10095890-G-A ***
9933496-T-G 10095887-T-G ***
5743536-G-A 5875495-G-A ***
4167674-A-G 4299633-A-G ***
13481027-T-G 11325351-T-G ***
56822627-T-A ***
13527964-G-C 11372288-G-C ***
13509219-G-A 11353543-G-A ***
13740145-G-A 11584469-G-A ***
9964171-G-C 10126562-G-C ***
13488741-T-C 11333065-T-C ***
6402486-ATCTTATGTTAGTC-A 6534445-ATCTTATGTTAGTC-A ***
6402449-ATGT-A 6534408-ATGT-A ***
13439940-G-T 11284264-G-T ***
13382488-G-A 11226812-G-A ***
13382478-T-C 11226802-T-C ***
13335612-T-C 11179936-T-C ***
13335598-G-A 11179922-G-A ***
13261705-A-G 11106029-A-G ***
10908296-C-T ***
9951180-C-G 10113571-C-G ***
9933549-T-C 10095940-T-C ***
9933548-G-A 10095939-G-A ***
9933547-T-C 10095938-T-C ***
13690745-C-G 11535069-C-G ***
13262590-T-A 11106914-T-A ***
13480712-C-A 11325036-C-A ***
13464532-G-A 11308856-G-A ***
19073940-T-TAC 16962060-T-TAC ***
3446607-C-CAA 3578566-C-CAA 25×A***
5833627-C-CTT 5965586-C-CTT 9×T***
3181857-CA-C,CAA 3313816-CA-C,CAA 20×A***
13443597-G-A 11287921-G-A ***
13475838-C-A 11320162-C-A ***
13476689-G-C 11321013-G-C ***
13476656-G-C 11320980-G-C ***
3101326-A-AT 3233285-A-AT 9×T***
13464549-C-T 11308873-C-T ***
13718297-A-C 11562621-A-C ***
13718288-G-T 11562612-G-T ***
11333951-CA- ***
4854274-G-A 4986233-G-A ***
5570209-ATTT-A 5702168-ATTT-A 14×T***
15220173-A-G 13108259-A-G ***
15629878-G-C 13517998-G-C ***
15629869-C-T 13517989-C-T ***
15629843-G-A 13517963-G-A ***
15629840-T-C 13517960-T-C ***
15588597-C-T 13476717-C-T ***
15519713-G-T 13407833-G-T ***
15420256-T-A 13308376-T-A ***
15347627-A-G 13235746-A-G ***
15296797-C-T 13184896-C-T ***
15296632-A-G 13184731-A-G ***
15263490-T-C 13151580-T-C ***
15260746-C-T 13148830-C-T ***
15082070-G-C 12970160-G-C ***
15629883-G-A 13518003-G-A ***
14952993-C-T 12841067-C-T ***
14905379-A-G 12793446-A-G ***
14826548-GT-G,GTTT 12714615-GT-G,GTTT 19×T***
14803145-C-T 12691216-C-T ***
14766375-C-T 12654444-C-T ***
14722136-G-A 12610204-G-A ***
14690993-A-G 12579059-A-G ***
14571535-C-T 12459735-C-T ***
12374768-G-A ***
14414783-C-T 12294080-C-T ***
14396420-A-C 12275716-A-C ***
14324918-T-C 12204212-T-C ***
15629882-T-C 13518002-T-C ***
15629884-T-C 13518004-T-C ***
14158773-G-A 12038067-G-A ***
16625046-TC-T 14513166-TC-T ***
17300603-G-C 15188723-G-C ***
17298908-TA-T 15187028-TA-T ***
17283700-T-C 15171820-T-C ***
17268546-T-A 15156666-T-A ***
16977224-C-T 14865344-C-T ***
16977216-C-A 14865336-C-A ***
16938240-G-T 14826360-G-T ***
16888783-C-T 14776903-C-T ***
16813760-T-A 14701880-T-A ***
16780388-A-C 14668508-A-C ***
16687242-T-C 14575362-T-C ***
16647670-C-A 14535790-C-A ***
16599008-A-C 14487128-A-C ***
15629890-G-C 13518010-G-C ***
16581750-C-T 14469870-C-T ***
16530668-A-G 14418788-A-G ***
16461681-A-AT 14349801-A-AT ***
16350517-G-GAA 14238637-G-GAA 12×A***
16217274-A-G 14105394-A-G ***
16186455-A-ATC 14074575-A-ATC ***
16186440-C-T 14074560-C-T ***
16186164-G-T 14074284-G-T ***
16173769-ATGC-A 14061889-ATGC-A ***
15964646-T-C 13852766-T-C ***
15904168-A-AAC 13792288-A-AAC 8×AC***
15807489-G-T 13695609-G-T ***
15630907-C-T 13519027-C-T ***
14303816-C-T 12183110-C-T ***
14097945-ATT-A,ATTTT 11977239-ATT-A,ATTTT 23×T***
17391010-A-T 15279130-A-T ***
13471853-G-GACA 11316177-G-GACA ***
13484070-A-G 11328394-A-G ***
13482077-A-T 11326401-A-T ***
13480736-C-G 11325060-C-G ***
13480397-C-T 11324721-C-T ***
13479119-T-G 11323443-T-G ***
13475794-G-A 11320118-G-A ***
13475371-A-G 11319695-A-G ***
13475370-C-T 11319694-C-T ***
13472564-G-GCAGTAAGCAGAGCCTAGACAAGAGTTACATCAC 11316888-G-GCAGTAAGCAGAGCCTAGACAAGAGTTACATCAC ***
11316444-C- ***
11316182-AATTTAGGT- ***
11316181-G- ***
11316166-T- ***
13484270-G-C 11328594-G-C ***
13471839-T-TAA 11316163-T-TAA ***
13471828-GCA-G 11316152-GCA-G ***
13471827-A-ACG 11316151-A-ACG ***
13471815-G-T 11316139-G-T ***
13471814-G-A 11316138-G-A ***
13470542-G-T 11314866-G-T ***
13469075-C-T 11313399-C-T ***
13469062-C-A 11313386-C-A ***
13468544-T-A 11312868-T-A ***
13468527-A-G 11312851-A-G ***
13468152-A-G 11312476-A-G ***
13468133-T-G 11312457-T-G ***
13463960-C-CAAA 11308284-C-CAAA ***
13484114-A-C 11328438-A-C ***
11332081-C- ***
14088470-A-G 11967764-A-G ***
13730059-T-G 11574383-T-G ***
14080464-T-C 11959758-T-C ***
13959800-G-A 11839094-G-A FT133783 ***
13951054-G-A 11830348-G-A ***
13934421-T-C 11813715-T-C ***
13838475-T-C 11717769-T-C ***
13745199-G-T 11589523-G-T ***
13740278-A-C 11584602-A-C ***
13739951-T-A 11584275-T-A ***
13739943-G-T 11584267-G-T ***
13739941-T-A 11584265-T-A ***
13730519-G-A 11574843-G-A ***
13730085-A-G 11574409-A-G ***
13730055-G-A 11574379-G-A ***
11334026-CG- ***
11567297-G- ***
13689477-A-T 11533801-A-T FT448559 ***
13688208-A-AATGGCATGGAATGGAATGGAGTGAAATGGATTGGAATGGGATGGGCCCAAAGTAATGGACTAAAATAAAAGAGACTCAAATAGAATGAATTGTAAAGAAACGGTCTCGAATGTAATTTATTCGAATAGAATGAT 11532532-A-AATGGCATGGAATGGAATGGAGTGAAATGGATTGGAATGGGATGGGCCCAAAGTAATGGACTAAAATAAAAGAGACTCAAATAGAATGAATTGTAAAGAAACGGTCTCGAATGTAATTTATTCGAATAGAATGAT ***
13612740-G-T 11457064-G-T ***
13544974-A-G 11389298-A-G ***
13527854-C-G 11372178-C-G ***
13505071-A-G 11349395-A-G ***
13494211-G-C 11338535-G-C ***
13490340-T-TGAACTCA 11334664-T-TGAACTCA ***
13489970-C-A 11334294-C-A ***
13489957-C-G 11334281-C-G ***
11334126-C- ***
11334093-C- ***
17333106-T-C 15221226-T-C ***
17417712-A-T 15305832-A-T ***
13463945-G-A 11308269-G-A ***
23305204-G-A 21143318-G-A ***
26488166-TAAA-T 24342019-TAAA-T P1_Y1 15×A***
26479561-A-C 24333414-A-C P1_Y1 ***
26466403-G-A 24320256-G-A P1_Y1 ***
26140243-T-A 23994096-T-A P1_Y1 ***
26024570-G-T 23878423-G-T P1_Y1 ***
25593072-C-A 23446925-C-A P1_gr1 ***
25086501-CA-C 22940354-CA-C g1 10×A***
24890079-G-A 22743932-G-A g1 ***
24373989-C-G 22227842-C-G ***
24206459-G-T 22060312-G-T P3_b1 ***
23649271-G-T 21487385-G-T ***
23528145-G-A 21366259-G-A ***
23285571-C-T 21123685-C-T ***
28486385-G-A 26340238-G-A ***
23206808-G-A 21044922-G-A ***
23088732-C-G 20926846-C-G ***
23040321-CA-C 20878435-CA-C ***
22974519-T-C 20812633-T-C ***
22870888-A-G 20709002-A-G ***
22864768-C-T 20702882-C-T ***
22843232-GT-G 20681346-GT-G ***
22741584-C-T 20579698-C-T ***
22730106-GA-G 20568220-GA-G ***
22717453-A-G 20555567-A-G ***
22542015-C-A 20380129-C-A ***
22510893-A-T 20349007-A-T DYZ19 ***
28480230-T-C 26334083-T-C ***
28515556-A-G 26369409-A-G ***
22489990-GTGTCTTCCTTCTGGCAGGTTCGTGGTCTTGCTCACTTCACTAATGAAGCTGCAGACCTTACTGGTGAGTATTACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGGGTTTC-G 20328104-GTGTCTTCCTTCTGGCAGGTTCGTGGTCTTGCTCACTTCACTAATGAAGCTGCAGACCTTACTGGTGAGTATTACAGCACTTAAAGGTGTTATGTCCAGAGTTTGTTCCTTCAGATGTGTCCAGGGTTTC-G DYZ19 ***
56724653-G-T ***
56866857-ACC-A ***
56833062-G-A,A ***
56832753-CCACTCCATGCCAATCCACTCCATTCCATTCCACTCTACTCCACTCCTCTCCATTCCACTCCAA- ***
56832750-ATG- ***
56832740-ATTCCACTCCATGCCACTCCATGCCAATCCACTCCATTCCATTCCACTCTACTCCACTCCT-A ***
56832728-C-G ***
56832720-A-C ***
56832705-ACTCCAGTCCTC-A ***
56832700-ACTCC-A ***
56832690-ATTCCC-A ***
56825991-AGTTCATTCCATTCGAGTTCCTTCCATTCGAGTTCATTCCATTCGAG-A ***
56763625-T-G ***
56721666-G-A ***
28598502-T-A 26452355-T-A ***
56721656-G-A ***
56721639-T-A ***
56706804-T-A ***
56706761-A-T ***
28809810-G-T 26663663-G-T ***
28799802-G-GGAATT 26653655-G-GGAATT ***
28679715-G-A 26533568-G-A ***
28673586-C-T 26527439-C-T ***
28627543-G-A 26481396-G-A ***
28622717-A-G 26476570-A-G FT98636 ***
28617468-G-A 26471321-G-A ***
28601648-G-A 26455501-G-A ***
28598504-A-T 26452357-A-T ***
22510087-A-G 20348201-A-G DYZ19 ***
22489989-A-C 20328103-A-C DYZ19 ***
17543561-G-A 15431681-G-A ***
19014229-A-G 16902349-A-G ***
20805247-C-CT 18643361-C-CT P4_Gap 8×T***
20242421-C-T 18080535-C-T P5_Dst ***
19556924-G-A 17445044-G-A ***
19518276-T-TAAA 17406396-T-TAAA 16×A***
19385450-A-G 17273570-A-G ***
19327655-G-T 17215775-G-T ***
19327576-G-C 17215696-G-C ***
19325523-A-G 17213643-A-G ***
19275024-G-A 17163144-G-A ***
19257107-G-A 17145227-G-A ***
19241379-T-A 17129499-T-A ***
19241375-G-A 17129495-G-A ***
18978746-T-C 16866866-T-C ***
21197420-T-G 19035534-T-G ***
18857602-T-C 16745722-T-C ***
18846042-C-A 16734162-C-A ***
18705048-A-G 16593168-A-G ***
18657072-T-G 16545192-T-G ***
18400520-C-T 16288640-C-T P6_Gap ***
18268667-A-G 16156787-A-G ***
18222792-C-A 16110912-C-A ***
18179054-T-C 16067174-T-C ***
18157073-T-A 16045193-T-A ***
17932871-T-C 15820991-T-C ***
17627440-G-A 15515560-G-A ***
17580917-C-A 15469037-C-A ***
17580763-CA-C 15468883-CA-C ***
20840202-C-T 18678316-C-T P4_Gap ***
21365797-T-G 19203911-T-G ***
22489983-G-A 20328097-G-A DYZ19 ***
22213035-A-G 20051149-A-G ***
22489981-G-A 20328095-G-A DYZ19 ***
22487932-A-T 20326046-A-T BY53333 DYZ19 ***
22487931-G-T 20326045-G-T DYZ19 ***
22474789-TGCAGACCTTTGCGGTGAGTGATAC-T 20312903-TGCAGACCTTTGCGGTGAGTGATAC-T DYZ19 ***
22474778-AAGAACGAAG-A 20312892-AAGAACGAAG-A DYZ19 ***
22449112-G-T 20287226-G-T DYZ19 ***
22440010-A-T 20278124-A-T FT456391 DYZ19 ***
22432355-G-T 20270469-G-T DYZ19 ***
22328528-G-T 20166642-G-T DYZ19 ***
22315494-C-G 20153608-C-G DYZ19 ***
22250078-G-T 20088192-G-T DYZ19 ***
22247108-A-T 20085222-A-T DYZ19 ***
22211929-T-A 20050043-T-A ***
21400612-T-A 19238726-T-A ***
22191695-T-C 20029809-T-C ***
22100582-C-G 19938696-C-G ***
22069001-CAAAA-C 19907115-CAAAA-C 14×A***
22012512-C-T 19850626-C-T ***
21887755-A-C 19725869-A-C ***
21761724-A-G 19599838-A-G ***
21701481-C-T 19539595-C-T ***
21675897-T-C 19514011-T-C FT25585 ***
21661592-T-C 19499706-T-C ***
21617325-C-T 19455439-C-T FT392788 ***
21556988-G-T 19395102-G-T ***
21530284-C-A 19368398-C-A ***
21511972-C-A 19350086-C-A ***
13463958-T-C 11308282-T-C ***
13462230-T-TCCCACCACCGCCATCACCACGCCCTCTCCGCCAAACCCACCCCACCATGA 11306554-T-TCCCACCACCGCCATCACCACGCCCTCTCCGCCAAACCCACCCCACCATGA ***
13448238-C-CCAAT,T 11292562-C-CCAAT,T ***
13463639-A-C 11307963-A-C ***
13471891-C-T 11316215-C-T ***
13471884-G-T 11316208-G-T ***
13469192-AATGCCTCCATAGGCAAATCCAAGTTGAGATTCTGTCACCTGTGTGATCAGTGCAGACATATGTGACC-A 11313516-AATGCCTCCATAGGCAAATCCAAGTTGAGATTCTGTCACCTGTGTGATCAGTGCAGACATATGTGACC-A ***
13472119-GCA-G 11316443-GCA-G ***
13472116-C-CAT 11316440-C-CAT ***
5405116-A-AT 5537075-A-AT 9×T***
13488955-C-CGA 11333279-C-CGA ***
13469481-A-G 11313805-A-G ***
13265940-A-G 11110264-A-G ***
56835013-A-G ***
56834972-CACTCCGACTCCGACTCCACTCCACTCCTCTA-C ***
13470623-C-G 11314947-C-G ***
56884423-T-TAATATATA ***
2731451-T-TA 2863410-T-TA 9×A***
28803110-A-G 26656963-A-G ***
13480742-T-A 11325066-T-A ***
13480718-C-A 11325042-C-A ***
13480682-T-A 11325006-T-A ***
13451862-A-ATT 11296186-A-ATT ***
13451860-T-TAAGTATC 11296184-T-TAAGTATC ***
22260846-T-A 20098960-T-A DYZ19 ***
13489945-C-G 11334269-C-G ***
5331924-A-G 5463883-A-G ***
10889256-G- ***
22508537-CTG-C 20346651-CTG-C DYZ19 ***
13482328-A-T 11326652-A-T ***
2661613-C-T 2793572-C-T ***
2769660-A-T 2901619-A-T ***
10062622-A-T 10225013-A-T ***
3304292-T-C 3436251-T-C ***
4136641-TACACAC-T,TAC 4268600-TACACAC-T,TAC 20×AC***
3912059-T-C 4044018-T-C ***
3894910-T-C 4026869-T-C ***
3848677-T-C 3980636-T-C ***
3801047-T-C 3933006-T-C ***
3716851-T-C 3848810-T-C ***
3711043-A-G 3843002-A-G ***
3650961-C-T 3782920-C-T ***
3598229-C-A 3730188-C-A ***
3592797-C-T 3724756-C-T ***
3578895-A-T 3710854-A-T ***
3570772-A-G 3702731-A-G ***
3205874-C-A,CA 3337833-C-A,CA 11×A***
2784684-C-A 2916643-C-A ***
3175708-G-A 3307667-G-A ***
3149779-T-C 3281738-T-C ***
3146271-A-G 3278230-A-G ***
3083032-T-C 3214991-T-C ***
3076050-TTTTC-T 3208009-TTTTC-T ***
3062407-G-A 3194366-G-A ***
3040620-A-G 3172579-A-G ***
2943181-T-C 3075140-T-C ***
2930223-G-T 3062182-G-T ***
2897205-G-A 3029164-G-A ***
2861534-CA-C,C 2993493-CA-C,C 25×A***
2857960-T-C 2989919-T-C ***
2827958-G-C 2959917-G-C ***
10062623-GA-G 10225014-GA-G ***
28791433-T-TGG 26645286-T-TGG ***
4233467-TACACAC-T 4365426-TACACAC-T 13×AC***
13730019-C-G 11574343-C-G ***
13489947-G-A 11334271-G-A ***
13480955-G-A 11325279-G-A ***
13412652-T-C 11256976-T-C ***
18109358-TA-T,T 15997478-TA-T,T 23×A***
13476608-C-G 11320932-C-G ***
13476597-T-C 11320921-T-C ***
13470562-G-A 11314886-G-A ***
13487993-T-A 11332317-T-A ***
9057431-C-CG ***
8447719-CT-C 8579678-CT-C 10×T***
3795112-CA-C 3927071-CA-C 12×A***
56832492-CACCGCACTCCACTCCACTCCACTCA- ***
13464560-A-T 11308884-A-T ***
10098910-T- ***
13464548-C-A 11308872-C-A ***
13464535-C-G 11308859-C-G ***
13464523-C-G 11308847-C-G ***
13464518-A-G 11308842-A-G ***
13463339-G-T 11307663-G-T ***
13461929-G-T 11306253-G-T ***
10989152-C-CATTCAACTCCACACCATTCCACTCCATTCCTCTCA,CATTCAACTCCACACCATTCCACTCCATTCCTCTCA ***
13475282-G-C 11319606-G-C ***
13465155-G-T 11309479-G-T ***
13465149-T-C 11309473-T-C ***
13701915-A-C 11546239-A-C ***
13701884-G-T 11546208-G-T ***
26667680-TG- ***
13447591-T-C 11291915-T-C ***
13482059-T-C 11326383-T-C ***
13488825-GCGT-G 11333149-GCGT-G ***
13471805-C-G 11316129-C-G ***
13488821-C-CACT 11333145-C-CACT ***
13487751-CCA-C 11332075-CCA-C ***
6529239-T-C 6661198-T-C ***
15084488-A-T 12972578-A-T ***
2827954-T-A 2959913-T-A ***
10807396-ATTG-A ***
10807383-TCCTG-T ***
10807381-AC-A ***
13543452-G-A 11387776-G-A ***
56880814-TC- ***
28786664-G-GAATAC 26640517-G-GAATAC ***
13483723-T-C 11328047-T-C ***
13471802-G-A 11316126-G-A ***
21235227-CAAA-C,CAAAA 19073341-CAAA-C,CAAAA 19×A***
13471772-G-T 11316096-G-T ***
13471770-G-A 11316094-G-A ***
9974352-A-ATTTTT 10136743-A-ATTTTT ***
56834559-AC- ***
13420541-C-CA 11264865-C-CA ***
13466631-G-T 11310955-G-T ***
13466626-AT-A 11310950-AT-A ***
13466623-A-AC 11310947-A-AC ***
13487859-G-A 11332183-G-A ***
13338675-G-C 11182999-G-C ***
28812601-T-C 26666454-T-C ***
9944188-G-T 10106579-G-T ***
11334025-C- ***
4167680-AAG-A 4299639-AAG-A ***
4279202-TA-T 4411161-TA-T 8×A***
13462226-G-GACGTCCTTAGAGCCAGCCCCCGAAACGCACCCCCTCACCCCTTCCCCTTCGCCCCATTCCTCTTCATCTCTC 11306550-G-GACGTCCTTAGAGCCAGCCCCCGAAACGCACCCCCTCACCCCTTCCCCTTCGCCCCATTCCTCTTCATCTCTC ***
10070814-G-A 10233205-G-A ***
10847002-C-T ***
10846998-T-C ***
10846988-TAC-T ***
10846987-C-T ***
10846981-TCCA-T ***
10826980-A-G ***
10821185-TACTCC-T ***
10808160-CTAAA-C ***
10760684-T-TTTCCA,TTTCCA ***
10671790-TCCA-T ***
10669156-A-ACCATT ***
10625940-C-A ***
10047747-A-G 10210138-A-G ***
10847007-A-T ***
10000080-A-T 10162471-A-T ***
9949361-G-A 10111752-G-A ***
9909133-T-A 10071524-T-A ***
9885648-T-A 10048039-T-A ***
9880873-G-A 10043264-G-A ***
9804999-A-G 9967390-A-G ***
9737764-A-T 9900155-A-T IR3_Prx ***
9724049-T-C 9886440-T-C IR3_Prx ***
9674502-C-A 9836893-C-A IR3_Prx ***
9617711-A-G 9780102-A-G IR3_Prx ***
9453451-C-A 9615842-C-A ***
9093488-C-T 9255879-C-T ***
10847005-C-T FT433903 ***
10847008-G-C ***
8888375-CTTT-C,CT 9020334-CTTT-C,CT 25×T***
13294189-T-G 11138513-T-G ***
13462077-C-CTTCCTTCACGGATAGAGGGCCTGGAACACTCCAGAGTCCCACGGAGGTTAAGTTCCACACTCCCCTCCAACCTCCCAGGCTGGTTTCT 11306401-C-CTTCCTTCACGGATAGAGGGCCTGGAACACTCCAGAGTCCCACGGAGGTTAAGTTCCACACTCCCCTCCAACCTCCCAGGCTGGTTTCT ***
13453840-CTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCAT-C 11298164-CTCCATTCCATTCCATTCCATTCCATTCCATTCCATTCCAT-C 10×TCCAT***
13453626-T-C 11297950-T-C ***
13451866-C-CCATT 11296190-C-CCATT ***
13451865-A-ATT 11296189-A-ATT ***
11294851-T- ***
11294850-C- ***
11294429-TCCACTCCACCCCATCCCATC- ***
13448260-T-C,TTCCACTCC 11292584-T-C,TTCCACTCC ***
13436027-C-T 11280351-C-T ***
13352950-A-G 11197274-A-G ***
13339837-C-T 11184161-C-T ***
13286667-A-AC 11130991-A-AC ***
10889261-G- ***
13276287-T-C 11120611-T-C ***
13273371-C-CTT 11117695-C-CTT 10×T***
13270646-G-T 11114970-G-T ***
13222271-AGG-A 11066595-AGG-A ***
10986820-T-TCAACTGCATTCCAGTCCATTCCATTACGCA ***
10986810-A-ACTCCACT ***
10986808-T-TTGTTC ***
10986804-A-ATTCTGGTTCCTTCCATTCC ***
10986803-T-TTTGTTCCGTTTC ***
10958868-T-G ***
10953726-TCACTC-T ***
10932518-TTCATTCC-T ***
10908294-C-CTA ***
9047176-C-T 9209567-C-T ***
8757661-G-A 8889620-G-A ***
4380195-C-T 4512154-C-T ***
4937668-T-C 5069627-T-C ***
5607521-T-G 5739480-T-G ***
5588594-T-TAA 5720553-T-TAA 15×A***
5450435-A-T 5582394-A-T ***
5385822-T-C 5517781-T-C ***
5367523-T-C 5499482-T-C ***
5360467-CT-C,C 5492426-CT-C,C 11×T***
5337399-C-T 5469358-C-T 8×T***
5222051-CA-C 5354010-CA-C 8×A***
5189977-TG-T 5321936-TG-T ***
5178157-T-C 5310116-T-C ***
5084715-T-C 5216674-T-C ***
5041200-T-C 5173159-T-C ***
4937663-T-G 5069622-T-G ***
5684363-G-A 5816322-G-A ***
4842253-A-T 4974212-A-T ***
4822395-A-C 4954354-A-C ***
4753917-G-A 4885876-G-A ***
4710853-A-T 4842812-A-T ***
4688257-C-T 4820216-C-T ***
4621146-G-GA 4753105-G-GA ***
4584218-T-C 4716177-T-C ***
4556032-T-C 4687991-T-C ***
4510657-T-C 4642616-T-C ***
4495973-C-T 4627932-C-T ***
4454086-G-A 4586045-G-A ***
4437018-TAA-T 4568977-TAA-T ***
4415304-C-T 4547263-C-T ***
5655542-A-G 5787501-A-G ***
5769175-CTT-C,CT 5901134-CTT-C,CT 17×T***
8647758-T-C 8779717-T-C ***
6448276-A-G 6580235-A-G ***
8274571-CTTT-C 8406530-CTTT-C 12×T***
8059411-G-T 8191370-G-T ***
7986693-A-T 8118652-A-T ***
7730515-G-C,C 7862474-G-C,C ***
7484972-G-A 7616931-G-A IR1_L ***
7321464-TCAA-T 7453423-TCAA-T ***
7303055-A-G 7435014-A-G ***
7002979-T-G 7134938-T-G ***
6997225-ATT-A 7129184-ATT-A 11×T***
6795852-C-CTT 6927811-C-CTT 10×T***
6744290-TA-T 6876249-TA-T ***
6520929-A-G 6652888-A-G ***
6447797-G-T 6579756-G-T ***
5785654-T-TAAA 5917613-T-TAAA 24×A***
6413649-C-T 6545608-C-T ***
6090689-T-C 6222648-T-C ***
6084992-C-A 6216951-C-A FT166938 ***
6052728-CT-C 6184687-CT-C ***
6048171-G-T 6180130-G-T ***
6044801-C-A 6176760-C-A ***
6040928-CAAA-C 6172887-CAAA-C 12×A***
5951659-T-A 6083618-T-A ***
5942146-A-G 6074105-A-G ***
5930377-G-A 6062336-G-A ***
5905300-T-G 6037259-T-G ***
5863111-A-AT 5995070-A-AT 9×T***
5788505-G-A 5920464-G-A ***
9964027-C-A 10126418-C-A ***
13488169-G-A 11332493-G-A ***
13838476-G-T 11717770-G-T ***
10041793-C-A 10204184-C-A ***
13286035-G-A 11130359-G-A ***
13285744-C-G 11130068-C-G ***
13282461-C-A 11126785-C-A ***
13273033-C-T 11117357-C-T ***
13272878-C-G 11117202-C-G ***
13272793-G-A 11117117-G-A ***
13271447-A-G 11115771-A-G ***
13269524-C-T 11113848-C-T ***
13267505-C-T 11111829-C-T ***
13254537-A-T 11098861-A-T ***
13241673-G-A 11085997-G-A ***
10054386-C-G 10216777-C-G ***
10054351-C-T 10216742-C-T ***
10041614-G-C 10204005-G-C ***
13294654-C-G 11138978-C-G ***
10029301-G-A 10191692-G-A FT376559 ***
10025620-C-A 10188011-C-A ***
9985090-T-C 10147481-T-C ***
9976938-T-G 10139329-T-G A13042 ***
9975261-G-A 10137652-G-A ***
9964967-G-A 10127358-G-A ***
9936816-C-A 10099207-C-A ***
9936735-T-A 10099126-T-A ***
6617575-T-C 6749534-T-C ***
6402502-TGTC-T 6534461-TGTC-T ***
6155120-A-G 6287079-A-G FGC7599 IR3_Dst ***
5739796-AAC-A 5871755-AAC-A ***
5334032-G-T 5465991-G-T ***
13286736-C-T 11131060-C-T ***
13305014-T-C 11149338-T-C ***
13466012-C-G 11310336-C-G ***
13479003-G-T 11323327-G-T ***
14102802-A-G 11982096-A-G ***
14077205-C-T 11956499-C-T ***
13722901-T-A 11567225-T-A ***
13722716-A-T 11567040-A-T ***
13722284-G-A 11566608-G-A ***
13722248-G-A 11566572-G-A ***
13694209-A-G 11538533-A-G ***
13692331-G-A 11536655-G-A BY47664 ***
13688121-G-A 11532445-G-A ***
13562103-G-C 11406427-G-C ***
13562095-G-C 11406419-G-C ***
13487760-C-CAT 11332084-C-CAT ***
13481776-T-G 11326100-T-G ***
13468786-G-T 11313110-G-T ***
13358504-G-C 11202828-G-C ***
13468467-G-A 11312791-G-A ***
13468450-A-T 11312774-A-T ***
13466560-A-G 11310884-A-G BY51506 ***
13466450-G-C 11310774-G-C ***
13460851-T-G 11305175-T-G ***
13453693-C-T 11298017-C-T ***
13446330-G-T 11290654-G-T ***
13436206-G-A 11280530-G-A ***
13393299-A-G 11237623-A-G ***
13389943-A-G 11234267-A-G ***
13389937-C-T 11234261-C-T ***
13382511-A-G 11226835-A-G ***
13382379-GAGA-G 11226703-GAGA-G ***
13358527-C-T 11202851-C-T ***
59027475-A-AG 56881328-A-AG ***
13468517-C-G 11312841-C-G ***
17557147-GTC-G 15445267-GTC-G ***
13482712-C-G 11327036-C-G ***
14102798-A-G 11982092-A-G BY30860 ***
13696674-T-C 11540998-T-C ***
13641545-A-C 11485869-A-C 8×C***
13634916-G-A 11479240-G-A ***
13622461-T-G 11466785-T-G ***
13574524-T-C 11418848-T-C ***
13574443-A-T 11418767-A-T ***
13574421-A-G 11418745-A-G ***
13569087-T-C 11413411-T-C ***
13549880-G-GTA 11394204-G-GTA ***
13542965-A-AAAT 11387289-A-AAAT ***
13509965-G-A 11354289-G-A ***
13503433-T-C 11347757-T-C ***
13480875-G-A 11325199-G-A ***
14698478-C-A 12586544-C-A BY1112 ***
13480874-T-A 11325198-T-A ***
13454881-C-A 11299205-C-A ***
13454872-C-T 11299196-C-T ***
13374539-C-A 11218863-C-A ***
13364241-A-G 11208565-A-G ***
13358568-C-T 11202892-C-T ***
13346004-C-T 11190328-C-T ***
13332020-A-C 11176344-A-C ***
13322480-A-T 11166804-A-T ***
13322474-G-A 11166798-G-A ***
13305017-C-T 11149341-C-T ***
13304700-G-A 11149024-G-A ***
13291896-G-GGT 11136220-G-GGT ***
14383734-CCT-C 12263030-CCT-C ***
15938096-T-TAC 13826216-T-TAC ***
9958028-AT-A 10120419-AT-A ***
24604697-AT-A 22458550-AT-A P3_t2 11×T***
22509188-A-G 20347302-A-G DYZ19 ***
9804915-G-A 9967306-G-A ***
13472643-C-T 11316967-C-T FGC19510 ***
22298332-A-G 20136446-A-G BY216669 DYZ19 ***
22298327-C-G 20136441-C-G FT455398 DYZ19 ***
13463882-G-A 11308206-G-A ***
21182165-G-GA 19020279-G-GA 10×A***
8724619-C-CT 8856578-C-CT 12×T***
28587435-A-C 26441288-A-C ***
13484017-T-A,C 11328341-T-A,C ***
13484409-G-A 11328733-G-A ***
7123133-T-C 7255092-T-C ***
13463637-C-G 11307961-C-G ***
28814074-G-T 26667927-G-T ***
16941388-C-CGT 14829508-C-CGT 11×GT***
13734188-A-T 11578512-A-T ***
22737231-CAAAAA-C 20575345-CAAAAA-C 18×A***
7783780-GAA-G 7915739-GAA-G 12×A***
59032481-A-C 56886334-A-C ***
59026811-GT-G 56880664-GT-G ***
59020952-C-CGG 56874805-C-CGG ***
59000538-C-A 56854391-C-A ***
28780709-A-C 26634562-A-C ***
28594590-TTG-T 26448443-TTG-T 10×TG***
28587061-T-C 26440914-T-C ***
25250655-C-G 23104508-C-G P2_r1 ***
23962104-G-T 21815957-G-T F3570 PF6233 ***
22446630-G-T 20284744-G-T DYZ19 ***
19247433-AAG-A 17135553-AAG-A ***
17300616-A-C 15188736-A-C ***
17971650-AAAC-A 15859770-AAAC-A 8×AAC***
13269581-AC-A 11113905-AC-A ***
10054388-G-A 10216779-G-A ***
22228430-C-T 20066544-C-T DYZ19 ***
13460834-C-T 11305158-C-T ***
8075936-CTT-C 8207895-CTT-C 17×T***
58840851-T-C 56750020-A-G ***
13472035-A-G 11316359-A-G ***
13465961-G-A 11310285-G-A ***
10028169-T-C 10190560-T-C ***
59026969-T-TTA 56880822-T-TTA ***
13484622-A-T 11328946-A-T ***
13484602-C-A 11328926-C-A ***
10075716-G-T 10238107-G-T FT427320 ***
10075712-G-T 10238103-G-T ***
10075709-A-G 10238100-A-G ***
9964292-C-A 10126683-C-A ***
17078004-A-AT 14966124-A-AT 11×T***
9964269-T-A 10126660-T-A ***
9939183-A-G 10101574-A-G ***
10054340-A-G 10216731-A-G ***
5104781-G-GT 5236740-G-GT 10×T***
17744399-G-GT 15632519-G-GT 10×T***
13196295-G-A 11040619-G-A 4×TTCCA***
13196294-T-C 11040618-T-C ***
13468512-A-G 11312836-A-G ***
8143991-G-GA 8275950-G-GA 11×A***
13737187-C-G 11581511-C-G ***
4839002-CTT-C 4970961-CTT-C 16×T***
5178199-CAA-C 5310158-CAA-C 15×A***
13484264-T-C 11328588-T-C ***
13452608-CTCCAT-C 11296932-CTCCAT-C ***
13464006-G-A 11308330-G-A ***
13468331-G-C 11312655-G-C ***
28813686-A-C 26667539-A-C ***
22488233-T-G 20326347-T-G DYZ19 ***
13468428-T-G 11312752-T-G ***
13468404-G-T 11312728-G-T ***
22509187-A-C 20347301-A-C DYZ19 ***
13745082-G-C 11589406-G-C ***
22480260-G-C 20318374-G-C DYZ19 ***
16988453-TA-T 14876573-TA-T 10×A***
13504934-A-T 11349258-A-T ***
13504920-A-ATTTG 11349244-A-ATTTG ***
10041552-TA-T 10203943-TA-T ***
13488813-C-T 11333137-C-T ***
13518351-T-C 11362675-T-C ***
18904499-C-CT 16792619-C-CT 10×T***
19470013-C-CA 17358133-C-CA 8×A***
22489969-G-T 20328083-G-T DYZ19 ***
13480984-C-T 11325308-C-T ***
13476553-T-A,C 11320877-T-A,C ***
13196169-A-T 11040493-A-T ***
13488159-G-C 11332483-G-C ***
23195586-CA-C 21033700-CA-C 10×A***
15781591-A-G 13669711-A-G BY104067 ***
20425803-CAA-C 18263917-CAA-C P5_Dst 15×A***
5770338-C-CTTTTT 5902297-C-CTTTTT 25×T***
15667773-GA-G 13555893-GA-G 11×A***
14642670-CT-C 12530739-CT-C 10×T***
13488170-C-A 11332494-C-A ***
13474613-C-G 11318937-C-G ***
13484445-C-T 11328769-C-T ***
13465445-A-T 11309769-A-T ***
13345990-A-G 11190314-A-G FGC50080 ***
24115164-CCA-C 21969017-CCA-C P3_b1 23×CA***
19071514-CCT-C 16959634-CCT-C ***
58999130-A-C 56852983-A-C ***
13480676-G-C 11325000-G-C ***
10075730-A-T 10238121-A-T ***
10075704-T-C 10238095-T-C ***
13489727-C-T 11334051-C-T ***
13484437-G-A 11328761-G-A ***
59032561-C-A 56886414-C-A ***
59032513-T-G 56886366-T-G ***
59029004-G-C 56882857-G-C ***
59028833-G-T 56882686-G-T ***
59013265-G-T 56867118-G-T ***
59000043-C-T 56853896-C-T ***
58999569-A-G 56853422-A-G ***
58999265-A-C 56853118-A-C ***
58998097-A-G 56851950-A-G ***
10028266-G-C 10190657-G-C ***
58994461-C-G 56848314-C-G ***
58994437-G-A 56848290-G-A ***
58991859-C-T 56845712-C-T ***
58982021-C-T 56835874-C-T ***
58980604-C-G 56834457-C-G ***
28809760-G-T 26663613-G-T ***
23396732-C-A 21234846-C-A ***
22752939-G-GT 20591053-G-GT 9×T***
22509920-C-A 20348034-C-A DYZ19 ***
22509156-A-G 20347270-A-G DYZ19 ***
22508458-C-G 20346572-C-G DYZ19 ***
22507990-T-A 20346104-T-A DYZ19 ***
22041023-AAC-A 19879137-AAC-A ***
19827457-TTG-T 17715577-TTG-T P5_Prx 11×TG***
13463941-G-T 11308265-G-T ***
13482008-TTA-T 11326332-TTA-T ***
58866285-T-C 56724586-A-G ***
14488773-CAAAA-C 12368042-CAAAA-C 16×A***
13484478-G-A 11328802-G-A BY210387 ***
13332210-C-G 11176534-C-G ***
5753522-CT-C 5885481-CT-C 10×T***
13461753-G-A 11306077-G-A FGC42178 ***
10082040-A-C 10244431-A-C ***
19513164-G-T 17401284-G-T ***
18984861-G-GA 16872981-G-GA 10×A***
22052900-C-CA 19891014-C-CA BY33010 10×A***
8272134-AT-A 8404093-AT-A 10×T***
13196330-A-T 11040654-A-T ***
13196320-A-C 11040644-A-C ***
15938078-C-CAT 13826198-C-CAT ***
9997296-T-G 10159687-T-G ***
13469483-T-C 11313807-T-C ***
13460802-A-G 11305126-A-G ***
22487471-T-A 20325585-T-A DYZ19 ***
22448747-G-C 20286861-G-C DYZ19 ***
13484085-T-A 11328409-T-A ***
9952269-A-AG 10114660-A-AG ***
9952266-AT-A 10114657-AT-A ***
13487818-G-T 11332142-G-T ***
13470552-C-A 11314876-C-A ***
13470546-G-A 11314870-G-A ***
13470543-C-T 11314867-C-T ***
13267546-T-C 11111870-T-C ***
13267570-T-A 11111894-T-A ***
13470580-G-A 11314904-G-A ***
22509970-C-T 20348084-C-T DYZ19 ***
13460822-G-T 11305146-G-T ***
13286631-C-T 11130955-C-T ***
13267524-A-G 11111848-A-G ***
22366410-T-G 20204524-T-G DYZ19 ***
22510612-G-A 20348726-G-A DYZ19 ***
26325206-ATG-A 24179059-ATG-A P1_Y1 14×TG***
13301339-G-A 11145663-G-A ***
13301291-A-G 11145615-A-G ***
9958303-A-G 10120694-A-G ***
22509927-G-T 20348041-G-T BY26596 DYZ19 ***
13487887-G-T 11332211-G-T ***
13481009-G-A 11325333-G-A ***
22247368-A-G 20085482-A-G DYZ19 ***
6402425-T-C 6534384-T-C FT75544 ***
58972530-G-C 56826383-G-C ***
59004623-G-GGAAA 56858476-G-GGAAA 16×GAAA***
23139032-T-TA 20977146-T-TA A7537 9×A***
22490722-C-T 20328836-C-T DYZ19 ***
7904490-C-CT 8036449-C-CT 13×T***
23435181-G-GTT 21273295-G-GTT 20×T***
13474253-C-G 11318577-C-G ***
13469154-G-C 11313478-G-C ***
13447603-G-C 11291927-G-C ***
9986844-A-G 10149235-A-G ***
22359735-T-A 20197849-T-A DYZ19 ***
13482443-CA-C 11326767-CA-C ***
13475878-A-C 11320202-A-C ***
13490021-G-A 11334345-G-A ***
22459121-T-A 20297235-T-A BY24515 DYZ19 ***
25037867-G-GA 22891720-G-GA g1 11×A***
58976477-C-T 56830330-C-T ***
22442280-C-G 20280394-C-G DYZ19 ***
22366307-G-C 20204421-G-C DYZ19 ***
19418524-T-TA 17306644-T-TA 12×A***
28795740-GGGGTC-G 26649593-GGGGTC-G ***
13483777-CTGT-C 11328101-CTGT-C ***
7542441-A-AT 7674400-A-AT Z17970 9×T***
22228529-T-A 20066643-T-A DYZ19 ***
13489770-G-A 11334094-G-A ***
23961933-GTA-G 21815786-GTA-G ***
7382657-CA-C 7514616-CA-C 11×A***
28806443-G-A 26660296-G-A ***
6130592-A-G 6262551-A-G ***
58976748-G-A 56830601-G-A ***
13448640-ATTCCATTCCATTCCATTCCAT-A 11292964-ATTCCATTCCATTCCATTCCAT-A ***
13857915-G-T 11737209-G-T ***
13513086-G-A 11357410-G-A BY86348 ***
22502629-G-T 20340743-G-T A4401 DYZ19 ***
22502673-G-T 20340787-G-T DYZ19 ***
18246092-CGT-C 16134212-CGT-C ***
9958291-C-A 10120682-C-A ***
21687951-A-AAC 19526065-A-AAC 17×AC***
13480662-T-A 11324986-T-A ***
13857868-A-T 11737162-A-T ***
13745195-G-T 11589519-G-T ***
28786681-A-G 26640534-A-G ***
7365426-CT-C 7497385-CT-C 11×T***
13196200-T-C 11040524-T-C ***
13469116-T-A 11313440-T-A ***
13473705-G-C 11318029-G-C F18179 ***
13475909-T-G 11320233-T-G ***
13196332-T-TC 11040656-T-TC ***
22295225-GT-G 20133339-GT-G DYZ19 ***
13488738-G-A 11333062-G-A ***
13447598-G-C 11291922-G-C ***
9958280-T-A 10120671-T-A ***
13545356-G-GAAGAAAGA 11389680-G-GAAGAAAGA 11×AAGA***
22228415-C-G 20066529-C-G BY165709 DYZ19 ***
22457523-C-G 20295637-C-G DYZ19 ***
22442096-A-G 20280210-A-G DYZ19 ***
6265215-TAC-T 6397174-TAC-T IR3_Dst ***
58978963-A-C 56832816-A-C ***
22428590-T-C 20266704-T-C FGC69461 DYZ19 ***
13600365-AAGAGGAC-A 11444689-AAGAGGAC-A ***
13403066-G-A 11247390-G-A ***
9954479-A-G 10116870-A-G ***
22505719-T-A 20343833-T-A DYZ19 ***
58974081-T-G 56827934-T-G ***
13475849-C-T 11320173-C-T BY35759 ***
9962395-A-T 10124786-A-T ***
13447579-CATTGT-C 11291903-CATTGT-C ***
8992722-C-CT 9155113-C-CT 14×T***
24305272-CA-C 22159125-CA-C P3_t1 21×A***
13712461-T-C 11556785-T-C ***
13487989-C-T 11332313-C-T ***
13471867-C-T 11316191-C-T ***
13450513-CCACTCCACTT-C 11294837-CCACTCCACTT-C ***
58858965-C-T 56731906-G-A ***
28794316-G-T 26648169-G-T ***
28794313-T-G 26648166-T-G ***
27053578-TA-T 24907431-TA-T P1_r4 11×A***
22502698-G-C 20340812-G-C DYZ19 ***
22502690-A-C 20340804-A-C DYZ19 ***
22502655-A-T 20340769-A-T DYZ19 ***
22502642-C-T 20340756-C-T DYZ19 ***
22502575-G-A 20340689-G-A DYZ19 ***
22441648-T-G 20279762-T-G DYZ19 ***
22281811-A-C 20119925-A-C DYZ19 ***
13486303-T-C 11330627-T-C ***
13857935-A-G 11737229-A-G ***
13701308-T-G 11545632-T-G ***
13473880-A-G 11318204-A-G ***
13476494-A-C,T 11320818-A-C,T ***
22502634-G-A 20340748-G-A DYZ19 ***
13332083-C-T 11176407-C-T ***
7002980-C-A 7134939-C-A ***
13745206-A-G 11589530-A-G ***
7307494-TAG-T 7439453-TAG-T 11×AG***
13349694-A-G 11194018-A-G ***
13450448-C-G 11294772-C-G ***
8504198-TTGTG-T 8636157-TTGTG-T 19×TG***
23593798-TCA-T 21431912-TCA-T 11×CA***
20603820-AAG-A 18441934-AAG-A P5_Dst 10×AG***
13479004-C-T 11323328-C-T ***
13478261-G-A 11322585-G-A ***
13476665-C-T 11320989-C-T ***
22281813-C-T 20119927-C-T DYZ19 ***
26101362-CA-C 23955215-CA-C P1_Y1 17×A***
13857885-C-T 11737179-C-T ***
58977805-G-T 56831658-G-T ***
22490766-A-T 20328880-A-T DYZ19 ***
22481632-G-A 20319746-G-A DYZ19 ***
22481631-A-T 20319745-A-T DYZ19 ***
22481616-T-A 20319730-T-A DYZ19 ***
13473684-C-G 11318008-C-G ***
13196140-T-C 11040464-T-C ***
28796289-A-G 26650142-A-G ***
13478662-C-A 11322986-C-A ***
13478661-A-G 11322985-A-G ***
9966104-A-G 10128495-A-G PF404 ***
13711046-G-A 11555370-G-A BY27337 ***
13476527-T-A,G 11320851-T-A,G ***
26834792-G-T 24688645-G-T FGC20403 P1_g2 ***
22466041-G-T 20304155-G-T FT458642 DYZ19 ***
13266346-C-G 11110670-C-G ***
13489695-C-T 11334019-C-T ***
13484640-T-G 11328964-T-G ***
4389597-C-CT 4521556-C-CT 15×T***
59017778-A-AT 56871631-A-AT 10×AT***
22509039-G-T 20347153-G-T BY3989BY196744 DYZ19 ***
13857947-A-T 11737241-A-T FT328809 ***
13857921-C-T 11737215-C-T ***
13857852-A-C 11737146-A-C ***
17709787-GT-G 15597907-GT-G 11×T***
22279247-T-C 20117361-T-C DYZ19 ***
13635126-C-A 11479450-C-A ***
13470902-C-A 11315226-C-A ***
13464098-G-T 11308422-G-T ***
13464117-A-T 11308441-A-T ***
13745377-A-T 11589701-A-T ***
8550913-GCA-G 8682872-GCA-G 8×CA***
13745274-C-G 11589598-C-G ***
9974347-CAAA-C 10136738-CAAA-C ***
13857887-A-C 11737181-A-C ***
59006962-T-TAA 56860815-T-TAA 8×A***
26400702-C-T 24254555-C-T P1_Y1 ***
18639348-GT-G 16527468-GT-G 11×T***
22487550-A-C 20325664-A-C A12395BY34890 DYZ19 ***
22487469-G-C 20325583-G-C BY196746 DYZ19 ***
21928979-AAG-A 19767093-AAG-A ***
24095498-ACTCT-A 21949351-ACTCT-A P3_b1 13×CT***
13450411-CTCCATTCCATTCCATTCTATTCCATTCCATTCCAT-C 11294735-CTCCATTCCATTCCATTCTATTCCATTCCATTCCAT-C ***
14486459-G-GGT 12365728-G-GGT 9×GT***
5084471-GTTTC-G 5216430-GTTTC-G ***
13196402-C-A 11040726-C-A ***
21570706-G-GA 19408820-G-GA 11×A***
18804474-A-AAG 16692594-A-AAG 26×AG***
9995876-G-A 10158267-G-A ***
13264955-G-A 11109279-G-A ***
13264729-T-A 11109053-T-A Z37138 ***
13263609-C-T 11107933-C-T ***
13260296-T-G 11104620-T-G ***
13241687-A-G 11086011-A-G ***
13223453-G-A 11067777-G-A ***
10068818-C-A 10231209-C-A A4928 ***
10062563-G-C 10224954-G-C ***
10041603-A-C 10203994-A-C ***
10041584-A-C 10203975-A-C ***
10028213-T-C 10190604-T-C ***
10028180-A-G 10190571-A-G ***
9995880-C-A 10158271-C-A ***
9966176-T-G 10128567-T-G ***
13283255-CT-C 11127579-CT-C ***
9966166-T-C 10128557-T-C ***
9966157-G-A 10128548-G-A ***
8422302-CTG-C 8554261-CTG-C ***
6346315-CAT-C 6478274-CAT-C ***
6002047-G-T 6134006-G-T ***
5997998-T-A 6129957-T-A ***
5833035-A-G 5964994-A-G FT325203 ***
5744718-T-C 5876677-T-C FT324939 ***
5331254-A-C 5463213-A-C ***
4953820-T-TTG 5085779-T-TTG 16×TG***
3456103-G-A 3588062-G-A ***
3249936-C-T 3381895-C-T ***
3240893-C-T 3372852-C-T K541 ***
3087945-A-T 3219904-A-T ***
13214289-A-ATC 11058613-A-ATC 19×T***
9977949-T-A 10140340-T-A ***
22475307-G-T 20313421-G-T BY223330 DYZ19 ***
13428048-T-G 11272372-T-G ***
13196173-C-A 11040497-C-A ***
13478109-G-T 11322433-G-T ***
22475235-C-T 20313349-C-T DYZ19 ***
13267431-CAAA-C 11111755-CAAA-C 16×A***
13485439-G-T 11329763-G-T ***
22480249-T-G 20318363-T-G BY25230 DYZ19 ***
22481444-G-T 20319558-G-T DYZ19 ***
59007959-CAAAAAAAA-C 56861812-CAAAAAAAA-C 26×A***
13562043-TAA-T 11406367-TAA-T ***
59027472-T-TAAA 56881325-T-TAAA 11×A***
22475516-C-G 20313630-C-G FGC9722 DYZ19 ***
13482013-G-GA 11326337-G-GA ***
13428067-C-T 11272391-C-T ***
9936818-A-T 10099209-A-T ***
13720993-T-TATGGA 11565317-T-TATGGA ***
13428072-A-T 11272396-A-T ***
13389947-T-C 11234271-T-C ***
13488888-G-T 11333212-G-T ***
13291125-C-T 11135449-C-T ***
6432160-GA-G 6564119-GA-G 11×A***
13460523-C-G 11304847-C-G ***
13484841-T-G 11329165-T-G ***
15420840-TAC-T 13308960-TAC-T ***
13488215-C-G 11332539-C-G ***
13484364-G-A 11328688-G-A ***
22505681-A-T 20343795-A-T DYZ19 ***
13489779-G-A 11334103-G-A ***
13482806-A-T 11327130-A-T ***
22502986-A-C 20341100-A-C DYZ19 ***
13451631-ATCCAT-A 11295955-ATCCAT-A 4×TCCAT***
13734111-G-A 11578435-G-A ***
13294597-G-T 11138921-G-T ***
13484666-G-T 11328990-G-T ***
13470634-C-A 11314958-C-A ***
13482440-T-TC 11326764-T-TC ***
6776606-AAC-A 6908565-AAC-A 9×AC***
18396936-A-AT 16285056-A-AT P6_Gap 10×T***
22228437-A-C 20066551-A-C FT453083 DYZ19 ***
13488148-A-G 11332472-A-G ***
13488134-A-G 11332458-A-G ***
13482721-G-A 11327045-G-A ***
13464112-C-G 11308436-C-G ***
13857854-T-C 11737148-T-C ***
13857847-A-T 11737141-A-T ***
22298397-C-T 20136511-C-T DYZ19 ***
22502697-G-A 20340811-G-A A4403 DYZ19 ***
13484627-C-G 11328951-C-G ***
22298196-C-T 20136310-C-T DYZ19 ***
15179010-C-CA 13067096-C-CA 25×A***
22127975-C-CT 19966089-C-CT 20×T***
13517368-GACT-G 11361692-GACT-G ***
13383436-A-C 11227760-A-C ***
13135804-A-G 10625290-A-G ***
13600329-G-A 11444653-G-A ***
18043102-AACAC-A 15931222-AACAC-A 13×AC***
13488203-G-T 11332527-G-T ***
28583694-C-G 26437547-C-G CTS12380 ***
13483759-T-A 11328083-T-A ***
13246481-A-G 11090805-A-G ***
25511351-AT-A 23365204-AT-A P1_gr1 14×T***
13482292-T-C 11326616-T-C ***
13482288-C-G 11326612-C-G ***
22509120-C-A 20347234-C-A DYZ19 ***
13196304-C-A 11040628-C-A ***
18196517-T-A 16084637-T-A ***
10028237-G-A 10190628-G-A ***
13470449-G-A 11314773-G-A ***
10693720-A-G ***
10693710-GTTGCA-G ***
13712638-T-G 11556962-T-G ***
28786727-T-A 26640580-T-A ***
28786717-T-A 26640570-T-A ***
13468271-G-C 11312595-G-C ***
13462354-C-A 11306678-C-A ***
13347874-C-T 11192198-C-T ***
28806362-C-A 26660215-C-A ***
28786710-A-C 26640563-A-C ***
13463154-A-T 11307478-A-T ***
15926052-ATT-A 13814172-ATT-A 11×T***
10028195-A-G 10190586-A-G ***
19292325-C-CT 17180445-C-CT 9×T***
10028176-G-A 10190567-G-A ***
10028173-G-A 10190564-G-A ***
10028171-T-A 10190562-T-A ***
10028170-G-A 10190561-G-A ***
10028154-G-A 10190545-G-A ***
11026249-C-A ***
13700690-A-C 11545014-A-C ***
4044629-G-GA 4176588-G-GA 11×A***
17580921-G-A 15469041-G-A ***
13472216-C-T 11316540-C-T ***
13472161-G-A 11316485-G-A ***
4509423-G-A 4641382-G-A FT235379 ***
13463871-G-T 11308195-G-T ***
13695491-G-T 11539815-G-T ***
13222280-G-C 11066604-G-C ***
4521425-G-GCA 4653384-G-GCA 10×CA***
13460499-A-T 11304823-A-T ***
13345944-G-C 11190268-G-C ***
9995971-T-G 10158362-T-G ***
9995885-C-A 10158276-C-A ***
13466013-A-G 11310337-A-G ***
58833917-C-T 56756954-G-A ***
28812550-G-T 26666403-G-T ***
13572046-T-A 11416370-T-A ***
4151936-CAAA-C 4283895-CAAA-C 17×A***
3970482-G-GA 4102441-G-GA 12×A***
13475488-A-T 11319812-A-T ***
16271807-G-A 14159927-G-A 19×A***
13465124-G-T 11309448-G-T ***
14814998-C-CT 12703069-C-CT 10×T***
22505732-T-G 20343846-T-G DYZ19 ***
13483363-AT-A 11327687-AT-A ***
13719524-C-T 11563848-C-T ***
13636850-T-TA 11481174-T-TA 10×A***
13593090-C-T 11437414-C-T ***
13408481-C-A 11252805-C-A ***
13404002-G-C 11248326-G-C ***
13269822-T-G 11114146-T-G ***
13480837-C-T 11325161-C-T ***
9966120-AAAAT-A 10128511-AAAAT-A ***
3960483-T-TA 4092442-T-TA 9×A***
18978747-G-A 16866867-G-A ***
16336891-T-G 14225011-T-G ***
13748448-G-A 11592772-G-A ***
13474671-A-G 11318995-A-G ***
14276252-TA-T 12155546-TA-T 9×A***
19476603-C-CTT 17364723-C-CTT 13×T***
5854566-CAA-C 5986525-CAA-C 16×A***
22447664-T-A 20285778-T-A DYZ19 ***
13458701-C-T 11303025-C-T ***
16548363-T-TAA 14436483-T-TAA 15×A***
11031280-A-C ***
13488951-TTC-T 11333275-TTC-T ***
13466301-G-T 11310625-G-T ***
13465094-C-A 11309418-C-A ***
3400566-G-GA 3532525-G-GA 10×A***
9975213-C-T 10137604-C-T ***
10054290-G-A 10216681-G-A ***
18934769-GT-G 16822889-GT-G 10×T***
13489081-G-T 11333405-G-T ***
6413855-C-CT 6545814-C-CT 14×T***
27423977-G-T 25277830-G-T P1_g3 ***
13482489-G-A 11326813-G-A ***
9966108-G-A 10128499-G-A ***
6943972-CT-C,CTT 7075931-CT-C,CTT 15×T***
56851130-G-T ***
10826971-TTGCAC-T ***
10826962-TCCATG-T ***
10826956-T-A ***
13468287-A-G 11312611-A-G ***
19368360-G-GA 17256480-G-GA 9×A***
13475869-G-A 11320193-G-A ***
13468555-G-T 11312879-G-T ***
9114145-CTT-C ***
13447137-CATTCCATTCCATTCCATTCT-C 11291461-CATTCCATTCCATTCCATTCT-C ***
28497838-GA-G 26351691-GA-G 10×A***
3788963-AT-A 3920922-AT-A 10×T***
17419439-ATT-A,AT 15307559-ATT-A,AT 25×T***
13489129-C-G 11333453-C-G ***
10651691-A-G ***
7468573-C-G 7600532-C-G IR1_L ***
13460514-C-T 11304838-C-T ***
10997225-T-C ***
19429659-C-T 17317779-C-T ***
14396441-CA-C 12275737-CA-C 9×A***
56838232-G-C ***
10846965-CTCAAA-C ***
5626506-C-CT 5758465-C-CT 10×T***
21932179-CA-C 19770293-CA-C 9×A***
5756655-T-TA 5888614-T-TA 9×A***
13475487-G-T 11319811-G-T ***
27964790-A-AT 25818643-A-AT P1_Y2 10×T***
10912943-G-C ***
13466410-G-T 11310734-G-T ***
13469488-A-T 11313812-A-T ***
2970371-G-A 3102330-G-A ***
10997220-T-G ***
7144247-C-CT 7276206-C-CT 9×T***
10997218-G-C ***
13472102-C-T 11316426-C-T ***
56861288-T-TATA ***
3342287-AT-A 3474246-AT-A 10×T***
17632570-G-GTTT 15520690-G-GTTT 22×T***
13705562-A-C 11549886-A-C ***
10651613-C-A ***
10651611-T-A ***
10062593-G-A 10224984-G-A ***
8199579-T-TA 8331538-T-TA 10×A***
17580919-T-A 15469039-T-A ***
18857575-CTTTT-C 16745695-CTTTT-C 15×T***
13480951-C-T 11325275-C-T ***
18060031-CTT-C 15948151-CTT-C 11×T***
13345946-C-A 11190270-C-A ***
22510127-G-A 20348241-G-A FT460741 DYZ19 ***
7085874-GA-G 7217833-GA-G 10×A***
23310285-GT-G 21148399-GT-G 10×T***
56850518-A-G ***
13479138-C-G 11323462-C-G ***
13375727-A-G 11220051-A-G ***
13467874-A-C 11312198-A-C ***
13467868-T-A 11312192-T-A ***
3080986-T-TA 3212945-T-TA 10×A***
5109180-A-AT 5241139-A-AT 11×T***
13475365-G-T 11319689-G-T ***
56838239-A-T ***
13469581-C-G 11313905-C-G ***
13469577-T-A 11313901-T-A ***
22520822-G-T 20358936-G-T ***
28786668-G-A 26640521-G-A ***
56853008-G-A ***
13488687-G-A 11333011-G-A ***
13484475-A-G 11328799-A-G ***
13484470-T-C 11328794-T-C ***
13428056-G-A 11272380-G-A ***
13252783-G-GT 11097107-G-GT 11×T***
17951299-ATT-A,ATTT 15839419-ATT-A,ATTT 25×T***
28807405-G-A 26661258-G-A ***
28807391-C-G 26661244-C-G ***
13470238-G-C 11314562-G-C ***
6667819-C-CT 6799778-C-CT 9×T***
13273688-TTTTC-T 11118012-TTTTC-T ***
5742075-TA-T 5874034-TA-T 10×A***
4248768-G-GT 4380727-G-GT 10×T***
10041574-T-C 10203965-T-C ***
13484967-C-T 11329291-C-T ***
15253981-GA-G 13142067-GA-G 9×A***
13448836-C-CTGCAT 11293160-C-CTGCAT ***
3915436-TA-T 4047395-TA-T 9×A***
13489806-C-G 11334130-C-G ***
9975197-T-G 10137588-T-G ***
7935855-TAA-T,TAAA 8067814-TAA-T,TAAA 22×A***
13475376-C-A 11319700-C-A ***
19275277-G-A 17163397-G-A ***
13462378-C-T 11306702-C-T ***
58883892-C-G 56706979-G-C ***
16010265-C-A 13898385-C-A ***
13470547-C-A 11314871-C-A ***
13468384-G-C,T 11312708-G-C,T ***
23992318-T-TA 21846171-T-TA 10×A***
13468453-G-A 11312777-G-A ***
13470837-G-A 11315161-G-A ***
10041567-A-C 10203958-A-C ***
17300602-C-T 15188722-C-T ***
28806350-A-C 26660203-A-C ***
13482700-C-A 11327024-C-A ***
13463315-C-A 11307639-C-A ***
18196518-C-A 16084638-C-A ***
13457973-C-CTCCGTTCCGT 11302297-C-CTCCGTTCCGT 7×TCCGT***
5905301-C-A 6037260-C-A ***
13196176-C-T 11040500-C-T ***
13484675-C-T 11328999-C-T ***
28807421-G-T 26661274-G-T ***
13499311-T-C 11343635-T-C ***
10777714-T-C ***
22772586-G-GA 20610700-G-GA ***
13480922-C-G 11325246-C-G ***
13468362-C-T 11312686-C-T ***
10041565-G-A 10203956-G-A ***
13489151-T-A 11333475-T-A ***
13469557-C-T 11313881-C-T ***
58876784-C-A 56714087-G-T ***
3963763-G-GA 4095722-G-GA 11×A***
4871454-T-TA 5003413-T-TA 10×A***
7200269-CTTTT-C,CTTT 7332228-CTTTT-C,CTTT 16×T***
4488327-G-GA 4620286-G-GA 10×A***
13460530-T-A 11304854-T-A ***
10950863-C-T ***
7579075-T-C 7711034-T-C ***
13482496-G-A 11326820-G-A ***
16885440-G-GA 14773560-G-GA 10×A***
2932041-C-CA 3064000-C-CA 9×A***
13480625-G-C 11324949-G-C ***
13481024-C-T 11325348-C-T ***
58884147-C-A 56706724-G-T ***
2708411-CGAGA-C,CGA 2840370-CGAGA-C,CGA 23×GA***
4174046-C-CA 4306005-C-CA 8×A***
14501814-A-C 12390019-A-C ***
2955378-CATAT-C 3087337-CATAT-C 9×AT***
16084334-A-G 13972454-A-G ***
56830209-A-ACTCCACTCCT ***
16336922-A-T 14225042-A-T ***
13453692-C-A 11298016-C-A ***
13696925-G-C 11541249-G-C ***
3141361-G-A 3273320-G-A ***
28812557-G-A 26666410-G-A ***
13458694-T-A 11303018-T-A ***
13275218-C-T 11119542-C-T ***
13480974-C-A 11325298-C-A ***
10958841-C-T ***
3744243-CT-C 3876202-CT-C 11×T***
13480903-T-A 11325227-T-A ***
16833655-T-TAC 14721775-T-TAC 17×AC***
10846974-A-G ***
28794794-T-G 26648647-T-G ***
3006331-G-GT 3138290-G-GT 10×T***
13272696-A-G 11117020-A-G ***
13480884-G-T 11325208-G-T ***
13470582-C-T 11314906-C-T ***
56822065-T-C ***
13487853-G-A 11332177-G-A ***
13483704-G-C 11328028-G-C ***
17170167-CT-C,CTT 15058287-CT-C,CTT 21×T***
15611907-CA-C 13500027-CA-C 8×A***
5235847-T-TAC 5367806-T-TAC 11×AC***
13468089-G-T 11312413-G-T ***
13438425-T-A 11282749-T-A ***
28794799-T-G 26648652-T-G ***
13267803-G-A,C 11112127-G-A,C ***
13489729-CTGG-C 11334053-CTGG-C ***
3512413-G-A 3644372-G-A ***
22474770-C-T 20312884-C-T SUR47 DYZ19 ***
28814100-T-C 26667953-T-C ***
4686573-CAAA-C 4818532-CAAA-C 15×A***
13474049-G-T 11318373-G-T ***
13483811-A-C 11328135-A-C ***
16336783-T-C 14224903-T-C ***
6863818-CTTT-C,CTT 6995777-CTTT-C,CTT 21×T***
13465137-C-A 11309461-C-A ***
10847000-A-T ***
13480333-G-A 11324657-G-A ***
13474343-C-T 11318667-C-T ***
10982756-G-A ***
10028252-T-C 10190643-T-C ***
13470436-C-T 11314760-C-T ***
13472178-T-A 11316502-T-A ***
9977661-G-A 10140052-G-A ***
13483762-C-G 11328086-C-G ***
13487874-C-A 11332198-C-A ***
13135801-T-G 10625287-T-G ***
21287545-GA-G 19125659-GA-G 10×A***
16288086-C-CT 14176206-C-CT 11×T***
13487885-C-G 11332209-C-G ***
58866099-A-C 56724772-T-G ***
13857855-T-A 11737149-T-A ***
22439472-T-A 20277586-T-A DYZ19 ***
22475549-C-A 20313663-C-A DYZ19 ***
58972562-T-C 56826415-T-C ***
28803377-C-G 26657230-C-G ***
16196502-GA-G 14084622-GA-G FGC43114 10×A***
13476778-G-T 11321102-G-T ***
13461101-T-C 11305425-T-C ***
23273183-GA-G 21111297-GA-G Z34614 10×A***
13480999-A-G 11325323-A-G ***
28802727-T-G 26656580-T-G ***
22508077-T-A 20346191-T-A DYZ19 ***
13688176-G-A 11532500-G-A ***
13207274-CTTT-C 11051598-CTTT-C 16×T***
10023952-GTC-G 10186343-GTC-G ***
4807506-AT-A 4939465-AT-A 10×T***
13468003-A-C 11312327-A-C ***
22509142-T-C 20347256-T-C DYZ19 ***
13449080-C-A 11293404-C-A ***
13347859-G-A 11192183-G-A ***
13347854-G-T 11192178-G-T ***
13347851-T-C 11192175-T-C ***
2806030-ATTT-A 2937989-ATTT-A 16×T***
13474053-A-T 11318377-A-T ***
13478687-C-T 11323011-C-T ***
9986899-A-G 10149290-A-G ***
14519570-G-GA 12407771-G-GA 11×A***
9105202-CAA-C 9267593-CAA-C 15×A***
5621263-A-AGT 5753222-A-AGT 10×GT***
56850715-G-C ***
13489065-C-T 11333389-C-T ***
13466435-T-A 11310759-T-A ***
13474540-C-A 11318864-C-A ***
13378637-T-C 11222961-T-C ***
13474325-A-T 11318649-A-T ***
9984183-T-C 10146574-T-C ***
16919936-G-GT 14808056-G-GT 9×T***
22364651-G-C 20202765-G-C DYZ19 ***
16545414-C-CA 14433534-C-CA 24×A***
9986873-C-G 10149264-C-G ***
13474491-G-A 11318815-G-A ***
6959733-G-GT 7091692-G-GT 9×T***
4008588-C-CA 4140547-C-CA 10×A***
58866062-C-A 56724809-G-T ***
13451479-C-A 11295803-C-A ***
13451455-A-G 11295779-A-G ***
9360939-G-A 9523330-G-A ***
13531753-CAAAA-C 11376077-CAAAA-C 23×A***
5393984-C-CTG 5525943-C-CTG 12×TG***
13607662-G-T 11451986-G-T FGC26089 ***
13688122-G-C 11532446-G-C BY88477 ***
13466530-C-G 11310854-C-G ***
9949465-A-AT 10111856-A-AT 8×T***
58858916-GCATTC-G 56731940-CAATGG-C ***
17580912-T-C 15469032-T-C Y139571 ***
7002892-C-A 7134851-C-A ***
21202094-C-CT 19040208-C-CT 15×T***
16354869-C-CA 14242989-C-CA 13×A***
7125199-CAA-C 7257158-CAA-C 16×A***
13461512-A-G 11305836-A-G ***
13516698-A-G 11361022-A-G ***
7002946-T-C 7134905-T-C ***
7002943-T-C 7134902-T-C ***
7002936-G-A 7134895-G-A FTA3055 ***
7002927-T-A 7134886-T-A ***
7002914-A-G 7134873-A-G ***
18596061-A-AAC 16484181-A-AAC 16×AC***
13520080-A-G 11364404-A-G ***
13469493-C-G 11313817-C-G ***
13469487-A-G 11313811-A-G ***
28547088-T-TA 26400941-T-TA 14×A***
26320658-T-TA 24174511-T-TA P1_Y1 14×A***
6427695-TA-T 6559654-TA-T 10×A***
22466038-C-T 20304152-C-T DYZ19 ***
6293347-C-CTTTTTT 6425306-C-CTTTTTT IR3_Dst 15×T***
13466591-C-A 11310915-C-A ***
22505733-T-G 20343847-T-G DYZ19 ***
9977615-C-A 10140006-C-A ***
9977603-A-T 10139994-A-T ***
13471872-G-A 11316196-G-A ***
10037704-C-T 10200095-C-T FT376729 ***
6892888-C-CT 7024847-C-CT 10×T***
13449054-AATGAG-A 11293378-AATGAG-A ***
13451476-TTCCATTCTATTCTGC-T 11295800-TTCCATTCTATTCTGC-T ***
22508449-G-T 20346563-G-T DYZ19 ***
13480840-C-A 11325164-C-A ***
13464552-C-T 11308876-C-T ***
9997063-A-C 10159454-A-C A11740 ***
13346071-CA-C 11190395-CA-C 18×A***
13474316-G-A 11318640-G-A BY85936 ***
27482837-AT-A 25336690-AT-A P1_Y2 16×T***
7002885-G-T 7134844-G-T ***
13489665-G-C 11333989-G-C ***
13475265-C-A 11319589-C-A ***
13488870-C-A 11333194-C-A ***
58869200-C-G 56721671-G-C ***
7258755-CA-C 7390714-CA-C 25×A***
10068347-A-C 10230738-A-C ***
13468149-T-A,G 11312473-T-A,G ***
28813664-T-C 26667517-T-C BY188751 ***
22508036-G-T 20346150-G-T DYZ19 ***
13489718-C-A 11334042-C-A ***
7002998-G-T 7134957-G-T ***
7002903-T-G 7134862-T-G ***
7002896-T-A 7134855-T-A ***
13468489-T-A 11312813-T-A ***
13468395-C-T 11312719-C-T ***
13468463-C-T 11312787-C-T ***
13466545-C-T 11310869-C-T ***
13601982-AACAC-A 11446306-AACAC-A 14×AC***
23158148-G-GA 20996262-G-GA 10×A***
15191680-C-CT 13079766-C-CT 9×T***
13480939-C-G 11325263-C-G ***
2813410-C-CT 2945369-C-CT 10×T***
13745060-G-T 11589384-G-T ***
13405142-G-GT 11249466-G-GT 12×T***
9034372-TA-T 9196763-TA-T 11×A***
13404381-G-A 11248705-G-A ***
10062586-G-A 10224977-G-A ***
13468457-G-A 11312781-G-A ***
13468448-C-T 11312772-C-T ***
9444689-CAA-C 9607080-CAA-C 14×A***
13468300-T-C 11312624-T-C ***
26328771-A-C 24182624-A-C P1_Y1 ***
56756928-G-A ***
26494330-A-AT 24348183-A-AT P1_Y1 13×T***
11031327-A-T ***
10625034-G-A ***
8428944-CAAAAAA-C 8560903-CAAAAAA-C 25×A***
13480183-T-A 11324507-T-A ***
10982258-G-A ***
2841104-CT-C,CTT 2973063-CT-C,CTT 17×T***
19333229-ATTTT-A,ATTT 17221349-ATTTT-A,ATTT 21×T***
8449678-C-CA 8581637-C-CA 10×A***
28811123-G-T 26664976-G-T ***
10958873-G-T ***
13474714-T-A 11319038-T-A ***
56756929-G-T ***
17932405-CAA-C 15820525-CAA-C 13×A***
3706712-T-A 3838671-T-A 8×TA***
18277996-C-A 16166116-C-A P6_Prx ***
13480771-G-A 11325095-G-A ***
18614437-C-CA 16502557-C-CA 9×A***
7769254-C-CT 7901213-C-CT 10×T***
11029569-G-A ***
11029567-C-G ***
11029563-C-A ***
11029562-C-A ***
11029537-T-G ***
10763127-A-T BY174690 ***
22561390-T-TA 20399504-T-TA 10×A***
19530312-CT-C 17418432-CT-C 11×T***
13489045-A-T 11333369-A-T ***
10651642-G-T ***
14203430-CAA-C 12082724-CAA-C 23×A***
15364059-CAAAAA-C 13252179-CAAAAA-C 21×A***
16608673-GGTGT-G 14496793-GGTGT-G 16×GT***
11034878-G-T ***
11034857-TCCATGA-T ***
11034839-C-A ***
13466303-T-A 11310627-T-A ***
11003720-T-TTCCAC ***
13468112-C-A 11312436-C-A ***
10763095-C-G ***
6539540-GA-G 6671499-GA-G 9×A***
13489322-T-C 11333646-T-C ***
28812630-G-T 26666483-G-T ***
16305924-C-CAA 14194044-C-CAA 24×A***
24381008-ATT-A 22234861-ATT-A 12×T***
17199546-AT-A 15087666-AT-A 9×T***
13468189-G-C 11312513-G-C ***
13489061-C-G 11333385-C-G ***
3628360-A-AGT 3760319-A-AGT ***
24636349-CTT-C 22490202-CTT-C P3_t2 17×T***
13499276-T-C 11343600-T-C ***
4869617-C-CT 5001576-C-CT 10×T***
16485800-C-CA 14373920-C-CA 10×A***
10958883-G-T FT438214 ***
14992933-T-TCA 12881018-T-TCA 11×CA***
13460516-C-T 11304840-C-T ***
10997212-A-C ***
10997205-A-T ***
10997191-T-A ***
10997184-G-C ***
10997182-T-A ***
10997179-T-C ***
13489042-C-A 11333366-C-A ***
2842003-C-CT 2973962-C-CT 14×T***
15969956-TAAA-T 13858076-TAAA-T 20×A***
13531498-G-GA 11375822-G-GA 10×A***
14933566-CTT-C 12821631-CTT-C 16×T***
13480645-G-A 11324969-G-A ***
10820388-C-G ***
22800921-CT-C 20639035-CT-C 10×T***
22115447-CTT-C 19953561-CTT-C 12×T***
9852715-C-CA 10015106-C-CA 12×A***
6928381-CT-C 7060340-CT-C 10×T***
21435190-CTT-C 19273304-CTT-C 15×T***
15749575-CTTT-C 13637695-CTTT-C 15×T***
8602218-A-AT 8734177-A-AT 11×T***
56851094-T-G ***
56851046-C-G ***
10807356-A-G ***
10987276-A-G ***
10673173-T-C ***
56833326-C-CCTTCCACTCA ***
19286405-CA-C 17174525-CA-C 11×A***
10913859-A-G ***
10913845-G-C ***
10913842-G-T ***
10913841-G-T ***
10913839-T-A ***
13489140-C-T 11333464-C-T ***
13489135-G-C 11333459-G-C ***
14464165-A-ATT 12343438-A-ATT 18×T***
13695492-G-T 11539816-G-T ***
11030253-C-A ***
56724776-A-T ***
15049918-CAA-C 12938009-CAA-C 18×A***
10908287-T-G ***
10673192-C-A ***
5581941-A-AT 5713900-A-AT 12×T***
10826951-T-C ***
10994345-C-T ***
13471959-C-T 11316283-C-T ***
13471952-C-G 11316276-C-G ***
15593274-CAAA-C 13481394-CAAA-C 23×A***
13478427-G-T 11322751-G-T ***
13478411-C-A 11322735-C-A ***
2892719-A-AT 3024678-A-AT 10×T***
13461069-G-T 11305393-G-T ***
17861334-ATT-A 15749454-ATT-A 13×T***
13688151-C-G 11532475-C-G ***
13465122-C-A 11309446-C-A ***
8705698-CTTT-C 8837657-CTTT-C 16×T***
13460540-G-A 11304864-G-A ***
10826950-G-A ***
10673203-CTCCTT-C ***
10826948-T-C ***
10651626-T-A ***
15557469-TA-T 13445589-TA-T 10×A***
10958843-T-C ***
56835997-C-T ***
23013378-AT-A 20851492-AT-A 9×T***
7158033-C-CA 7289992-C-CA 10×A***
4922309-CTT-C 5054268-CTT-C 14×T***
18162897-CTT-C 16051017-CTT-C 13×T***
56832905-CCTCCACTCCA-C ***
15104915-C-CA 12993003-C-CA 10×A***
10912937-A-G ***
6983589-CTGTG-C 7115548-CTGTG-C 20×TG***
14745420-CTT-C 12633489-CTT-C 12×T***
11332083-C- ***

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 3434631551726693493488176275
Used in age calculations1551726693493488176275
Counts of SNPs00
Variant counts last updated 2022-08-14 03:01:01.



Big Tree Main Page