Tree Position

R-U106/S21 > Z2265 > Z381/S263 > S264/Z156 > S5520 > BY12135 > FGC11660 > FGC11674 > FGC14326 > BY59371 > BY189214

Unique Mutations

The mutations unique to this man are summarized in the table below. Those with a '+' or '*' confidence level are considered by FamilyTreeDNA or FullGenomesCorp to be high quality SNPs/INDELs. For completeness, all other mutations of lesser confidence are included as well. These additional mutations may be useful for distinguishing between very closely related men.

Occasionally, some of the mutations listed here will be thought to be shared with other men in which case they might appear in upstream blocks on the tree. When this happens, the 'Blocks' field will indicate what block they appear in. Such a situation might arise with BigY men if the BED data suggests another man may be positive for a SNP, even though it doesn't appear in his VCF data. It might also happen if Chromo2 testing or Sanger sequencing of other men not on the tree show the SNP to be shared.

POS-REF-ALT (hg19) POS-REF-ALT (hg38) Blocks Names Region McDonald BED combBED STRKane-BY3
591172
17618763-C-T 15506883-C-T Y+
10746064-G-T FT85379 +
6008062-C-T 6140021-C-T +
21997940-G-A 19836054-G-A Y+
17618768-C-T 15506888-C-T Y+
17618764-C-T 15506884-C-T Y+
15744518-C-G 13632638-C-G FT22244 YY+
4636105-AAAT-A 4768064-AAAT-A +
18389334-C-T 16277454-C-T FT24242 P6_Gap +
2975515-C-T 3107474-C-T FT14755 +
5416522-A-T 5548481-A-T FT17542 +
3257375-C-T 3389334-C-T FT15080 +
11646952-G-A FT85378 +
17618762-C-T 15506882-C-T Y+
19138043-AATATATATATTCCACTATATATATAT-A 17026163-AATATATATATTCCACTATATATATAT-A +
15463403-AT-A 13351523-AT-A 10×T*
10032418-T-C 10194809-T-C Y*
10051654-T-C 10214045-T-C *
10627559-T-A *
10679708-T-TCAGAAGATCTCACTCTGTCACTCAGGTTGGAGTGCAGTCGCATAA *
10752507-T-C *
10903488-T-C *
10937828-TTAATTCCACTG-T *
10032411-G-A 10194802-G-A Y*
9960873-T-C 10123264-T-C Y*
10023935-T-C 10186326-T-C Y*
8768498-AACTTGAAGCTGGGAGGCAGGGGAATC-A 8900457-AACTTGAAGCTGGGAGGCAGGGGAATC-A *
8648085-G-A 8780044-G-A YY*
8692848-C-T 8824807-C-T Y*
8725759-TCACACA-T,TCACA 8857718-TCACACA-T,TCACA 19×CA*
8752872-G-A 8884831-G-A YY*
8752877-G-A 8884836-G-A YY*
8758881-A-AT 8890840-A-AT *
8758883-A-T 8890842-A-T YY*
9361168-GACACACAC-G,GACACAC 9523559-GACACACAC-G,GACACAC 12×AC*
10023916-T-C 10186307-T-C Y*
9735942-G-T 9898333-G-T IR3_Prx *
9756286-AT-A 9918677-AT-A 9×T*
9791920-AT-A 9954311-AT-A 8×T*
9837925-T-G 10000316-T-G YY*
9838708-A-C 10001099-A-C YY*
9951111-A-G 10113502-A-G Y*
11001977-C-T FT227895 *
10982036-ATTCCATTCCATTCCATTCCATTCAATTCCACTAAATCCACTCCACTCCAATCCATTCCAGTTCACTTCACTCCTTTCCAGTCCACGCAACTCCT-A *
11020764-T-A *
11007389-T-C *
13809846-A-G 11689140-A-G *
13526300-C-T 11370624-C-T *
13565570-A-G 11409894-A-G *
13566783-A-G 11411107-A-G *
13589021-G-T 11433345-G-T *
13618030-T-C 11462354-T-C *
13809812-TCGAAC-T 11689106-TCGAAC-T *
13809829-G-C 11689123-G-C *
13809856-A-G 11689150-A-G *
13497043-T-A 11341367-T-A *
13874839-TTC-T 11754133-TTC-T *
13887449-T-C 11766743-T-C YY*
13933985-C-T 11813279-C-T Y*
14177421-G-T 12056715-G-T YY*
14280236-CT-C 12159530-CT-C 9×T*
14286760-C-T 12166054-C-T YY*
14301636-A-G 12180930-A-G YY*
13503530-C-T 11347854-C-T *
13489535-T-C 11333859-T-C *
11020760-T-A *
13266650-A-C 11110974-A-C *
11020761-T-A *
8467821-TTGTGTG-T 8599780-TTGTGTG-T 11×TG*
13204426-ATGG-A 11048750-ATGG-A *
13205335-A-G 11049659-A-G *
13217492-C-A 11061816-C-A *
13253394-C-CA 11097718-C-CA *
13264127-A-G 11108451-A-G *
13267597-CAA-C 11111921-CAA-C 11×A*
13481342-TGTTACATCACCTGGGTGATCCGTGCAGAGATATCTCACAATACACCCTGTAAGCAGAGCCTAGAAAAGA-T 11325666-TGTTACATCACCTGGGTGATCCGTGCAGAGATATCTCACAATACACCCTGTAAGCAGAGCCTAGAAAAGA-T *
13296355-A-T 11140679-A-T *
13315051-C-A 11159375-C-A *
13331465-C-T 11175789-C-T *
13359961-C-A 11204285-C-A *
13448896-G-GTCCAC,GTCCATTCCATTCCAGTCCACTCCAT 11293220-G-GTCCAC,GTCCATTCCATTCCAGTCCACTCCAT *
13464446-C-A 11308770-C-A *
13477303-C-T 11321627-C-T *
8559092-T-C 8691051-T-C YY*
7861007-T-C 7992966-T-C Y*
8417965-CAA-C 8549924-CAA-C 11×A*
5417518-GA-G 5549477-GA-G *
5119710-A-G 5251669-A-G *
5140878-T-C 5272837-T-C *
5141289-C-T 5273248-C-T *
5278720-TC-T 5410679-TC-T *
5289090-T-TACAC,TACACACAC 5421049-T-TACAC,TACACACAC 19×AC*
5326721-C-T 5458680-C-T *
5404587-T-C 5536546-T-C *
5422681-A-G 5554640-A-G *
5079912-T-C 5211871-T-C *
5429058-A-G 5561017-A-G *
5480732-C-CTT 5612691-C-CTT 12×T*
5493431-CTTTT-C,CTTTTT 5625390-CTTTT-C,CTTTTT 24×T*
5517961-G-GT 5649920-G-GT 8×T*
5634627-TA-T 5766586-TA-T 8×A*
5736993-G-T 5868952-G-T *
5797318-A-T 5929277-A-T *
5102598-C-T 5234557-C-T *
5060185-A-G 5192144-A-G *
5866341-G-GA 5998300-G-GA *
4674662-T-C 4806621-T-C *
4278705-C-T 4410664-C-T *
4369528-A-T 4501487-A-T *
4377337-AT-A 4509296-AT-A *
4460629-G-A 4592588-G-A *
4510807-G-A 4642766-G-A *
4586380-T-C 4718339-T-C *
4634283-C-T 4766242-C-T FT100410 *
4742565-AT-A 4874524-AT-A *
5047499-T-C 5179458-T-C *
4834245-TA-T,TAAA 4966204-TA-T,TAAA 23×A*
4896649-CA-C,CAA 5028608-CA-C,CAA 16×A*
4978441-C-T 5110400-C-T *
5035558-TTG-T,TTGTG 5167517-TTG-T,TTGTG 22×TG*
5035694-G-A 5167653-G-A *
5046194-T-C 5178153-T-C *
5047307-T-C 5179266-T-C *
5801566-C-T 5933525-C-T *
5907529-A-G 6039488-A-G *
8097301-C-T 8229260-C-T BY40634 YY*
7378948-C-T 7510907-C-T Y*
7222003-T-A 7353962-T-A Y*
7275188-T-A 7407147-T-A YY20×A*
7296402-C-T 7428361-C-T Y*
7378938-TC-T 7510897-TC-T *
7378940-C-T 7510899-C-T Y*
7378942-C-T 7510901-C-T FTB9583 Y*
7378947-C-T 7510906-C-T Y*
7378973-C-T 7510932-C-T Y*
7075968-T-C 7207927-T-C YY*
7378979-C-T 7510938-C-T Y*
7390916-T-TA 7522875-T-TA 8×A*
7432202-A-G 7564161-A-G Y*
7473509-G-T 7605468-G-T IR1_L *
7783774-A-G 7915733-A-G YY*
14456103-T-C 12335376-T-C YY*
7971604-C-A 8103563-C-A YY*
7076117-G-T 7208076-G-T YY*
7063802-C-T 7195761-C-T YY*
5937103-C-G 6069062-C-G *
6047272-GAA-G 6179231-GAA-G 11×A*
5949217-CA-C 6081176-CA-C *
5949231-G-A 6081190-G-A *
5949241-C-T 6081200-C-T *
5977109-AT-A 6109068-AT-A *
6020697-T-TTTG 6152656-T-TTTG *
6046182-A-G 6178141-A-G *
6046443-T-C 6178402-T-C *
6194293-A-G 6326252-A-G IR3_Dst *
7020679-C-G 7152638-C-G Y*
6432160-GAA-G 6564119-GAA-G 11×A*
6445882-T-C 6577841-T-C *
6516511-T-C 6648470-T-C *
6525488-C-T 6657447-C-T *
6538495-G-A 6670454-G-A *
6607981-A-ATT 6739940-A-ATT 11×T*
6720402-T-A 6852361-T-A YY*
14450525-A-G 12329798-A-G YY*
14612971-C-G 12501169-C-G YY*
14514249-G-A 12402454-G-A Y*
22102559-A-G 19940673-A-G YY*
21718078-GAA-G 19556192-GAA-G 10×A*
21775247-A-G 19613361-A-G YY*
21837775-G-GA,GAA 19675889-G-GA,GAA 10×A*
21873317-A-G 19711431-A-G YY*
21887763-A-T 19725877-A-T Y*
21990935-G-A 19829049-G-A YY*
22128101-T-C 19966215-T-C YY*
21348450-T-C 19186564-T-C Y*
22168546-TC-T 20006660-TC-T *
22171441-AT-A 20009555-AT-A *
22293924-A-G 20132038-A-G DYZ19 *
22478665-A-G 20316779-A-G DYZ19 *
22528234-T-C 20366348-T-C Y*
22536112-T-C 20374226-T-C Y*
22536181-T-C 20374295-T-C Y*
21714839-G-A 19552953-G-A YY*
21323841-C-G 19161955-C-G Y*
22698768-T-C 20536882-T-C YY*
20783463-C-A 18621577-C-A P4_Prx *
19409417-G-T 17297537-G-T YY*
19512236-A-G 17400356-A-G YY*
19556754-T-C 17444874-T-C Y*
19562704-A-C 17450824-A-C FT348120 Y*
19622110-G-GCA,GCACA 17510230-G-GCA,GCACA P5_Prx 23×CA*
20423328-CA-C 18261442-CA-C P5_Dst *
20603722-TC-T 18441836-TC-T P5_Dst *
20804789-A-G 18642903-A-G P4_Gap *
21245347-C-T 19083461-C-T Y*
21033584-A-G 18871698-A-G Y*
21054492-A-G 18892606-A-G YY*
21127552-T-C 18965666-T-C YY*
21132670-T-C 18970784-T-C YY*
21134756-A-ATT 18972870-A-ATT 12×T*
21208384-T-C 19046498-T-C Y*
21227184-T-C 19065298-T-C YY*
22537747-A-G 20375861-A-G Y*
22700761-A-C 20538875-A-C YY*
19388027-T-C 17276147-T-C Y*
28620677-C-T 26474530-C-T Y*
28492458-AG-A 26346311-AG-A *
28498528-GT-G 26352381-GT-G 8×T*
28500712-T-C 26354565-T-C Y*
28539174-CAAAA-C,CAAAAA 26393027-CAAAA-C,CAAAAA 20×A*
28588082-GA-G 26441935-GA-G *
28604464-C-A 26458317-C-A *
28710092-G-C 26563945-G-C *
27607861-G-A 25461714-G-A P1_Y2 *
28809755-G-A 26663608-G-A *
28809778-T-G 26663631-T-G *
56826906-CCATTCCATTCGATTA-C *
56829766-C-CATTCCATTCCATTCCATTCCATCTCATTGCATGCG *
56834385-T-TTTCATTCCAC *
56875038-C-A *
56875039-C-A *
28472488-A-G 26326341-A-G *
27396929-T-C 25250782-T-C P1_g3 *
22752319-A-G 20590433-A-G YY*
23241789-T-C 21079903-T-C Y*
22837357-A-G 20675471-A-G Y*
22853717-T-C 20691831-T-C Y*
22868392-TA-T 20706506-TA-T *
22868887-C-T 20707001-C-T YY*
22920605-CTT-C,CTTT 20758719-CTT-C,CTTT 25×T*
23019725-G-A 20857839-G-A FT264860 YY*
23039197-A-G 20877311-A-G FT366306 Y*
23307856-T-A 21145970-T-A YY*
24518280-G-A 22372133-G-A *
23464538-T-C 21302652-T-C YY*
23498999-T-C 21337113-T-C YY*
23529104-G-T 21367218-G-T YY*
23545169-G-T 21383283-G-T YY*
23601462-T-C 21439576-T-C Y*
23759138-G-A 21597252-G-A Y*
24355654-A-ATG 22209507-A-ATG *
19390003-A-G 17278123-A-G Y*
19337633-CT-C,C 17225753-CT-C,C 22×T*
14530554-A-C 12418755-A-C YY*
16718393-C-T 14606513-C-T YY*
16000125-C-T 13888245-C-T Y*
16003585-T-C 13891705-T-C Y*
16014472-A-AT 13902592-A-AT 9×T*
16030068-A-G 13918188-A-G Y*
16284176-G-A 14172296-G-A YY*
16675339-A-G 14563459-A-G Y*
16718400-C-T 14606520-C-T YY*
15863757-C-A 13751877-C-A BY104608 YY*
16827084-G-A 14715204-G-A Y*
16829037-G-A 14717157-G-A Y*
16889592-G-A 14777712-G-A YY*
16897680-A-G 14785800-A-G YY*
16928334-G-A 14816454-G-A YY*
17033882-A-G 14922002-A-G YY*
17130400-CTTTTTT-C,CTTTTT 15018520-CTTTTTT-C,CTTTTT 21×T*
15882546-T-C 13770666-T-C YY*
15815497-G-A 13703617-G-A YY*
17242995-A-G 15131115-A-G YY*
14910825-G-T 12798892-G-T YY*
14604576-G-T 12492778-G-T YY*
14610681-C-T 12498883-C-T YY*
4006199-AT-A 4138158-AT-A 8×T*
14819960-C-T 12708027-C-T YY*
14845064-G-A 12733130-G-A YY*
14862957-C-T 12751023-C-T YY*
14903940-A-G 12792007-A-G YY*
12997004-T- *
15694025-T-C 13582145-T-C YY*
15352818-G-GCTGGGATTACAGCACTATTCCAGTTGATAGAAAGAGAGGGAATCCTCCCTA 13240937-G-GCTGGGATTACAGCACTATTCCAGTTGATAGAAAGAGAGGGAATCCTCCCTA *
15358794-G-C 13246914-G-C YY*
15553032-A-T 13441152-A-T YY*
15558431-GAGATAGATAGATAGAT-G,GAGATAGAT 13446551-GAGATAGATAGATAGAT-G,GAGATAGAT 17×AGAT*
15602866-GT-G 13490986-GT-G *
15622725-A-G 13510845-A-G YY*
15660847-G-T 13548967-G-T YY*
17147541-C-A 15035661-C-A YY4×TTCT*
17300797-G-A 15188917-G-A YY*
19281004-G-A 17169124-G-A FTA36804 YY*
18764800-CT-C 16652920-CT-C 8×T*
18384490-C-A,CA 16272610-C-A,CA P6_Gap 19×A*
18423907-G-T 16312027-G-T P6_Gap *
18425332-A-C 16313452-A-C P6_Gap *
18534147-T-C 16422267-T-C P6_Dst *
18578935-A-G 16467055-A-G YY*
18738949-T-C 16627069-T-C YY*
18833071-C-T 16721191-C-T YY*
18255838-T-C 16143958-T-C Y*
18907997-C-T 16796117-C-T YY*
19007916-T-C 16896036-T-C YY*
19130738-CT-C,C 17018858-CT-C,C 33×T*
19214284-T-G 17102404-T-G YY*
19222493-C-T 17110613-C-T YY*
19226188-AATAGATAGATAGATAG-A,AATAGATAG 17114308-AATAGATAGATAGATAG-A,AATAGATAG 14×ATAG*
19251335-A-G 17139455-A-G YY*
18266379-A-G 16154499-A-G *
18219116-G-T 16107236-G-T Y*
17307508-A-AAGAT,AAGATAGAT 15195628-A-AAGAT,AAGATAGAT 11×AGAT*
17518710-C-A 15406830-C-A YY*
17311778-T-C 15199898-T-C YY*
17342974-T-C 15231094-T-C YY*
17379675-A-G 15267795-A-G Y*
17402501-CTT-C,CT 15290621-CTT-C,CT 14×T*
17414310-G-A 15302430-G-A YY*
17482402-G-A 15370522-G-A Y*
17489434-G-A 15377554-G-A YY*
17604931-GT-G,GTTT 15493051-GT-G,GTTT 24×T*
18060138-C-A 15948258-C-A YY*
17622731-C-A 15510851-C-A YY*
17734039-CAA-C 15622159-CAA-C 10×A*
17740452-C-T 15628572-C-T Y*
17846472-T-C 15734592-T-C YY*
17857308-A-G 15745428-A-G Y*
17941913-T-C 15830033-T-C YY*
18007916-G-T 15896036-G-T P7_Gap Y*
4021908-TTTTC-T 4153867-TTTTC-T *
3922150-C-A 4054109-C-A *
4005057-GTTT-G 4137016-GTTT-G 13×T*
15183876-G-T 13071962-G-T YY*
2683179-G-T 2815138-G-T Y*
18818389-G-GAAA 16706509-G-GAAA 17×A*
17854389-C-T 15742509-C-T YY*
21079200-CAT-C 18917314-CAT-C *
19003405-A-ATT 16891525-A-ATT 14×T*
13489813-T-G 11334137-T-G *
19530267-C-A 17418387-C-A YY*
17622714-C-A 15510834-C-A YY*
13547016-C-CT 11391340-C-CT 10×T*
6631480-AT-A 6763439-AT-A 10×T*
13464452-T-C 11308776-T-C *
10820765-A-G *
28603123-AT-A 26456976-AT-A 9×T*
9730658-T-C 9893049-T-C IR3_Prx *
22298442-C-T 20136556-C-T BY216686 DYZ19 *
17709787-G-GTT 15597907-G-GTT 11×T*
17346142-CTT-C,CT 15234262-CTT-C,CT 18×T*
19391703-A-ATT 17279823-A-ATT 14×T*
4895693-TA-T 5027652-TA-T 9×A*
10964889-C-T *
21042925-G-A 18881039-G-A Y*
3857282-C-CT 3989241-C-CT 10×T*
22857966-AT-A 20696080-AT-A 8×T*
10773208-A-T *
7917119-C-A 8049078-C-A YY*
18401248-T-A 16289368-T-A P6_Gap *
21295234-C-CTT 19133348-C-CTT 17×T*
18931131-GA-G 16819251-GA-G 10×A*
10964920-G-T *
5362726-TA-T 5494685-TA-T 9×A*
10937807-T-C *
6087359-AT-A 6219318-AT-A 9×T*
8875170-C-CA 9007129-C-CA 9×A*
17944647-GT-G 15832767-GT-G 10×T*
3201648-G-GA 3333607-G-GA 10×A*
22298444-G-C 20136558-G-C DYZ19 *
24386594-CTA-C 22240447-CTA-C *
13217502-C-G 11061826-C-G *
10985456-C-T *
10930701-C-A *
10757201-C-A *
4254663-TTA-T 4386622-TTA-T *
10851140-A-T *
10954362-A-T *
23298737-G-T 21136851-G-T YY*
3999738-TA-T 4131697-TA-T 8×A*
4035474-T-TACA 4167433-T-TACA *
21054516-A-G 18892630-A-G FT131694 YY*
10756938-T-C *
14356940-A-G 12236235-A-G YY*
14416139-GTA-G 12295436-GTA-G *
17292636-CTT-C 15180756-CTT-C 10×T*
23385818-CA-C 21223932-CA-C 8×A*
20865485-ATG-A 18703599-ATG-A P4_Dst *
8295746-G-A 8427705-G-A Y*
4297284-GT-G 4429243-GT-G 10×T*
2769750-CA-C 2901709-CA-C 8×A*
21214193-T-TA 19052307-T-TA 10×A*
17533824-GAA-G,GA 15421944-GAA-G,GA 21×A*
14772676-ATTT-A,ATT 12660745-ATTT-A,ATT 21×T*
22208867-C-CAA 20046981-C-CAA 14×A*
3834286-GA-G 3966245-GA-G 10×A*
6273791-A-T 6405750-A-T IR3_Dst *
5832456-CAT-C 5964415-CAT-C *
8634381-TACACACACACAC-T 8766340-TACACACACACAC-T 22×AC*
4077506-C-A 4209465-C-A *
3031203-C-T 3163162-C-T FGC80990 *
8452228-CAA-C 8584187-CAA-C 11×A*
13489543-C-A 11333867-C-A *
9113135-T-TA *
3991945-AACAC-A 4123904-AACAC-A 12×AC*
3533207-AT-A 3665166-AT-A 9×T*
7017659-C-A 7149618-C-A Y*
14407169-CTTTT-C 12286467-CTTTT-C 16×T*
14365625-CT-C 12244920-CT-C 9×T*
23773323-TAC-T,TACAC 21611437-TAC-T,TACAC 24×AC*
13217488-A-G 11061812-A-G *
13689915-G-T 11534239-G-T *
20865481-G-A 18703595-G-A P4_Dst *
13888691-T-TG 11767985-T-TG *
15577468-GAC-G 13465588-GAC-G *
16013027-C-T 13901147-C-T Y*
16175584-GCA-G 14063704-GCA-G *
16635364-TAC-T 14523484-TAC-T *
17281742-TAG-T 15169862-TAG-T *
24355621-TACAC-T 22209474-TACAC-T 13×AC*
8566316-GAC-G 8698275-GAC-G *
3791645-ATC-A 3923604-ATC-A 8×TC*
6080638-TTC-T 6212597-TTC-T 9×TC*
6517064-A-G 6649023-A-G *
6517067-T-C 6649026-T-C *
8564009-TAC-T 8695968-TAC-T *
8835741-A-ATTTAT 8967700-A-ATTTAT 5×TTTAT*
13203742-GTGA-G 11048066-GTGA-G 5×TGA*
13447644-AGCTCC-A 11291968-AGCTCC-A *
6346315-CAT-C 6478274-CAT-C *
13687959-G-A 11532283-G-A *
5334178-C-T 5466137-C-T FT273099 *
8565786-A-AT 8697745-A-AT 10×T*
24600670-CA-C 22454523-CA-C P3_t2 16×A*
22318691-C-A 20156805-C-A A10683 DYZ19 *
8422324-C-CTG 8554283-C-CTG 15×TG*
15520169-GA-G 13408289-GA-G 10×A*
13477202-C-T 11321526-C-T *
14533050-A-C 12421251-A-C Y*
3240893-C-T 3372852-C-T K541 *
6336567-GCA-G 6468526-GCA-G IR3_Dst 8×CA*
3318710-C-T 3450669-C-T A7847 *
3443398-G-T 3575357-G-T *
3443404-T-TAAAG 3575363-T-TAAAG *
3742475-TTA-T 3874434-TTA-T *
3920475-T-C 4052434-T-C *
3923867-G-A 4055826-G-A *
5371726-C-CGT 5503685-C-CGT 10×GT*
13513152-C-A 11357476-C-A BY26235 8×A*
14067620-TAC-T 11946914-TAC-T *
5170787-CT-C 5302746-CT-C 10×T*
6250518-TCA-T 6382477-TCA-T IR3_Dst 8×CA*
5949242-A-G 6081201-A-G *
59030570-T-TAATATA 56884423-T-TAATATA *
7645202-A-ATTT 7777161-A-ATTT 17×T*
27860967-CTTG-C 25714820-CTTG-C P1_Y2 5×TTG*
16908451-TAAA-T,TAA 14796571-TAAA-T,TAA 21×A*
24386820-CTA-C 22240673-CTA-C *
7360567-TAA-T 7492526-TAA-T 13×A*
16957758-T-C 14845878-T-C FT102195 YY*
22149183-AT-A 19987297-AT-A 9×T*
17956056-CTTT-C 15844176-CTTT-C 13×T*
56860299-G-T *
23590790-C-A 21428904-C-A YY*
23772621-AT-A 21610735-AT-A 8×T*
18401237-G-T 16289357-G-T P6_Gap *
56832819-C-T *
16739069-GAA-G 14627189-GAA-G 17×A*
13469426-A-T 11313750-A-T *
20065443-C-T 17953563-C-T Y105151 P5_Gap *
14375011-AAG-A 12254307-AAG-A *
21844894-TA-T 19683008-TA-T BY33829 9×A*
16957277-CTG-C 14845397-CTG-C *
17106925-TAC-T 14995045-TAC-T *
18182744-ATC-A 16070864-ATC-A *
18698807-GCA-G 16586927-GCA-G *
24386482-CTA-C 22240335-CTA-C *
59007163-C-T 56861016-C-T *
59021248-C-T 56875101-C-T *
23265606-CTTT-C 21103720-CTTT-C 15×T*
15641926-T-TA 13530046-T-TA 8×A*
13809957-A-T 11689251-A-T *
15818409-G-T 13706529-G-T PF6129 YY*
21766566-A-G 19604680-A-G YY*
13489558-TG-T 11333882-TG-T *
19758818-A-T 17646938-A-T P5_Prx *
9403521-GTTTTTTT-G 9565912-GTTTTTTT-G 21×T*
58976176-A-T 56830029-A-T *
5265902-A-AT 5397861-A-AT 9×T*
24458760-CA-C,CAA 22312613-CA-C,CAA 18×A*
3957342-A-G 4089301-A-G *
13448910-A-AGTCCACTCCACTCCACTCCC 11293234-A-AGTCCACTCCACTCCACTCCC *
2827953-G-C 2959912-G-C YY*
3980500-G-T 4112459-G-T *
56832948-C-CCGCTG *
13450172-CACTCCATT-C 11294496-CACTCCATT-C *
13450181-GCA-CCA,G 11294505-GCA-CCA,G *
56834390-T-TTCTATTCCAC *
13489686-CAT-C 11334010-CAT-C *
5826453-A-G 5958412-A-G *
2827954-T-A 2959913-T-A YY*
5252833-A-AT 5384792-A-AT 16×T*
13450193-T-TCTCCA 11294517-T-TCTCCA *
13449514-C-CCAT 11293838-C-CCAT *
56831617-A- *
56831619-TCCTCTCTATTTCACTCCACTC- *
56831673-CTAAACTCGA- *
23488873-AGTT-A 21326987-AGTT-A *
18653684-CA-C,CAA 16541804-CA-C,CAA 20×A*
23593798-TCACA-T 21431912-TCACA-T 11×CA*
9429672-A-T 9592063-A-T Y*
10985447-TCCC-T *
10985452-TCA-T *
13470223-C-T 11314547-C-T *
17402527-G-T 15290647-G-T YY*
56830019-AT-A *
56830021-CCCAT-C *
10632823-ATTCCATTCCTTTTCTTCGACAGGATCTCGCTCTGTCACTCAGGCTGGAGTGCAGTGGCACAATCTCAGCTCACATTTCATTTCACCATTCC-A,A *
9429673-A-T 9592064-A-T Y*
13452075-C-CTCCACTCCAA,CTCCACTCCAATCCAA 11296399-C-CTCCACTCCAA,CTCCACTCCAATCCAA *
13204374-TTATGATAATGGTGGTGATGGTG-T 11048698-TTATGATAATGGTGGTGATGGTG-T *
4464429-GT-G 4596388-GT-G 10×T*
13204353-T-C 11048677-T-C *
13204356-TGGTG-T 11048680-TGGTG-T *
13204361-ATGATG-A 11048685-ATGATG-A *
4564938-TA-T 4696897-TA-T 10×A*
5933233-CA-C,CAA 6065192-CA-C,CAA 18×A*
5904059-G-T 6036018-G-T *
9013409-AT-A 9175800-AT-A 10×T*
10985432-TCAAA-T *
3757889-G-A 3889848-G-A *
3482590-CAAA-C,CAA 3614549-CAAA-C,CAA 22×A*
3500149-G-A 3632108-G-A *
3508197-TA-T 3640156-TA-T 8×A*
3557284-G-T 3689243-G-T *
3620873-G-T 3752832-G-T *
3671327-G-A 3803286-G-A *
3745923-A-T 3877882-A-T *
3788671-T-TAA 3920630-T-TAA 13×A*
3477851-GGT-G,GGTGT 3609810-GGT-G,GGTGT 17×GT*
3809146-T-C 3941105-T-C *
3892063-GCT-G 4024022-GCT-G *
3892066-T-TAA 4024025-T-TAA *
3892070-T-TCA 4024029-T-TCA *
3897595-G-T 4029554-G-T *
3912106-T-C 4044065-T-C *
8261193-AAT-A 8393152-AAT-A *
3479407-T-C 3611366-T-C *
3454208-T-C 3586167-T-C *
10757170-C-CT,CT *
3098022-T-C 3229981-T-C *
2649886-G-T 2781845-G-T Y*
2822963-G-A 2954922-G-A YY*
2845646-T-C 2977605-T-C YY*
2909234-C-CAAA 3041193-C-CAAA 16×A*
2975627-A-G 3107586-A-G *
3005295-G-A 3137254-G-A *
3039839-CTTTT-C,CTTT 3171798-CTTTT-C,CTTT 22×T*
3112498-AT-A 3244457-AT-A *
3451956-C-T 3583915-C-T *
3112622-A-G 3244581-A-G *
3204009-T-C 3335968-T-C *
3253818-C-T 3385777-C-T *
3255354-T-G 3387313-T-G *
3266618-G-A 3398577-G-A *
3266619-G-A 3398578-G-A *
3301256-TATAC-T 3433215-TATAC-T *
10985441-T-A *
10985429-CA-C *
17302875-G-GA 15190995-G-GA 9×A*
5493864-GT-G,GTT 5625823-GT-G,GTT 22×T*
3451063-C-G 3583022-C-G *
4897963-CA-C,CAA 5029922-CA-C,CAA 20×A*
28458910-TA-T 26312763-TA-T 10×A*
13470198-G-T 11314522-G-T *
13477292-G-A 11321616-G-A *
3322618-A-T 3454577-A-T *
23098816-CAAA-C,CAA 20936930-CAAA-C,CAA 25×A*
13477257-C-T 11321581-C-T *
18109358-TA-T,TAA 15997478-TA-T,TAA 23×A*
20804004-TTGTGTG-T 18642118-TTGTGTG-T P4_Gap 19×TG*
5756916-GTATA-G 5888875-GTATA-G 8×TA*
4282604-CAT-C 4414563-CAT-C *
18177995-T-C 16066115-T-C YY*
18177996-G-A 16066116-G-A YY*
6532479-C-A 6664438-C-A *
14010016-TA-T 11889310-TA-T 9×A*
18737329-C-CT 16625449-C-CT 8×T*
22298453-G-A 20136567-G-A DYZ19 *
17632570-GT-G,GTTT 15520690-GT-G,GTTT 22×T*
6861416-T-TAA 6993375-T-TAA 12×A*
15022389-A-AT 12910478-A-AT 10×T*
7646440-T-G 7778399-T-G YY*
10964919-G-A *
7220641-C-A 7352600-C-A YY*
19449452-G-T 17337572-G-T YY*
18152921-GT-G 16041041-GT-G 10×T*
5204664-G-T 5336623-G-T *
4487816-G-GAA 4619775-G-GAA 19×A*
6013611-C-A 6145570-C-A 13×T*
2840091-T-A 2972050-T-A YY*
10684704-TTCCAC-T *
10032416-C-G 10194807-C-G Y*
16141929-C-A 14030049-C-A P8_Dst *
3837743-CA-C 3969702-CA-C 9×A*
5096093-C-CT 5228052-C-CT 11×T*
3322619-A-T 3454578-A-T *
8157547-T-C 8289506-T-C YY*
56828041-T-A *
5519905-TAAA-T 5651864-TAAA-T 13×A*
10632799-TC-T,T *
10632802-ATTCCATTCCACTCCAT-A,A *
13204261-C-CATGATGGTAGTGATAATGGTGATGGTGATGGGGATGGTATTGGTGATGATAGTGGTGATTATGAGGATGGTGGTGATGATGGTGATGGTGACAATAATGGTGATAATGATGGTATTATGATAGTGATGATGGTGGTGATGGTGATGATAATGGTGATAATGACGGT 11048585-C-CATGATGGTAGTGATAATGGTGATGGTGATGGGGATGGTATTGGTGATGATAGTGGTGATTATGAGGATGGTGGTGATGATGGTGATGGTGACAATAATGGTGATAATGATGGTATTATGATAGTGATGATGGTGGTGATGGTGATGATAATGGTGATAATGACGGT *
24501353-G-A 22355206-G-A *
13450267-ACC-A 11294591-ACC-A *
56834817-C-CTCCACTCCAT *
19189750-C-CTT 17077870-C-CTT 11×T*
16013006-T-C 13901126-T-C Y*
5867467-C-A 5999426-C-A *
9646148-CA-C 9808539-CA-C IR3_Prx 9×A*
13450270-ATTCCATTCCATTGCATTC-A 11294594-ATTCCATTCCATTGCATTC-A *
16934901-G-GA 14823021-G-GA 10×A*
56827973-CCAG-C *
56827977-TCCATTCCTTTCAAGTCCATTCAATTCCATTCCGTTCGAATTC-T *
56828033-C-A *
56828034-C-A *
10632777-ACTCCTGTCCTCTTCT-A,A *
5483618-C-A 5615577-C-A *
13477227-C-A 11321551-C-A *
18780110-G-A 16668230-G-A FT139952 YY*
28500806-CTTTT-C,CTTT 26354659-CTTTT-C,CTTT 18×T*
5253212-G-T 5385171-G-T *
5243395-AT-A 5375354-AT-A 12×T*
6147446-ATTT-A 6279405-ATTT-A IR3_Dst 19×T*
18984973-G-T 16873093-G-T YY*
3640853-C-A 3772812-C-A *
10032425-A-G 10194816-A-G Y*
56886095-CAA-C 11×A*
13477294-C-T 11321618-C-T *
10771769-C-G *
8405334-GA-G 8537293-GA-G 10×A*
22127975-CTTT-C,CTT 19966089-CTTT-C,CTT 20×T*
4829207-A-G 4961166-A-G *
3077778-CA-C 3209737-CA-C 10×A*
13477232-C-G 11321556-C-G *
13477259-G-T 11321583-G-T *
56879382-T-C *

In the table above, the meaning of the confidence field depends on whether the data comes from an FTDNA kit or an FGC kit. For FTDNA kits, + implies a "PASS" result with just one possible variant, * indicates a "PASS" but with multiple variants, ** indicates "REJECTED" with just a single variant, and *** indicates "REJECTED" with multiple possible variants. 'A*' are heterozygous variants not called by FTDNA, but still pulled from the VCF file. For FGC kits, + indicates over 99% likely genuine (95% for INDELs); * over 95% likely genuine (90% for INDELs); ** about 40% likely genuine; *** about 10% likely genuine. Manual entries read directly from a BAM file will be either + indicating positive, or * indicating that the data show a mixture of possible variants.

For the FTDNA kits, the BED data is encoded in the background color of the cells. Those cells with a white background have coverage, those with a grey background indicate no coverage in the BED file, and those with a pink background indicate the mutation is on the edge of a coverage region. These pink regions often indicate that the individual may be positive for a SNP even if there is no corresponding entry in the vcf file.

The combBED column indicates whether or not the mutation is a SNP and falls in the combBED region defined in Defining a New Rate Constant for Y-Chromosome SNPs based on Full Sequencing Data by Dmitry Adamov, Vladimir Guryanov, Sergey Karzhavin, Vladimir Tagankin, Vadim Urasin.

The McDonald BED column indicates whether or not the mutation is a SNP and falls in the BED region used by Dr. Iain McDonald in the age analysis he does for R-U106 men.

Age Analysis Information (work in progress)

AllMcDonaldYFull
Kit: 5911721471975291766138213009
Used in age calculations1471975291766138213009
Counts of SNPs182120
Variant counts last updated 2022-06-12 04:18:07.



Big Tree Main Page